ID: 1002524168

View in Genome Browser
Species Human (GRCh38)
Location 5:179806433-179806455
Sequence GCGCACCTGGGCGTCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 162}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002524168_1002524176 -9 Left 1002524168 5:179806433-179806455 CCGCCGCCGACGCCCAGGTGCGC 0: 1
1: 0
2: 2
3: 19
4: 162
Right 1002524176 5:179806447-179806469 CAGGTGCGCCAGGTGCGGGCCGG 0: 1
1: 1
2: 2
3: 26
4: 261
1002524168_1002524178 -5 Left 1002524168 5:179806433-179806455 CCGCCGCCGACGCCCAGGTGCGC 0: 1
1: 0
2: 2
3: 19
4: 162
Right 1002524178 5:179806451-179806473 TGCGCCAGGTGCGGGCCGGGCGG 0: 1
1: 0
2: 2
3: 24
4: 197
1002524168_1002524179 -4 Left 1002524168 5:179806433-179806455 CCGCCGCCGACGCCCAGGTGCGC 0: 1
1: 0
2: 2
3: 19
4: 162
Right 1002524179 5:179806452-179806474 GCGCCAGGTGCGGGCCGGGCGGG 0: 1
1: 0
2: 6
3: 62
4: 589
1002524168_1002524181 -2 Left 1002524168 5:179806433-179806455 CCGCCGCCGACGCCCAGGTGCGC 0: 1
1: 0
2: 2
3: 19
4: 162
Right 1002524181 5:179806454-179806476 GCCAGGTGCGGGCCGGGCGGGGG 0: 1
1: 0
2: 3
3: 47
4: 527
1002524168_1002524177 -8 Left 1002524168 5:179806433-179806455 CCGCCGCCGACGCCCAGGTGCGC 0: 1
1: 0
2: 2
3: 19
4: 162
Right 1002524177 5:179806448-179806470 AGGTGCGCCAGGTGCGGGCCGGG 0: 1
1: 0
2: 0
3: 22
4: 198
1002524168_1002524180 -3 Left 1002524168 5:179806433-179806455 CCGCCGCCGACGCCCAGGTGCGC 0: 1
1: 0
2: 2
3: 19
4: 162
Right 1002524180 5:179806453-179806475 CGCCAGGTGCGGGCCGGGCGGGG 0: 1
1: 0
2: 3
3: 91
4: 525
1002524168_1002524184 16 Left 1002524168 5:179806433-179806455 CCGCCGCCGACGCCCAGGTGCGC 0: 1
1: 0
2: 2
3: 19
4: 162
Right 1002524184 5:179806472-179806494 GGGGGTCGCGCTCACCTTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002524168 Original CRISPR GCGCACCTGGGCGTCGGCGG CGG (reversed) Intronic