ID: 1002524647

View in Genome Browser
Species Human (GRCh38)
Location 5:179808132-179808154
Sequence CGGGCCTCCCCCGGGCGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002524647_1002524659 9 Left 1002524647 5:179808132-179808154 CCCACCCGCCCGGGGGAGGCCCG 0: 1
1: 0
2: 0
3: 18
4: 157
Right 1002524659 5:179808164-179808186 ACTCAGACTGAGATTGAATGCGG 0: 1
1: 0
2: 1
3: 19
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002524647 Original CRISPR CGGGCCTCCCCCGGGCGGGT GGG (reversed) Intronic
900284022 1:1890751-1890773 CGGGCGCCCCCAGGGCGGGCGGG + Intronic
900399546 1:2467387-2467409 CGGGGCTCCCACGGGAGGGGCGG + Intronic
900604882 1:3519503-3519525 GGGGCCTCCCCCAGGAGGGCAGG - Intronic
903639404 1:24848325-24848347 CGCGCCTCCCCCGGCGGGGCAGG + Intergenic
903907332 1:26696284-26696306 CGAGGCCCGCCCGGGCGGGTGGG + Exonic
905151451 1:35931089-35931111 CGGGGCGGCCCCGGGCAGGTCGG + Exonic
905647216 1:39633059-39633081 CGGGGCTGGGCCGGGCGGGTTGG + Intronic
907297133 1:53462409-53462431 CGAGCTTCACCCGGGCAGGTTGG + Intronic
910237161 1:85048143-85048165 CGGGCCTGCCCGGGGCTGGGCGG - Intronic
915616549 1:157043864-157043886 TGGGCCTCCACCAGGCTGGTTGG - Intronic
916656032 1:166876075-166876097 CGGGCGTCTCCGGGGCGGGCTGG + Intronic
922558139 1:226548718-226548740 CGCCCCTCCGCCGGGCGTGTGGG + Intergenic
924439660 1:244075525-244075547 CAAGCCTCCCCCAGGAGGGTAGG - Intergenic
1063121071 10:3106135-3106157 GGGGCCTCCCCTGGGAGGGCCGG + Intronic
1064142986 10:12805993-12806015 GGGGCCTGCCCTGGCCGGGTGGG + Intronic
1068060726 10:52064509-52064531 CGGGCCTCCCCTGTGCTGTTGGG - Intronic
1069942452 10:71964724-71964746 GCGGCCTCCCCCGGGCTGGGCGG - Intronic
1070032757 10:72692683-72692705 CCCTCCTCCTCCGGGCGGGTTGG + Intronic
1072624095 10:97099754-97099776 CTGGCCTCCCCTGGGCGAGAAGG - Intronic
1073042703 10:100618330-100618352 CGGGTCCCCTCCGGGAGGGTGGG + Intergenic
1073491295 10:103855156-103855178 CGGGCCACCCCCAGCAGGGTCGG + Intronic
1075646670 10:124101352-124101374 TGGGCCTCCCAAGGGTGGGTGGG - Intergenic
1077076921 11:706186-706208 CAGGTCTCCCGCGGGCGGGTGGG - Exonic
1077078234 11:710829-710851 CTGGCCTCCCCCGGCCCCGTGGG - Intronic
1077080685 11:723301-723323 AGGGCATCCCCCGGGGGGGTGGG - Exonic
1077091104 11:778630-778652 CTGGCCTCCGCCGGGCGCGGTGG + Intronic
1080344811 11:31312533-31312555 TGGCCCTCCCCAGGGCAGGTGGG + Intronic
1081576168 11:44319690-44319712 TGGGCCTGCTCTGGGCGGGTAGG - Intergenic
1081774082 11:45665777-45665799 CGTGGCTGCCCCCGGCGGGTGGG - Intergenic
1081873300 11:46392679-46392701 CGGGCCTCGCCCAGGCTGGGCGG + Intergenic
1084004802 11:66317090-66317112 GGGGCCTCCTGCGGGCGGGCCGG + Intergenic
1084424850 11:69079042-69079064 CCGGCCTCTACTGGGCGGGTGGG + Intronic
1084434556 11:69131314-69131336 CGGGCCACCCCTGGGCAGCTCGG - Intergenic
1084935493 11:72584500-72584522 GGGGCCTGCGCCGGGCGGGGCGG - Intronic
1089643832 11:119865031-119865053 CGGGGCTCCTCCGGGCAGGATGG - Intergenic
1091404961 12:203494-203516 CGGGCGTCCGCCGCGGGGGTGGG + Intronic
1092254286 12:6917735-6917757 CGGCTCTCCCAGGGGCGGGTGGG + Intronic
1092263564 12:6964866-6964888 CAGGCCTCCCCTGGGGAGGTGGG - Intergenic
1095432092 12:42144915-42144937 CGCCCCTCCCCCGGGCGGGAGGG + Intergenic
1101409807 12:104458358-104458380 CGGGAATCCCCCGGGCGGCGTGG + Intronic
1102482487 12:113233287-113233309 CAGCCCTCCCCCAGGCGAGTGGG - Intronic
1103294810 12:119877137-119877159 CCGCCCTCCCCGGGGCGGGAGGG + Intronic
1103563539 12:121804463-121804485 CGGGGGTCCCCTGGGCGGGCTGG - Intronic
1104899661 12:132182001-132182023 CCGGCCACACCTGGGCGGGTGGG - Intergenic
1105349461 13:19602306-19602328 CGGGCCACCCCGGGGCGGTGAGG - Intergenic
1105545707 13:21349181-21349203 TGGGCCTCCCCCAGGGGTGTTGG + Intergenic
1106109055 13:26760856-26760878 CGGGGATCCCGCGGGCGGGCGGG - Intergenic
1118820397 14:69341784-69341806 TGTGCATCCCCCAGGCGGGTAGG + Intronic
1121648109 14:95534990-95535012 AGGGCCTCCAGGGGGCGGGTCGG + Exonic
1124251090 15:28106891-28106913 CGGGCTTCCACCCGGCGGGCTGG + Intergenic
1126113401 15:45188022-45188044 CGGGGCTCCGCCGGGCGGGGAGG + Intronic
1130014594 15:80176746-80176768 GTGGCCTCCCCCGGGCGGGCAGG - Intronic
1131200060 15:90388465-90388487 GGGGGCTCGGCCGGGCGGGTGGG + Intronic
1132683607 16:1153420-1153442 CGGGCATCGCCCGGGCGGCGCGG - Exonic
1135755375 16:25092800-25092822 AGGGCCTCCGCCGGGCGCGGTGG + Intergenic
1136690463 16:32024890-32024912 TGGGCTTCCCCCGAGCGGGTGGG + Intergenic
1136791050 16:32968450-32968472 TGGGCTTCCCCCGAGCGGTTGGG + Intergenic
1136878763 16:33885482-33885504 TGGGCTTCCCCCGAGCGGTTGGG - Intergenic
1137440697 16:48496752-48496774 GGGGACTCGCCCGGGCGGGGCGG - Intergenic
1139954301 16:70685952-70685974 CGGGCCTCCGGCGGGCGGCGCGG + Exonic
1140467437 16:75193877-75193899 CAGGCCGCCCCCGGGAGGGCTGG + Intergenic
1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG + Intergenic
1142513117 17:410409-410431 CGGGCGCCCCCGGGGCGGGTTGG + Exonic
1142602539 17:1061256-1061278 CAAGCCTCCCAGGGGCGGGTGGG + Intronic
1143016486 17:3893390-3893412 CGCGCCTCGCCCGGGAGGGAGGG - Intronic
1143141904 17:4745693-4745715 CGGGGCTCCACCGGGCGGTCAGG - Intronic
1146061995 17:29612585-29612607 CGGCTCTCCCCGGGGTGGGTGGG + Intronic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1148152101 17:45403016-45403038 CTGTCCTCCCCTGGGTGGGTGGG - Intronic
1148178346 17:45585998-45586020 CGGGCCACCCCCAGGCTGGGTGG + Intergenic
1148270815 17:46260469-46260491 CGGGCCACCCCCAGGCTGGGTGG - Intergenic
1148456614 17:47814647-47814669 TGGGCCTCCCCCGGGCAGCTGGG + Intronic
1148856462 17:50581600-50581622 GGGGCCAGCCCCGGGCGGGGTGG - Intronic
1150463234 17:65370675-65370697 CGAGTCTCCCCAGAGCGGGTCGG + Intergenic
1151990434 17:77570828-77570850 CAGGCCTCCCCTGGGCGGTGTGG - Intergenic
1152128383 17:78461110-78461132 CGGGCCCCCCCCGAGAGGGTAGG - Intronic
1152834417 17:82519972-82519994 CGGGTCCCCGCCGGGCGGCTGGG + Exonic
1153900666 18:9614637-9614659 CGGGCCTGCCGCGGGCGGCGCGG + Intronic
1153911196 18:9708093-9708115 CGGACCAGCCCCGCGCGGGTCGG - Intergenic
1156036616 18:32772117-32772139 CGGCTCTCCCCCGGGCGGGCGGG - Exonic
1157276210 18:46312755-46312777 CCAGCCTCCCCTGGGCAGGTGGG - Intergenic
1158236598 18:55322582-55322604 CCGGCCTCCCCGGAGCTGGTGGG + Intronic
1160567975 18:79798608-79798630 CGGGCCGCGCCCCGGCTGGTCGG - Intergenic
1160935557 19:1592859-1592881 GGGGCCCCGCGCGGGCGGGTGGG - Intergenic
1160941447 19:1622111-1622133 CGGGCCGCTACCGGGCGGGAGGG + Exonic
1160991948 19:1863702-1863724 GGGGCGTCCTCCGGGCGGGGCGG - Intergenic
1161066327 19:2240173-2240195 CTGGCCTCCCCCGGGGTGGGGGG + Intronic
1161289133 19:3483409-3483431 CGGGCCTCCCCTGTGCCGGGCGG - Intergenic
1162964506 19:14149563-14149585 GAGGTCTCCCCCGGGCCGGTGGG + Exonic
1163481706 19:17560350-17560372 CGGGCCTTCCTCGTCCGGGTAGG - Exonic
1166547036 19:43639878-43639900 CGCCCCGCCCCCGGGCGGGCAGG - Intergenic
1167781515 19:51601734-51601756 CAGACCTCACCCGGGCGCGTCGG - Intergenic
927214094 2:20656727-20656749 TGGGCCTCCTCCAGGCGGCTGGG - Intergenic
934856906 2:97735223-97735245 CGTGCCTCCCGTGGCCGGGTCGG + Intronic
935717133 2:105949036-105949058 TGGCCCTCCCCCGTGCGGGTGGG + Intergenic
937362326 2:121237818-121237840 AGGGCCTCCACCGGGTGGGTCGG + Exonic
937395410 2:121530383-121530405 TAGGCCTCCCCGGAGCGGGTGGG - Intronic
938579883 2:132636297-132636319 TGGGCCTCCCCAGGTTGGGTTGG + Intronic
944412829 2:199459235-199459257 CGGCCTCCCCCCGGGCGGGGAGG - Intronic
947552522 2:231056844-231056866 CGGGCAGCCCCTGGGCGGGCGGG + Exonic
947641708 2:231710691-231710713 CCGGCCTCCCCGCGGCGGCTAGG - Intronic
948159465 2:235812306-235812328 CGGGCTTGCCCCGGGCAGGCCGG - Intronic
949032410 2:241803270-241803292 CGCGCCTCCTCCCCGCGGGTGGG + Intronic
949059556 2:241949164-241949186 CGGGCCTCTCCCTCTCGGGTGGG - Intergenic
1170947629 20:20905820-20905842 CGGCCCTCCCCGGTGTGGGTGGG - Intergenic
1171437841 20:25136823-25136845 TGGGCCTCCCCAGGGCTGCTTGG + Intergenic
1173495478 20:43514759-43514781 CGGGCCCCCAACAGGCGGGTAGG + Exonic
1174287712 20:49484042-49484064 CGGGCCTACCCCGGCCGGGCAGG + Intergenic
1175856361 20:62122858-62122880 CGGGGCGCCCCGGGGCGGGGAGG - Intronic
1178104029 21:29298976-29298998 CGGCCCTTCTCCGGGAGGGTTGG + Intronic
1179217532 21:39380499-39380521 CTGGCCTCCCAAGGGCCGGTGGG + Intronic
1179597980 21:42455915-42455937 CGGCCCTCCCCAGGGTGGGTGGG - Intergenic
1179731934 21:43372918-43372940 TGGGCCTCCCCCGGGGGCTTCGG + Intergenic
1182546818 22:31081422-31081444 CGAGCCTGCGCCGGACGGGTGGG + Exonic
1183451584 22:37898890-37898912 CAGGCCTCACCCAGGCGGGCAGG + Intergenic
1183486109 22:38088636-38088658 CTGGCCTCCCCCGGGGGCCTCGG - Intronic
1183548799 22:38469234-38469256 CGGGCATCCCCCGGGAAGGGTGG + Intronic
1184224341 22:43120628-43120650 TGGGCCTCCCTTGGGCTGGTGGG + Intronic
1185037897 22:48489371-48489393 CCGGCGTCCCCCTGGCGGGCCGG + Intergenic
1185114577 22:48924553-48924575 TGGCCCTCCCCAGGGTGGGTGGG + Intergenic
1185333497 22:50261745-50261767 CGCGCCGCCCGCGGGCCGGTTGG - Exonic
950457718 3:13102587-13102609 CTGTCCTTCCCCGGTCGGGTGGG + Intergenic
950962239 3:17118973-17118995 CAGGCCTCCACCTGGCGGGAGGG - Intergenic
954003912 3:47577989-47578011 CGGGCCTGACCGGGGCGGGCCGG - Intronic
954110309 3:48429629-48429651 CCGCCCTCCCCCGTGCGGGAGGG - Intronic
954633481 3:52059142-52059164 TGGGCCCCCACCGGGCAGGTTGG + Intergenic
954662129 3:52231833-52231855 CAGGCCTGCCCCTGGAGGGTGGG - Intronic
954795901 3:53161279-53161301 CGGGCCTCCGCGCGGCGGGCGGG - Exonic
956674941 3:71725026-71725048 CGGGACTCGCCCCGCCGGGTCGG - Intronic
961664961 3:128489072-128489094 CCGGCCACCCCCGGGAGAGTGGG + Intronic
966712005 3:182980685-182980707 GGGGCTTCCCCCGGGCGCGGGGG + Intronic
969090788 4:4692534-4692556 CGGGCCTCCTCAGTGCGGGTGGG - Intergenic
969702159 4:8773656-8773678 CTGGCCTCCACCAGGCGGGCTGG - Intergenic
969710417 4:8840177-8840199 CGAGCCTGCCCGGGGCGGGGTGG + Intergenic
978189599 4:105896126-105896148 CGGGCCTCCCCCCGGGGGCCTGG - Intronic
982232649 4:153223071-153223093 CGGACCTTGCCCGGGCGGGAGGG - Intronic
985580578 5:693498-693520 CGCGCGTCCCCGGGCCGGGTGGG - Intergenic
987108560 5:14664272-14664294 CGGGCTTCCCCCCGCCGGGACGG - Intergenic
1002524647 5:179808132-179808154 CGGGCCTCCCCCGGGCGGGTGGG - Intronic
1002570497 5:180137019-180137041 CTGGCCTCCCTCGGGCTGGCTGG - Intronic
1002719022 5:181246787-181246809 CGGGCATCCCCTGGGAGGGACGG - Intronic
1002790700 6:435629-435651 CGGGGCTCCTCCGGGAGGCTCGG + Intergenic
1003175772 6:3751573-3751595 CGCGCCTCCTGCGGGCGGGCGGG - Exonic
1006393383 6:33771937-33771959 CGGGCAGCCCCAGGGCGGGCGGG - Exonic
1011590038 6:88963287-88963309 CGGCCCACCCCCGGGCACGTTGG + Intronic
1014215496 6:118748871-118748893 TGGGCCGGCCCAGGGCGGGTGGG + Intergenic
1018727876 6:166627436-166627458 CGGGGCTCTCCCGGGCGGGGCGG - Intronic
1018978384 6:168582814-168582836 CGGGTCTTCCCCGTGCGTGTCGG - Intronic
1019329417 7:455286-455308 CAGGCCTCGCCCGGACAGGTGGG + Intergenic
1019708848 7:2509347-2509369 CCGGCCTCCTCCGGGCCGTTTGG - Intergenic
1020104073 7:5413070-5413092 CGGGCCTCCCCAGGGCCTGCTGG - Intronic
1020224970 7:6272633-6272655 CGGGCCTCCTCCCGCCGGGCGGG + Exonic
1023875152 7:44282797-44282819 CGGGCCTCCTCTGGGTTGGTGGG - Intronic
1026968478 7:74454389-74454411 CCGGCCCCTCCCGGGCAGGTGGG - Intronic
1029409182 7:100397921-100397943 TGGGCCTCCCCAGGGTGGGTTGG + Intronic
1029746469 7:102517918-102517940 CGGGGTTCCCCAGGGCGGGGAGG + Intergenic
1029764406 7:102616897-102616919 CGGGGTTCCCCAGGGCGGGGAGG + Intronic
1032011785 7:128351956-128351978 CGGGGCGCCCCTGGGAGGGTCGG - Exonic
1033452276 7:141472528-141472550 CTGGCCTCCCCAGGGCTGCTGGG - Exonic
1034978021 7:155459087-155459109 CGGGCCTCCCCGCGGCGAGCCGG - Intronic
1037547760 8:19940170-19940192 CGGGGCTCCCCAGAGCGGGTGGG - Intronic
1039936465 8:42051246-42051268 CCGGCCTCCCCTCGGCGGCTGGG + Intronic
1040294536 8:46142388-46142410 CAGGCCTGCCCCATGCGGGTTGG - Intergenic
1040408480 8:47132776-47132798 TGGGCTTCCCCCCGCCGGGTGGG - Intergenic
1043390133 8:79784112-79784134 CGGGCCCTCCCTGGGCGGGCGGG + Intergenic
1046094354 8:109539882-109539904 GGAGCCTCCGCCGGGCGGGCGGG + Intronic
1047254872 8:123207303-123207325 CGGGGCTGCTCCGGGCGGGACGG - Exonic
1049761350 8:144333156-144333178 GGGGCCTCCCCCAGCCAGGTCGG - Exonic
1049891396 9:73522-73544 CGGGCGGTCCCCGGGCGGGCGGG - Intergenic
1054250225 9:62710319-62710341 TGGGCCTCTCCCGGGCGGAAGGG + Intergenic
1061208348 9:129177063-129177085 CGGGGCGCCCCCGGGGGGCTCGG + Exonic
1062279575 9:135745949-135745971 CGGGTCTACCCCAGCCGGGTCGG + Intronic
1062600109 9:137315746-137315768 CCGGCCTGCCCTGGGCGGGCAGG + Intronic
1062625946 9:137441569-137441591 CGCCCCGCCCCCGGGGGGGTGGG + Intronic
1187888013 X:23907478-23907500 CGGGAGACCCCCGGGTGGGTGGG - Intronic
1198683085 X:139203174-139203196 AGGGCCTCCCATCGGCGGGTTGG - Intronic