ID: 1002523488

View in Genome Browser
Species Human (GRCh38)
Location 5:179803800-179803822
Sequence GTCATTTCCCTACACACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002523481_1002523488 -2 Left 1002523481 5:179803779-179803801 CCCGCCCACACCAACCCTTCTGT 0: 1
1: 0
2: 4
3: 30
4: 359
Right 1002523488 5:179803800-179803822 GTCATTTCCCTACACACTGCAGG No data
1002523478_1002523488 9 Left 1002523478 5:179803768-179803790 CCCCACGGGCTCCCGCCCACACC 0: 1
1: 0
2: 0
3: 23
4: 328
Right 1002523488 5:179803800-179803822 GTCATTTCCCTACACACTGCAGG No data
1002523480_1002523488 7 Left 1002523480 5:179803770-179803792 CCACGGGCTCCCGCCCACACCAA 0: 1
1: 0
2: 1
3: 22
4: 336
Right 1002523488 5:179803800-179803822 GTCATTTCCCTACACACTGCAGG No data
1002523484_1002523488 -7 Left 1002523484 5:179803784-179803806 CCACACCAACCCTTCTGTCATTT 0: 1
1: 1
2: 4
3: 33
4: 381
Right 1002523488 5:179803800-179803822 GTCATTTCCCTACACACTGCAGG No data
1002523479_1002523488 8 Left 1002523479 5:179803769-179803791 CCCACGGGCTCCCGCCCACACCA 0: 1
1: 0
2: 3
3: 105
4: 2351
Right 1002523488 5:179803800-179803822 GTCATTTCCCTACACACTGCAGG No data
1002523482_1002523488 -3 Left 1002523482 5:179803780-179803802 CCGCCCACACCAACCCTTCTGTC 0: 1
1: 0
2: 2
3: 42
4: 421
Right 1002523488 5:179803800-179803822 GTCATTTCCCTACACACTGCAGG No data
1002523475_1002523488 24 Left 1002523475 5:179803753-179803775 CCAGGAGATAAAGGGCCCCACGG 0: 1
1: 0
2: 2
3: 13
4: 82
Right 1002523488 5:179803800-179803822 GTCATTTCCCTACACACTGCAGG No data
1002523483_1002523488 -6 Left 1002523483 5:179803783-179803805 CCCACACCAACCCTTCTGTCATT 0: 1
1: 0
2: 1
3: 17
4: 219
Right 1002523488 5:179803800-179803822 GTCATTTCCCTACACACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002523488 Original CRISPR GTCATTTCCCTACACACTGC AGG Intronic
No off target data available for this crispr