ID: 1002523489

View in Genome Browser
Species Human (GRCh38)
Location 5:179803806-179803828
Sequence TCCCTACACACTGCAGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 308}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002523484_1002523489 -1 Left 1002523484 5:179803784-179803806 CCACACCAACCCTTCTGTCATTT 0: 1
1: 1
2: 4
3: 33
4: 381
Right 1002523489 5:179803806-179803828 TCCCTACACACTGCAGGCCCTGG 0: 1
1: 1
2: 2
3: 24
4: 308
1002523479_1002523489 14 Left 1002523479 5:179803769-179803791 CCCACGGGCTCCCGCCCACACCA 0: 1
1: 0
2: 3
3: 105
4: 2351
Right 1002523489 5:179803806-179803828 TCCCTACACACTGCAGGCCCTGG 0: 1
1: 1
2: 2
3: 24
4: 308
1002523485_1002523489 -6 Left 1002523485 5:179803789-179803811 CCAACCCTTCTGTCATTTCCCTA 0: 1
1: 0
2: 2
3: 30
4: 346
Right 1002523489 5:179803806-179803828 TCCCTACACACTGCAGGCCCTGG 0: 1
1: 1
2: 2
3: 24
4: 308
1002523486_1002523489 -10 Left 1002523486 5:179803793-179803815 CCCTTCTGTCATTTCCCTACACA 0: 1
1: 0
2: 1
3: 20
4: 344
Right 1002523489 5:179803806-179803828 TCCCTACACACTGCAGGCCCTGG 0: 1
1: 1
2: 2
3: 24
4: 308
1002523481_1002523489 4 Left 1002523481 5:179803779-179803801 CCCGCCCACACCAACCCTTCTGT 0: 1
1: 0
2: 4
3: 30
4: 359
Right 1002523489 5:179803806-179803828 TCCCTACACACTGCAGGCCCTGG 0: 1
1: 1
2: 2
3: 24
4: 308
1002523475_1002523489 30 Left 1002523475 5:179803753-179803775 CCAGGAGATAAAGGGCCCCACGG 0: 1
1: 0
2: 2
3: 13
4: 82
Right 1002523489 5:179803806-179803828 TCCCTACACACTGCAGGCCCTGG 0: 1
1: 1
2: 2
3: 24
4: 308
1002523478_1002523489 15 Left 1002523478 5:179803768-179803790 CCCCACGGGCTCCCGCCCACACC 0: 1
1: 0
2: 0
3: 23
4: 328
Right 1002523489 5:179803806-179803828 TCCCTACACACTGCAGGCCCTGG 0: 1
1: 1
2: 2
3: 24
4: 308
1002523483_1002523489 0 Left 1002523483 5:179803783-179803805 CCCACACCAACCCTTCTGTCATT 0: 1
1: 0
2: 1
3: 17
4: 219
Right 1002523489 5:179803806-179803828 TCCCTACACACTGCAGGCCCTGG 0: 1
1: 1
2: 2
3: 24
4: 308
1002523480_1002523489 13 Left 1002523480 5:179803770-179803792 CCACGGGCTCCCGCCCACACCAA 0: 1
1: 0
2: 1
3: 22
4: 336
Right 1002523489 5:179803806-179803828 TCCCTACACACTGCAGGCCCTGG 0: 1
1: 1
2: 2
3: 24
4: 308
1002523482_1002523489 3 Left 1002523482 5:179803780-179803802 CCGCCCACACCAACCCTTCTGTC 0: 1
1: 0
2: 2
3: 42
4: 421
Right 1002523489 5:179803806-179803828 TCCCTACACACTGCAGGCCCTGG 0: 1
1: 1
2: 2
3: 24
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002523489 Original CRISPR TCCCTACACACTGCAGGCCC TGG Intronic
900389838 1:2429069-2429091 ACCCTGCACACCCCAGGCCCTGG - Intronic
900420299 1:2553315-2553337 TTCCTCCACGCTGCAGGCCAGGG - Intergenic
900493619 1:2965926-2965948 TCCCAACACCCTGCACTCCCTGG - Intergenic
900592189 1:3465098-3465120 TCTCTACACCCACCAGGCCCAGG + Intronic
901079729 1:6577109-6577131 TCCCTCCACCGTGCAGCCCCCGG - Intronic
901685265 1:10940333-10940355 TCCATACACGCTACGGGCCCGGG - Intergenic
902531221 1:17091954-17091976 GCCCTACACAGTGGGGGCCCAGG + Intronic
902761105 1:18581311-18581333 TCCCCACTCACTGCAGGGCAGGG + Intergenic
902928956 1:19716934-19716956 TCCCAGCACACTGGAGGCCGAGG + Intronic
905077874 1:35290033-35290055 TCTCAACTCACTGCAGCCCCTGG + Intronic
905495932 1:38386126-38386148 TCTCTATAAACTACAGGCCCTGG - Intergenic
907839396 1:58141968-58141990 TCTCAAAACACAGCAGGCCCTGG + Intronic
909377252 1:74953515-74953537 TCCCTACCCCCAACAGGCCCCGG + Intergenic
909762840 1:79314297-79314319 TCCCTACCCACACCAGGCCATGG - Intergenic
912491815 1:110066605-110066627 TGCATACACACAGCAGGCCATGG + Intronic
912514602 1:110210206-110210228 ATCCGACTCACTGCAGGCCCTGG - Intergenic
913156221 1:116101766-116101788 CCCCCACCCCCTGCAGGCCCTGG + Intergenic
915778763 1:158521656-158521678 TCCATACCCACTGGAGGCCCTGG + Intergenic
916021241 1:160794354-160794376 TCCCTCCACTCTGCAGCTCCAGG + Intergenic
916395789 1:164386024-164386046 CCCCCACCCCCTGCAGGCCCTGG + Intergenic
916551251 1:165851749-165851771 TCCCTACCCCCAGCAGGCCCTGG + Intronic
916805045 1:168250951-168250973 ACCCTAATCACTGCAGGCTCAGG + Exonic
917394710 1:174580617-174580639 TCCCACCCCACAGCAGGCCCCGG - Intronic
918464033 1:184803844-184803866 TTCCCTCACACTGCAGGCACAGG + Intronic
919785503 1:201255543-201255565 TCCCTCCACCCTGCAGCCCTTGG + Intergenic
920195764 1:204226116-204226138 TGCCCACACAGTGCATGCCCAGG + Intronic
920338771 1:205262376-205262398 CCCCTCCACACACCAGGCCCAGG + Intronic
1062891058 10:1060224-1060246 GCTCTACACACAGCAGGCACTGG - Intronic
1064014228 10:11760376-11760398 CAGCTACACACTGCCGGCCCAGG + Intronic
1064155060 10:12897076-12897098 CCCCCAGACACTGCAGGGCCTGG - Exonic
1064916874 10:20468107-20468129 TCTCGACTCACTGCATGCCCTGG + Intergenic
1065360526 10:24885044-24885066 TCCCTCCAGGCTGCAAGCCCAGG - Intronic
1065830240 10:29608516-29608538 TCCCTGCACTCTCCAGGGCCTGG + Intronic
1066370218 10:34814264-34814286 TCCCCAAACCCTGCAGCCCCCGG + Intronic
1067406731 10:46030383-46030405 CCCCTCCACACGCCAGGCCCGGG - Intronic
1067703453 10:48589968-48589990 TCCCTCCACACTGCACCCCACGG + Intronic
1068000479 10:51328133-51328155 TCCCTCCCCACTCCAGCCCCTGG + Intronic
1068111573 10:52686597-52686619 TCCCACCCCACTACAGGCCCTGG - Intergenic
1068362557 10:55997118-55997140 TCGCTCCACCCTCCAGGCCCTGG + Intergenic
1068438095 10:57017052-57017074 TCCCTAAACAGTGAAGGCTCAGG - Intergenic
1069714844 10:70514067-70514089 TTCCCACACTCTGCTGGCCCTGG + Intronic
1069912328 10:71767199-71767221 TCTCTCCACCCAGCAGGCCCCGG + Intronic
1070560591 10:77563749-77563771 TCCCTACACATTGCAGGCCCAGG + Intronic
1070964109 10:80519045-80519067 ACCCTCCCCACTGCAAGCCCAGG + Exonic
1072541713 10:96403203-96403225 TCCCGAGACACTGCAGCCACTGG + Intronic
1074766479 10:116703769-116703791 ACCCAGCACCCTGCAGGCCCCGG - Intronic
1075964595 10:126600406-126600428 TCCCTGCACATGGCAGGCACAGG - Intronic
1076182248 10:128419286-128419308 TCCCTACAGATTCCAGGACCTGG - Intergenic
1076236951 10:128870979-128871001 CCCCTACCCCATGCAGGCCCTGG + Intergenic
1076237389 10:128875920-128875942 TTCCAACACAATGCAGGCTCAGG - Intergenic
1076350336 10:129811073-129811095 TCCCTTCACCCTCCAGCCCCTGG + Intergenic
1076823719 10:132956638-132956660 TCCCTCCCCACAACAGGCCCCGG - Intergenic
1077093663 11:790386-790408 TCCCTTCAGACTGCAGGGCTAGG - Intergenic
1077237152 11:1487234-1487256 TGCGTACACACTGCAGGGCAGGG - Intronic
1077382514 11:2250827-2250849 TCCCTTCACTCCGCAGCCCCTGG - Intergenic
1077783811 11:5360977-5360999 CCCCACCCCACTGCAGGCCCTGG - Intronic
1077982064 11:7310512-7310534 TCTCTACTCACTGCAAGCTCCGG + Intronic
1079244205 11:18741206-18741228 ACCCTCCCCACTGCAGTCCCGGG + Intronic
1081036105 11:38148616-38148638 TCCCTTCACAGGGCTGGCCCGGG - Intergenic
1081638464 11:44736627-44736649 TCCCTAGACCCTTCAGGGCCCGG - Intronic
1083641937 11:64150360-64150382 TCCCTAACCTGTGCAGGCCCAGG - Intronic
1083750004 11:64755639-64755661 TCCCTGCACTCTGCAGACCCAGG + Intronic
1084876736 11:72138950-72138972 TCCCCACCCAGTGCAGTCCCTGG + Exonic
1084887512 11:72220859-72220881 TCCCCACCCAGTGCAGTCCCTGG + Exonic
1085294237 11:75421651-75421673 TCACAGCAAACTGCAGGCCCAGG - Intronic
1087007858 11:93486655-93486677 TCCCTCCATGCTGTAGGCCCTGG - Intronic
1087802051 11:102515108-102515130 GCACAAAACACTGCAGGCCCAGG - Intergenic
1089392069 11:118108928-118108950 TCCCTGCTCATTGCTGGCCCAGG - Intronic
1090044826 11:123321831-123321853 TCCCTAAAAACAGCAGCCCCCGG - Intergenic
1090172536 11:124617279-124617301 CCCCTACTCCCTGCTGGCCCTGG + Exonic
1090990727 11:131814960-131814982 TACCAACACACTGCGGGCCATGG + Intronic
1091268317 11:134287963-134287985 TCCCAACATACAGCAGGCCCGGG - Intronic
1092880669 12:12885573-12885595 TCCCTACAGACTGCATTCCGGGG + Intergenic
1094852641 12:34389137-34389159 TCCTTCCACATCGCAGGCCCTGG - Intergenic
1096029179 12:48396632-48396654 TCCCACCCCACGGCAGGCCCTGG - Intergenic
1097525531 12:60729179-60729201 CCCCTACCCACAACAGGCCCCGG - Intergenic
1098008904 12:66029701-66029723 TCCCTGGACAGTGCTGGCCCTGG + Intergenic
1098873146 12:75838881-75838903 TCCCAACACACCACAGCCCCTGG - Intergenic
1098910535 12:76204240-76204262 TCCCTGCACCCTGTCGGCCCCGG + Intergenic
1101499772 12:105292188-105292210 TCCCTACCCTCTGCAGCCTCTGG - Intronic
1101665871 12:106813843-106813865 TCTCTACAAACTGCAGGTCTGGG - Intronic
1102256696 12:111419259-111419281 TGCCAACACACTCCAGGCCTGGG + Intronic
1102430512 12:112879469-112879491 TCCAGAGACACTGCTGGCCCAGG - Intronic
1103101376 12:118179265-118179287 TCCCCAGTCACTGCATGCCCAGG + Intronic
1104555609 12:129797420-129797442 TCCCTGCAAACTGCATGCTCTGG - Intronic
1104899642 12:132181954-132181976 TCCCTGCACCCTCCAGGCCTGGG + Intergenic
1104903716 12:132202713-132202735 TCCCTGGCCACTGCAGGCACTGG - Intronic
1106087111 13:26553154-26553176 TCACTACACGCTGCATGCACGGG + Intergenic
1106376437 13:29193153-29193175 TCACTACACAGTGCAGGAGCTGG + Intronic
1106944148 13:34807408-34807430 TGTCTGCACACTGGAGGCCCAGG + Intergenic
1106980009 13:35268337-35268359 TCCCCACTCCCTGCAGCCCCTGG - Intronic
1107320987 13:39188474-39188496 TCCCTACCCCCGACAGGCCCCGG + Intergenic
1107796069 13:44053053-44053075 TCCCTTCCCACGGCTGGCCCTGG - Intergenic
1109417689 13:62064445-62064467 TCCCCACACCCAACAGGCCCTGG - Intergenic
1109874648 13:68385122-68385144 TCCTTACACTCTGCAGGCCTAGG + Intergenic
1110810949 13:79809973-79809995 TCTATGCACACTGCTGGCCCAGG - Intergenic
1110889102 13:80675885-80675907 TCCCTCCCCACAACAGGCCCTGG - Intergenic
1111531315 13:89541265-89541287 TTCCAACACACTGCAGTGCCTGG - Intergenic
1113015430 13:105823379-105823401 TCCTGACACACTGCAGGGCTTGG - Intergenic
1113443498 13:110347641-110347663 CCACCACACACTGCATGCCCTGG + Intronic
1115860051 14:37675229-37675251 TCCCTATACCCCACAGGCCCTGG + Intronic
1117929972 14:60831331-60831353 TCCCTGCCCCCAGCAGGCCCTGG + Intronic
1117951721 14:61089594-61089616 TCCCTGCACAGTGCAGGCCCAGG - Intergenic
1118869210 14:69727251-69727273 CCCCTACCCGCTGGAGGCCCTGG - Intronic
1119133732 14:72197517-72197539 TCCCTACCCACTGTAGCCCCAGG - Intronic
1119804866 14:77475996-77476018 TGCCTACCCACTGGAGGCCATGG - Exonic
1120925897 14:89796823-89796845 CCTCTCCACACTGCAGGCCACGG - Exonic
1122348426 14:101074289-101074311 CCCCCACACACTGCTGGCTCTGG + Intergenic
1122370759 14:101227763-101227785 TCCCTGGACACCGCAGGCCGGGG + Intergenic
1123018391 14:105386309-105386331 CCCCTACACACTGCAGAGCCTGG + Intronic
1124368970 15:29092573-29092595 ACCCATCACACCGCAGGCCCAGG - Intronic
1126343995 15:47674049-47674071 TCTCTTCACACTGCAGCCCATGG + Intronic
1127697218 15:61462134-61462156 TTCCTATATACTACAGGCCCTGG + Intergenic
1128159498 15:65414209-65414231 GCCCTTCACACTGCAATCCCAGG - Intronic
1132069783 15:98766036-98766058 TCTCTACAGACTGCAGGGCTTGG + Intronic
1132113836 15:99121257-99121279 CCCCTCCACAGTGCTGGCCCTGG - Intronic
1132303692 15:100792738-100792760 TCCCTCCTCCCTTCAGGCCCTGG - Intergenic
1132612540 16:824506-824528 TCCCTACACGCTGCCGGGCCTGG - Intergenic
1132675755 16:1120677-1120699 TCCCCACCCACCGCAGGCCCTGG + Intergenic
1132864144 16:2085369-2085391 TCCCTACCCACTGCAGGCTGAGG - Intronic
1132958005 16:2606625-2606647 CCCCCACACTCTGCAAGCCCAGG - Intergenic
1132970481 16:2685873-2685895 CCCCCACACTCTGCAAGCCCAGG - Intronic
1134103905 16:11471653-11471675 TGCCTATACCCTGCAGCCCCAGG - Exonic
1134438966 16:14286186-14286208 TCCCTACACACAGCTACCCCTGG + Intergenic
1136409346 16:30067102-30067124 GCCCCACACCCAGCAGGCCCTGG - Intronic
1137683151 16:50368611-50368633 TTCCTTCCCACGGCAGGCCCAGG - Intronic
1137892184 16:52174397-52174419 TCCCTCAGCACTGCAGGCTCAGG + Intergenic
1138183003 16:54955532-54955554 TCCCAACACACTCCAAGCGCTGG + Intergenic
1138288016 16:55824642-55824664 GCCCAGCACACTGCAGGCGCCGG + Intronic
1138659318 16:58508283-58508305 TCCCTACCCACCTCAGGCCCAGG + Intronic
1138884938 16:61065103-61065125 TCCCCACCCCCTACAGGCCCCGG - Intergenic
1139270047 16:65673362-65673384 TTCCACCACACTGCAGGCACTGG - Intergenic
1139549111 16:67663730-67663752 TTCCTGCTCACTGCAGGTCCTGG - Exonic
1140194661 16:72846454-72846476 TTGCTACCCACTGCAGGCCACGG + Intronic
1140470677 16:75212514-75212536 TCCCTCCACCCTGCCGGCCTTGG - Intergenic
1141826213 16:86482178-86482200 TCCCTCTTCCCTGCAGGCCCAGG - Intergenic
1142161371 16:88559316-88559338 TCCCCCCAGCCTGCAGGCCCCGG - Intergenic
1144076192 17:11721815-11721837 GCCCTACAAACTTTAGGCCCTGG + Intronic
1146068654 17:29658615-29658637 TCCCAACACTCTGGAGGCCGAGG + Intronic
1146214952 17:30971430-30971452 TCCCTACCCGCTGCAGTTCCGGG - Exonic
1147238185 17:39072833-39072855 CTCCTGCACACTGCAGCCCCAGG - Intronic
1147316093 17:39621189-39621211 TCCCTCCACACTGGAGCCTCAGG + Intergenic
1148051377 17:44771658-44771680 CCCATACTCACTGCAGCCCCTGG - Exonic
1148563756 17:48621021-48621043 TCCTTACACCCTGCAGGGCAAGG - Intronic
1150419480 17:65019146-65019168 TCTCCTCACACTGCAGGCTCCGG + Intronic
1151707571 17:75778957-75778979 CCCCTGCTCGCTGCAGGCCCGGG - Exonic
1151819755 17:76491125-76491147 TCCGTACCCACAGCAGGGCCAGG + Intronic
1152132475 17:78485463-78485485 TCCCCTCTCACTGCAGGCCCAGG - Intronic
1152201931 17:78952376-78952398 TCCCTACAGACACCAGGGCCTGG - Intergenic
1152234335 17:79130646-79130668 TCCCTGCAAACTCCAGGCCTCGG + Intronic
1152779362 17:82219518-82219540 TCCAGAGACACAGCAGGCCCAGG - Intergenic
1154325548 18:13388273-13388295 TCCCTACAAACTGCCAGCCAGGG - Intronic
1154364617 18:13695701-13695723 CCCCCACCCACCGCAGGCCCTGG - Intronic
1156739745 18:40309765-40309787 TTCCTTCACCCTGCAGGACCAGG + Intergenic
1157701602 18:49764364-49764386 CCCCTCCCCACTCCAGGCCCTGG - Intergenic
1157735625 18:50046232-50046254 TCCCTGCACACTGGAATCCCTGG + Intronic
1160316139 18:77849457-77849479 TCCCTAGACTCTGCATCCCCTGG + Intergenic
1160814216 19:1027864-1027886 TCCCTCCAGTCTGCCGGCCCTGG - Intronic
1161714648 19:5868347-5868369 TGCCTACACTCTGAGGGCCCTGG - Intronic
1162809194 19:13154035-13154057 TCCCTGCACACTGAAGGCGATGG - Exonic
1163153475 19:15428066-15428088 CCCCTCCTCACTGCGGGCCCTGG - Intronic
1163270269 19:16248762-16248784 TCCCTACCCACTCCAGGGGCAGG - Intergenic
1163408440 19:17138054-17138076 CCCCTACCCCCTACAGGCCCTGG + Intronic
1163571220 19:18083522-18083544 TCCCCACACAGTGCAAGGCCAGG - Intronic
1163654802 19:18539453-18539475 TCCCCACACACCCCAGGCCCTGG - Exonic
1163724100 19:18912851-18912873 TCACTGAACACTGCAGGCCTGGG + Intronic
1164151831 19:22560507-22560529 TCCCACCACTCTGCAGGCCCCGG + Intergenic
1164633262 19:29775355-29775377 TCCCCACAGGCTGCAGGGCCTGG - Intergenic
1164644941 19:29851894-29851916 TCCCTGCAGCCTGGAGGCCCTGG + Intergenic
1164760228 19:30722979-30723001 TCCCACCACCCTCCAGGCCCTGG - Intergenic
1165027166 19:32970402-32970424 TCCCAACACTCTGGAGGCCAAGG + Intronic
1165080755 19:33304659-33304681 ACCCTGCACAGGGCAGGCCCGGG - Intergenic
1165221132 19:34317521-34317543 TCCCCACCCACTGCAGACACAGG - Intronic
1165935392 19:39385544-39385566 TCCCTACCCACTTCTGTCCCCGG + Intronic
1166725570 19:45025338-45025360 TCCTCACACACTGGATGCCCAGG - Exonic
1167758682 19:51429399-51429421 TCCCAACACAATGCAGCCTCTGG + Intergenic
1167859014 19:52268210-52268232 TCCCAGCACTCTGCAGGCCAAGG + Intergenic
1168110256 19:54188340-54188362 TCCCTTCCCCCTGCAGGTCCTGG - Exonic
927957009 2:27214250-27214272 TCCCTACAAACTGCAAACACTGG - Intronic
929791945 2:45029792-45029814 TCCCTCCACCCTGTAGGGCCAGG - Intergenic
929823132 2:45289489-45289511 TTCCTCCCCACTGGAGGCCCTGG + Intergenic
929961013 2:46496411-46496433 TCTCTAGAAACTGCAGGCCATGG + Intronic
930958113 2:57228470-57228492 CCCCTTCCCACAGCAGGCCCCGG - Intergenic
932701937 2:73998031-73998053 TCTCTACACACTGCAAGATCAGG - Intronic
932829350 2:74973985-74974007 TCCCTACATCCTGCAGTCCCTGG + Intergenic
933354572 2:81196270-81196292 TCCCTCCACTCTGCAGCCCCAGG - Intergenic
934735688 2:96688797-96688819 TCCCTCGTCACTGCAGACCCTGG + Intergenic
934761275 2:96858299-96858321 TCCCCACACCCTGCAAGGCCAGG - Intergenic
934970025 2:98755671-98755693 TCCCTACACGCTGTTAGCCCAGG + Intergenic
936050220 2:109216948-109216970 TTCCTCCACCCTCCAGGCCCTGG + Intronic
936659613 2:114528155-114528177 CCCATACACACTGCAAGCACAGG + Intronic
938467542 2:131533211-131533233 TCCCCACACACTCCACTCCCGGG + Intronic
938467621 2:131533738-131533760 TCCCTGCAGACAGCAGGGCCTGG - Intergenic
938554500 2:132412184-132412206 TGCCTCCACACAGCAGGCCTGGG + Intergenic
941777378 2:169407650-169407672 TTGCTACACTCTTCAGGCCCAGG + Intergenic
943870418 2:192989546-192989568 TCCCACCCCACAGCAGGCCCTGG + Intergenic
944288672 2:197979458-197979480 TCCCTTCACACTGTAGGGGCCGG + Intronic
945339569 2:208635848-208635870 TCCCTCCTCCCTGCAGTCCCTGG - Intronic
947404687 2:229762619-229762641 TCTCGACTCACTGCAGGCTCCGG + Intergenic
948093332 2:235314185-235314207 TTCCTACACACAGCCTGCCCTGG + Intergenic
1170140158 20:13117767-13117789 GCCCTACACACGGCATCCCCAGG - Intronic
1171029576 20:21665327-21665349 TCCCTACACGCTGTAGGCAATGG + Intergenic
1171239230 20:23551612-23551634 TCCCTCCATTCTGCAGGCCTGGG - Intergenic
1173392445 20:42647146-42647168 TCCCAACACATTGGAGGCCAGGG - Intronic
1174674587 20:52341169-52341191 ACCCTGCAGCCTGCAGGCCCTGG - Intergenic
1176090523 20:63316439-63316461 TCCCACCGCACTGCAGCCCCTGG + Intronic
1176179578 20:63743030-63743052 TCCCCACCCCCTCCAGGCCCGGG + Exonic
1176260458 20:64176803-64176825 TCCCAGCACACTGCCTGCCCTGG + Intronic
1177275936 21:18913168-18913190 GCACTACTCACTGCAGGCCCGGG - Intergenic
1177818328 21:26002612-26002634 TCCCGGCACAGTGCAGGCTCTGG - Intronic
1178472775 21:32908744-32908766 TCCCTCTGCACTTCAGGCCCAGG - Intergenic
1179100077 21:38348669-38348691 TTCCTACATACTGCAGGTCTTGG + Intergenic
1179166394 21:38938508-38938530 TTCATTCACACTGCAGGCCAGGG + Intergenic
1179898759 21:44378038-44378060 GCCCCACTCACTCCAGGCCCTGG - Intronic
1181555954 22:23671772-23671794 ACCGTAGACACAGCAGGCCCAGG - Intergenic
1181698422 22:24606881-24606903 ACCGTAGACACAGCAGGCCCAGG + Intronic
1182164638 22:28161278-28161300 TCCCAACACTCTGGAGGCCAAGG + Intronic
1182351772 22:29703720-29703742 ACCCTACACACAGCATGCACTGG - Intergenic
1183185606 22:36289979-36290001 TCCCTACAAAATGCAGGGGCCGG + Intronic
1184057180 22:42060407-42060429 TCCCTCCCCACTGCAGGCCCAGG - Exonic
1184204162 22:42990506-42990528 ACCATCCACTCTGCAGGCCCAGG + Intronic
1184244278 22:43228012-43228034 TGCCTGCACTCGGCAGGCCCAGG + Intronic
1184502042 22:44880204-44880226 TACCTAATCACTGAAGGCCCAGG - Intergenic
1184688747 22:46108077-46108099 TCCCTGACCACTGCAGGCCTGGG + Intronic
1184837563 22:47032897-47032919 TCCTTTCACACTGCCGTCCCAGG + Intronic
1185148122 22:49150185-49150207 TCCCTCCACACAGCTGGGCCTGG + Intergenic
1185241260 22:49748905-49748927 TCCCCACCCCCTGCAGGCCGAGG + Intergenic
1185276938 22:49953893-49953915 CCCCTACCCACCGCAGGCCCTGG + Intergenic
949221281 3:1636995-1637017 TCCCAGCACTCTGGAGGCCCAGG + Intergenic
949413560 3:3793129-3793151 TCCCTGCTCTCTGCATGCCCTGG + Intronic
954304027 3:49716200-49716222 CCCCAACACACTACAGGCCTCGG + Intronic
954649742 3:52153923-52153945 CCCGCTCACACTGCAGGCCCGGG + Intronic
954743842 3:52775419-52775441 GCCCAACACACTGCAGGGCTTGG + Intergenic
957524293 3:81359249-81359271 TCCCAACACACTGGAGGCCAAGG - Intergenic
959851348 3:111091500-111091522 TCCCAACACTCTGGAGGCCGAGG - Intronic
960735299 3:120772865-120772887 CCCCCACTCACTGCAGGCCTTGG + Intronic
960955528 3:123027968-123027990 TCACCACACTCGGCAGGCCCGGG - Intronic
961405436 3:126676451-126676473 TCCCTTCAAACTGAAGACCCAGG - Intergenic
961458039 3:127033857-127033879 TCCATGCACTCAGCAGGCCCAGG - Intronic
965367669 3:167820395-167820417 TCTCTGCACTCTCCAGGCCCAGG + Intronic
967821029 3:193839127-193839149 TCCCTACTCCCCACAGGCCCTGG - Intergenic
969586678 4:8097927-8097949 TCCCAACACACACCCGGCCCAGG + Intronic
970755441 4:19420036-19420058 TCCCACCCCACTACAGGCCCCGG - Intergenic
971531307 4:27692688-27692710 GCCCTCTACACTGCATGCCCAGG - Intergenic
971864845 4:32156304-32156326 TCCCTCCCCACAACAGGCCCTGG + Intergenic
974293260 4:59961839-59961861 TGCCTACTCTCTGTAGGCCCTGG + Intergenic
975265782 4:72365039-72365061 TGCCTACACAGTACAGGGCCTGG + Intronic
976454864 4:85234445-85234467 TCCCTACCTACTGCAGGTCTGGG + Intergenic
976825203 4:89253129-89253151 TCCAAAAACACTGCAAGCCCCGG + Intronic
977272702 4:94937750-94937772 TCCATACACACTGCAGGAGAGGG + Intronic
979091899 4:116493720-116493742 TCTCTACAAACAACAGGCCCTGG + Intergenic
980392426 4:132164032-132164054 TCCCCACACCCAACAGGCCCTGG + Intergenic
981286772 4:143026782-143026804 TCCCTCCACATGGCTGGCCCAGG + Intergenic
981847076 4:149181817-149181839 CCCCCACACCCTGAAGGCCCTGG - Intergenic
986561480 5:9064631-9064653 TCCCTACCCCCGACAGGCCCCGG - Intronic
991638801 5:68733184-68733206 TCCCTCTACACTCCAAGCCCTGG - Intergenic
992102206 5:73418810-73418832 TCCCTACATACTGCATGCGGGGG - Intergenic
994710878 5:103262211-103262233 TCCCCACACTATGCAGGCACTGG - Intronic
996146652 5:119985308-119985330 CCCCTACCCCCTGCAGGCCCCGG + Intergenic
998309333 5:141111517-141111539 TCCCACCACACAACAGGCCCTGG + Intronic
998405133 5:141869942-141869964 TCCTTACACACCCCAGACCCTGG + Intronic
1002523489 5:179803806-179803828 TCCCTACACACTGCAGGCCCTGG + Intronic
1002756148 6:162014-162036 TCCCCACCCCCTGCAGGTCCTGG - Intergenic
1002975843 6:2075411-2075433 TCCCTCCCCACAACAGGCCCTGG + Intronic
1003637291 6:7844565-7844587 ACCCTTTACACTTCAGGCCCAGG + Intronic
1004220569 6:13743180-13743202 TCTCCACACCCTGCAAGCCCAGG - Intergenic
1004373665 6:15073960-15073982 TCCCAACACACTGGATGACCTGG - Intergenic
1006090125 6:31623742-31623764 TCCCGAGACTCTGCAGGCCATGG - Exonic
1006297822 6:33177839-33177861 GTCCCACACACTGCAGGCCTGGG - Intronic
1007962681 6:45974802-45974824 TCCCCACCCCCTGCAGGCTCTGG + Intronic
1010666904 6:78641668-78641690 CCCACACACCCTGCAGGCCCTGG + Intergenic
1011292508 6:85791349-85791371 TATCAACACACTGGAGGCCCAGG - Intergenic
1011640001 6:89409835-89409857 CACCTATCCACTGCAGGCCCAGG + Intronic
1012611997 6:101229066-101229088 TCCCCCCACAGTGCAGGTCCAGG + Intergenic
1013334675 6:109143748-109143770 TCACTACACACTGAAGTCCTTGG - Intronic
1013399899 6:109783103-109783125 ACCCTCACCACTGCAGGCCCTGG - Intronic
1013869792 6:114743168-114743190 CCCCTCCACACAACAGGCCCCGG + Intergenic
1015915572 6:138212863-138212885 TCCCTCCCCACAACAGGCCCTGG - Intronic
1017139258 6:151175746-151175768 TCCCTGCAGACTGCAATCCCAGG + Intergenic
1017503117 6:155043677-155043699 TCCTAAAACACTGCAGGGCCTGG - Intronic
1017711059 6:157168462-157168484 TCCCTAACCAGTGCTGGCCCAGG + Intronic
1018457747 6:163967557-163967579 TTCATACTCACTGCAGGCCGTGG + Intergenic
1019119631 6:169792724-169792746 TCCCTCCACCCTGGATGCCCAGG - Intergenic
1019341584 7:511200-511222 TCCCTCCAGCCTGCAGGCACCGG - Intronic
1019592003 7:1840193-1840215 TCCCTGCACGCTGGATGCCCTGG + Intronic
1020705049 7:11533722-11533744 TCCCCACACCCGACAGGCCCTGG - Intronic
1021435024 7:20604210-20604232 GCCCTAATCACTGCAGGGCCAGG + Intergenic
1023569283 7:41555592-41555614 TCCCTACATACTGTTAGCCCAGG - Intergenic
1023768886 7:43536733-43536755 TCCCTCCACCCACCAGGCCCTGG + Intronic
1023806461 7:43876309-43876331 TCCTTAGTCACTGCAGGCCCAGG - Exonic
1024698405 7:51880607-51880629 CCCCCACCCACTGCAGGCCCTGG + Intergenic
1025868105 7:65404937-65404959 TCCTTTCACATTGCAGGACCAGG + Intergenic
1026944412 7:74306726-74306748 TCACTACTCTCTGGAGGCCCTGG - Intronic
1027192540 7:76005398-76005420 TCCCTCCACACTTCAGGAACTGG - Exonic
1027263554 7:76481480-76481502 TCAAAACACACTGCAGGTCCAGG - Intronic
1027314926 7:76979592-76979614 TCAAAACACACTGCAGGTCCAGG - Intergenic
1029476511 7:100788149-100788171 TCCCCACACCCACCAGGCCCTGG - Intronic
1031355877 7:120785686-120785708 GTTGTACACACTGCAGGCCCTGG - Intergenic
1034267485 7:149788316-149788338 CCCCTTCACACTGCAGGGCTGGG - Intergenic
1034669416 7:152846768-152846790 TCACTACAGACTACAGCCCCGGG - Intronic
1034669472 7:152847141-152847163 TCACTACAGACTGCAGCCCCGGG - Intronic
1034796226 7:154015988-154016010 TCCCTGCACACTCCATGCTCTGG + Intronic
1035163533 7:156968881-156968903 TTCCTACACACTGCTGGCAGAGG - Intronic
1039136044 8:34323603-34323625 TCGCTACACACTGCAGGAGGCGG - Intergenic
1039764778 8:40616723-40616745 CCCCAACCCACGGCAGGCCCCGG - Intronic
1041178355 8:55221469-55221491 GGCCCACACACTGAAGGCCCTGG + Intronic
1041312891 8:56534329-56534351 GCCCCATACACTGCATGCCCTGG - Intergenic
1044832916 8:96267798-96267820 ACCCAACACCCAGCAGGCCCCGG + Intronic
1045300098 8:100903498-100903520 TCCCCAGGCACTGCAGGACCTGG + Intergenic
1046839455 8:118841167-118841189 GCCCTTCCCATTGCAGGCCCAGG + Intergenic
1047065482 8:121277406-121277428 TCCCAACCCACAACAGGCCCTGG + Intergenic
1048992749 8:139770889-139770911 TCCCTACGCCCGCCAGGCCCGGG - Intronic
1049665976 8:143842793-143842815 TCCCCACCCACTGCAGGCATGGG - Intergenic
1052165920 9:25327628-25327650 CCACTACCCACTACAGGCCCTGG + Intergenic
1053754858 9:41295609-41295631 CCCCACCACACAGCAGGCCCTGG + Intergenic
1054260382 9:62859906-62859928 CCCCACCACACAGCAGGCCCTGG + Intergenic
1056844120 9:90022873-90022895 TCCCTACAGACTGCAGACCAGGG - Intergenic
1057145834 9:92758905-92758927 TCCCAACACTTTGCAGGCCAAGG + Intronic
1058132454 9:101268091-101268113 CCCCTACCCACAACAGGCCCCGG - Intronic
1059388563 9:113984465-113984487 CCCCTACACCCTGCAGCCCTGGG - Intronic
1059956321 9:119519682-119519704 TCCCACCCCACTACAGGCCCCGG - Intronic
1060723775 9:125994590-125994612 ACCCCGCACCCTGCAGGCCCAGG - Intergenic
1061878615 9:133557281-133557303 TCCCTGCACCCCGCAGCCCCAGG - Intronic
1061995451 9:134180711-134180733 TGCCTCCTCCCTGCAGGCCCAGG + Intergenic
1062523914 9:136970650-136970672 CTCCTCCAAACTGCAGGCCCCGG - Intronic
1202798766 9_KI270719v1_random:153016-153038 CCCCACCACACAGCAGGCCCTGG - Intergenic
1186247773 X:7632137-7632159 TCCCTCCACACTGCAGAGCATGG + Intergenic
1189439787 X:41024982-41025004 CCACTACACACTGCAGGAGCTGG - Intergenic
1190595462 X:52049146-52049168 CCCCTACCCACAACAGGCCCCGG - Intergenic
1190613362 X:52204927-52204949 CCCCTACCCACAACAGGCCCCGG + Intergenic
1193072873 X:77324855-77324877 TCCCACCTCACAGCAGGCCCCGG - Intergenic
1196019064 X:110970584-110970606 CCCCCACCCACAGCAGGCCCTGG - Intronic
1197909680 X:131467134-131467156 TCCCAACCCACAACAGGCCCCGG - Intergenic
1198068208 X:133121109-133121131 TCCCTAAACACTGAAGGACTTGG + Intergenic
1199509000 X:148598532-148598554 TGCCTGCACACTGCATGCCATGG + Intronic
1201569278 Y:15397355-15397377 TCACTCCTCACTGCAGGCTCAGG - Intergenic