ID: 1002525570

View in Genome Browser
Species Human (GRCh38)
Location 5:179813992-179814014
Sequence GACATTTTTATTCGTGTACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002525570_1002525580 28 Left 1002525570 5:179813992-179814014 CCTAGTACACGAATAAAAATGTC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1002525580 5:179814043-179814065 CCCAGGTACTTGAGAGGCAGAGG 0: 1
1: 158
2: 6763
3: 110754
4: 225346
1002525570_1002525576 11 Left 1002525570 5:179813992-179814014 CCTAGTACACGAATAAAAATGTC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1002525576 5:179814026-179814048 TGGCGTGAGCCTGTAGTCCCAGG 0: 2
1: 86
2: 702
3: 1983
4: 3983
1002525570_1002525578 22 Left 1002525570 5:179813992-179814014 CCTAGTACACGAATAAAAATGTC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1002525578 5:179814037-179814059 TGTAGTCCCAGGTACTTGAGAGG 0: 41
1: 2866
2: 53716
3: 173994
4: 234236
1002525570_1002525575 -9 Left 1002525570 5:179813992-179814014 CCTAGTACACGAATAAAAATGTC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1002525575 5:179814006-179814028 AAAAATGTCTATCGGGGTGGTGG 0: 1
1: 0
2: 0
3: 12
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002525570 Original CRISPR GACATTTTTATTCGTGTACT AGG (reversed) Intronic
904554502 1:31350395-31350417 GAAATTATTATTCATATACTTGG - Intronic
906812209 1:48839467-48839489 GACATTTGTCTTTCTGTACTTGG - Intronic
908032646 1:60017686-60017708 GAAATTATTATCCGTGTTCTTGG - Intronic
909986613 1:82168515-82168537 GACATTTTGAGTCGTGTTTTAGG + Intergenic
910147642 1:84101428-84101450 GACATTTTTATGTGTCAACTTGG - Intronic
911168032 1:94742531-94742553 GGCATTTATATTAGTGTGCTAGG + Intergenic
916187530 1:162147514-162147536 CACATTATGATTCGTGTACCAGG + Intronic
916858839 1:168780750-168780772 GACCTTCTCATTCTTGTACTAGG + Intergenic
919654318 1:200182463-200182485 GACATTTTTATGGATGTTCTGGG - Intergenic
1063235049 10:4105432-4105454 GACAATTTTTTTCATGGACTCGG + Intergenic
1066980398 10:42408164-42408186 CACATTTTAATTAGTTTACTAGG + Intergenic
1068209959 10:53908632-53908654 GAAATATTTATTCCTGTACTTGG + Intronic
1068377409 10:56199045-56199067 AACATGTTTCTTCATGTACTAGG - Intergenic
1068508048 10:57928049-57928071 GACATTTTTATGAGTGAAATAGG + Intergenic
1068816069 10:61314634-61314656 GACACTTTTATTCTGGTAGTGGG + Intergenic
1070706643 10:78643928-78643950 GGCATTTTTATTGTTGTTCTTGG - Intergenic
1073659981 10:105464109-105464131 GACATTTTTTTCCATGGACTAGG - Intergenic
1075891424 10:125954578-125954600 GATTTTTTTTTTCCTGTACTGGG + Intronic
1075952388 10:126492225-126492247 GACATTTTTGGTTGTGTGCTAGG + Intronic
1088170278 11:106988467-106988489 GACATTTTTTTTTCTGTACCAGG + Intronic
1088323423 11:108576980-108577002 GATATTTGTATTTCTGTACTAGG + Intronic
1090123746 11:124062758-124062780 CACATTTTTTTTCCTGTGCTTGG + Intergenic
1091423216 12:361718-361740 GTCATTTTTATTAGTGTGATTGG - Intronic
1094435011 12:30411884-30411906 GTAATTTTTATTCCTGTGCTGGG - Intergenic
1095730595 12:45502438-45502460 GCCATTCTTATTCTTGTAATTGG + Intergenic
1097309106 12:58099452-58099474 TACATTTTTATTTGTGTTCTAGG - Intergenic
1099698489 12:86053762-86053784 GAAATGTTTATTCCTGTACTTGG - Intronic
1101798025 12:107994448-107994470 GGCATTTTTTTTCATATACTCGG + Intergenic
1106007646 13:25786079-25786101 GTCATTTTTTTTCTTGGACTTGG + Intronic
1106437223 13:29733775-29733797 GATGTTTTTATTCCTGTCCTTGG - Intergenic
1109011950 13:56960711-56960733 TACATTTGTATTCCTGTTCTTGG + Intergenic
1110584146 13:77168646-77168668 CATATTTTTATATGTGTACTAGG - Exonic
1110815924 13:79859956-79859978 GACATTTGAGTTGGTGTACTGGG + Intergenic
1112313539 13:98341225-98341247 GACATGTCCATCCGTGTACTTGG + Intronic
1112334644 13:98504145-98504167 GAAATTTTCATTTGTGTGCTTGG - Intronic
1114153280 14:20070083-20070105 TACATTGTTATTCTTCTACTAGG + Intergenic
1115582051 14:34770546-34770568 GATATTTATATTCTTGTAATGGG - Intronic
1117636554 14:57750683-57750705 GAAATGTCTATTCGTGTCCTTGG + Intronic
1123963958 15:25438052-25438074 GACATATTTAGCCGTGTGCTTGG - Intronic
1126280397 15:46940670-46940692 GACATGTTTATTATTTTACTTGG - Intergenic
1126524191 15:49631951-49631973 GGCATTGTTATTCATGTATTAGG - Intronic
1131752091 15:95520745-95520767 GACGTGTTTATTGGTCTACTGGG + Intergenic
1132321463 15:100928692-100928714 TAATTTTTTATTTGTGTACTAGG + Intronic
1137009241 16:35307119-35307141 GACATTGTGACTCATGTACTTGG - Intergenic
1137034737 16:35560161-35560183 GACATTGTGACTCATGTACTTGG - Intergenic
1137035376 16:35565364-35565386 CACAATTTTATTTGTGAACTGGG + Intergenic
1138411606 16:56844818-56844840 TACATTTTTATTTGTGTAATGGG + Intronic
1140626024 16:76795553-76795575 GACATTTTTCTTCGTGTTTTGGG + Intergenic
1146593772 17:34152299-34152321 GTCATTTGTATTTCTGTACTTGG + Intronic
1153725656 18:7952168-7952190 GACATATTTATTGATGTATTAGG + Intronic
1155337226 18:24777027-24777049 CACATTTTTGGTAGTGTACTTGG + Intergenic
1156714422 18:39989914-39989936 GATATTTTTATTTCTGTACCTGG - Intergenic
1157871474 18:51233626-51233648 GACATTTGAATCCGTGGACTGGG - Intergenic
1162594648 19:11618419-11618441 GACATTATTATGTCTGTACTAGG + Exonic
1164656567 19:29926194-29926216 AAGATTTTTATTCGGGTAATGGG - Intronic
927340698 2:21980592-21980614 CTCATTTCTGTTCGTGTACTTGG + Intergenic
934865512 2:97806563-97806585 AACAGTTTTATTTGTGTGCTGGG - Intronic
937020392 2:118645663-118645685 GACATTTTTATATGTGTATCTGG + Intergenic
938401607 2:130997142-130997164 TACATTTCTATTCATGTACAAGG + Intronic
939247388 2:139643877-139643899 GACATTTTTTTTCTTCTACTTGG + Intergenic
943080177 2:183250327-183250349 GAAATTTTTATCTGTTTACTAGG - Intergenic
943280859 2:185930840-185930862 GTTATTTTTATTTGTGTAATTGG - Intergenic
943604897 2:189965483-189965505 GAATTTTCTATTCATGTACTTGG - Intronic
945850367 2:214998970-214998992 TACATTTTTCTTGGGGTACTTGG - Intronic
1169213530 20:3780790-3780812 GACATGTTTAGTCTTGTATTTGG - Intronic
1170104308 20:12737094-12737116 GACATTTTTAGTAATGTCCTTGG - Intergenic
1170293509 20:14797690-14797712 TAGATTTTTATTCCTGCACTGGG + Intronic
1173603958 20:44316253-44316275 TAAATTTTTATGTGTGTACTAGG - Intergenic
1175641172 20:60631736-60631758 AACATTTTTATTGCTTTACTTGG - Intergenic
1180907861 22:19427960-19427982 CACATTTTACTTCGTGTTCTTGG - Intronic
1183502617 22:38189824-38189846 GACATCTCTATTCTTGTCCTTGG + Intronic
1184961253 22:47930437-47930459 GACATTTTTATTCTTGGCCTTGG - Intergenic
951701724 3:25503632-25503654 TACATTTATTTTTGTGTACTTGG - Intronic
951797458 3:26556466-26556488 GACATTTGTCTTTCTGTACTTGG - Intergenic
957463514 3:80555211-80555233 GACATTTTGATTCATATTCTTGG + Intergenic
961161922 3:124734582-124734604 TAGATTTATATTTGTGTACTGGG + Intronic
963471326 3:145746094-145746116 GTCATTATTATTGTTGTACTTGG - Intergenic
963510961 3:146248720-146248742 GAGATTTTTATTTGTACACTTGG + Intronic
967372488 3:188762707-188762729 GAGATATTTAATCGCGTACTTGG + Intronic
967510866 3:190310366-190310388 GACATTTTTATTTTGGTATTAGG + Intronic
967602075 3:191401900-191401922 GACATTTGTGTTGGTGGACTGGG - Intergenic
968380248 4:88897-88919 GACATTTTCATTCTCTTACTTGG - Intergenic
968416413 4:438788-438810 GATATTTTTAATCTTTTACTTGG + Intronic
969182085 4:5450017-5450039 GACATTTTTTTCCATGGACTAGG - Intronic
971420360 4:26468608-26468630 TGTATTTTTATTTGTGTACTCGG - Intergenic
973135826 4:46705486-46705508 GACAATTTTATTCGTGTACATGG - Intergenic
973247355 4:48023725-48023747 GACATTTATAATAGTGGACTTGG + Intronic
973607388 4:52601008-52601030 TATATTTTTAATTGTGTACTAGG - Intronic
974773847 4:66453701-66453723 GTCATTTTTATTTGTATAATAGG - Intergenic
974989738 4:69071780-69071802 TACACTTTTTTTCTTGTACTTGG - Intronic
976957950 4:90927342-90927364 GCCATTTTTAGTCTTGAACTTGG + Intronic
981381597 4:144078292-144078314 AACACTTATATTAGTGTACTTGG + Intergenic
982795545 4:159639489-159639511 GACATTTTTATTAAATTACTGGG - Intergenic
983120392 4:163876808-163876830 TACATTTTTATTAATTTACTAGG + Intronic
983802408 4:171949347-171949369 GAAATTTATATTTGTGTTCTTGG + Intronic
985976546 5:3422763-3422785 GACATTTTTAATGGTGTAACTGG - Intergenic
987807384 5:22786633-22786655 GACATCTTCATTTGTGTAATGGG + Intronic
987989568 5:25193108-25193130 GACATTTGAATTGGTGGACTGGG + Intergenic
988365065 5:30288041-30288063 GAGATTTTTTTTCTTTTACTTGG + Intergenic
988811376 5:34788352-34788374 GACATTTTTTATCATGGACTAGG - Intronic
994874215 5:105394186-105394208 TACATTTTAATTCTTGTACAAGG + Intergenic
997951423 5:138245612-138245634 GACATCATTATTTGAGTACTTGG - Intergenic
1000603925 5:163307873-163307895 GACATGTTTTTTCATGGACTAGG + Intergenic
1000725617 5:164766817-164766839 TACATTTTTATTCATTTAGTAGG - Intergenic
1000871797 5:166586155-166586177 GTCATTTGTATTCGTTTTCTAGG - Intergenic
1002525570 5:179813992-179814014 GACATTTTTATTCGTGTACTAGG - Intronic
1002856854 6:1045512-1045534 GAGATTTTTATGGGTTTACTGGG + Intergenic
1007110452 6:39310576-39310598 GACATGTTTCTTGCTGTACTGGG + Intronic
1007332582 6:41124844-41124866 TACATGGGTATTCGTGTACTTGG + Intergenic
1008658108 6:53636675-53636697 CAGATTTTTCTTCCTGTACTTGG - Intergenic
1009698786 6:67146731-67146753 GACATTTTTATCTGTGAAATTGG - Intergenic
1011293690 6:85805063-85805085 CACATTTTTCTTCATGAACTTGG + Intergenic
1011960412 6:93081703-93081725 GAGAGTTTTATTCATTTACTTGG + Intergenic
1013027284 6:106288356-106288378 GACATTTTGATTCCTAAACTTGG - Intronic
1015862044 6:137691442-137691464 TACATTTTTGGTAGTGTACTGGG - Intergenic
1018339420 6:162834994-162835016 TACATTTTTATTATTCTACTTGG + Intronic
1023846791 7:44125874-44125896 GAGATCTTTATTCGTTTATTCGG + Intergenic
1025743888 7:64226117-64226139 CACAATTTTATTTGTGAACTGGG + Intronic
1032004441 7:128288968-128288990 GACATTTGTATTAGTGTCCTAGG - Intergenic
1032974241 7:137203596-137203618 GACAGTTTGATTTGTGTTCTTGG + Intergenic
1039605047 8:38873517-38873539 GACTTTTTTGTGTGTGTACTTGG + Intergenic
1042505246 8:69552531-69552553 GACATTTTTCTTAGTGAATTTGG + Intronic
1046064108 8:109176172-109176194 TACATTTTTGTTGGTGTACTGGG + Intergenic
1049993114 9:1008684-1008706 GACATTTGTCTTTCTGTACTTGG - Intergenic
1050978140 9:11968624-11968646 GACATTTGAATCAGTGTACTGGG + Intergenic
1051837210 9:21353681-21353703 AACATTTTTATTTGTTTACCTGG + Intergenic
1057295632 9:93836877-93836899 GACATTTGTCTTTCTGTACTTGG + Intergenic
1187093928 X:16126897-16126919 GACATTCTTATTCATGTCTTTGG + Intronic
1187880484 X:23842473-23842495 GAAATTGTTATTCGTGTTCATGG - Intronic
1188382055 X:29506944-29506966 GACATTTTTTTTTGCATACTTGG + Intronic
1189893654 X:45631956-45631978 CACATTTTTATCAGTGAACTTGG - Intergenic
1192047831 X:67695200-67695222 GCCATCTTTATTTGTGTATTAGG + Intronic
1193748061 X:85308054-85308076 GACATCTTTATTTCTGTATTAGG + Intronic
1194507961 X:94756155-94756177 GACATTTTAAATAGTGTAGTTGG - Intergenic
1194920998 X:99763836-99763858 GCCATTTTTATTTGTTTTCTGGG - Intergenic
1195663897 X:107410586-107410608 GACATTTGAATTGGTGGACTGGG - Intergenic
1196001082 X:110786858-110786880 AAAATTTTTATTCATTTACTTGG + Intronic
1196137570 X:112226701-112226723 GACATTATTATTCATGTATTTGG + Intergenic
1198304245 X:135365063-135365085 TACATTTATATTCTTGTACTAGG - Intergenic