ID: 1002529737

View in Genome Browser
Species Human (GRCh38)
Location 5:179837097-179837119
Sequence TCTCAGTGAAACCAACATTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002529737 Original CRISPR TCTCAGTGAAACCAACATTG CGG (reversed) Exonic
900351217 1:2235583-2235605 ACACAGTGAAACCAACATGCAGG - Intronic
903968483 1:27103949-27103971 TTTCATTGAAGGCAACATTGGGG - Intronic
905039481 1:34943404-34943426 TCTAAGTGAATATAACATTGAGG + Intergenic
907090096 1:51715646-51715668 TGTCAGTCTAACCAACAATGGGG - Intronic
908906577 1:69019455-69019477 TATCAGACAAACCAAAATTGAGG - Intergenic
911591351 1:99751690-99751712 TCTCAGACAAACAAAAATTGAGG + Intronic
911806423 1:102214133-102214155 TCTCAGACAAACAAAAATTGAGG + Intergenic
911868526 1:103060290-103060312 TCTCAGACAAACAAAAATTGAGG + Intronic
912048820 1:105496562-105496584 TCTCACTGAAACATATATTGTGG + Intergenic
912530863 1:110320530-110320552 TCAGAATGAAACTAACATTGAGG + Intergenic
912855234 1:113162815-113162837 TCTCAGACAAACAAAAATTGAGG - Intergenic
912970446 1:114276586-114276608 TCTCAGACAAACGAAAATTGAGG + Intergenic
913422481 1:118687629-118687651 TCTCAGACAAACAAAAATTGAGG + Intergenic
916775934 1:167964249-167964271 TCTCAGATAAATTAACATTGAGG - Intronic
919203146 1:194385212-194385234 TGGCAATAAAACCAACATTGTGG - Intergenic
919272437 1:195365432-195365454 TCTCAGACAAACAAAAATTGAGG + Intergenic
920673215 1:208020591-208020613 TCTCAGTAAAAGCAACAATATGG - Intergenic
923964077 1:239116810-239116832 TCTGAGTGAAACCTGCAATGTGG - Intergenic
924171771 1:241349797-241349819 TCTCTTTGAAAACAAGATTGTGG - Intronic
1064704030 10:18051829-18051851 TCTCAGACAAACAAAAATTGAGG + Intergenic
1065405393 10:25357851-25357873 TCTCAGTGAATCTACCATTCTGG - Intronic
1068144882 10:53056179-53056201 TCTCAGACAAACAAAAATTGAGG - Intergenic
1070349036 10:75574631-75574653 TCTTGGTAATACCAACATTGAGG - Intronic
1072828673 10:98634911-98634933 TCTCAGAGAAAGTGACATTGAGG - Intronic
1073714248 10:106084542-106084564 GCTCAGTGAAGGCAACATAGTGG + Intergenic
1073880827 10:107977780-107977802 TGTGAGTGTAACCACCATTGTGG + Intergenic
1075489590 10:122855155-122855177 TCTCAGAGAAATAAAGATTGTGG + Intronic
1076155608 10:128202807-128202829 TGTCAGTGAATCTAACATTCTGG - Intergenic
1076262871 10:129083142-129083164 TCTCAGGCAAACCAGCATGGTGG + Intergenic
1076336612 10:129710703-129710725 CATCAGTGAAATCAACAGTGAGG + Intronic
1076576217 10:131471076-131471098 TCTCAGACAAACAAAAATTGAGG - Intergenic
1076647625 10:131964062-131964084 TATCAGGCAAACCAAAATTGAGG - Intergenic
1077596590 11:3537387-3537409 TGTCAGTGAATCCACCATTCTGG + Intergenic
1078517429 11:12034986-12035008 TCTCAGAGAAACAAATGTTGAGG + Intergenic
1078704086 11:13722110-13722132 TCTCTCTGAAACCAACATTAAGG - Intronic
1078976505 11:16484254-16484276 TCCCAGTGACACCAACATTCTGG - Intronic
1079261432 11:18886148-18886170 TCACATTGAAACCAATACTGAGG + Intergenic
1079369400 11:19837642-19837664 TCTCAGACAAACCCAAATTGTGG + Intronic
1080166759 11:29246436-29246458 TCTCAGAAAAATAAACATTGAGG + Intergenic
1080408693 11:32003086-32003108 TCACTGTGAAACCAGCAATGAGG + Intronic
1081685332 11:45038520-45038542 TCTGAGTGAAAACAACCTTAGGG + Intergenic
1084252506 11:67911361-67911383 TGTCAGTGAATCCACCATTCTGG + Intergenic
1084820348 11:71684670-71684692 TGTCAGTGAATCCACCATTCTGG - Intergenic
1088606062 11:111533801-111533823 TCTCGGTGAGACCAATAGTGAGG + Exonic
1089220945 11:116871139-116871161 TCACAGTGATACAAGCATTGTGG - Intronic
1091437984 12:488227-488249 TCTCAGACAAACAAAAATTGAGG + Intronic
1092349728 12:7746340-7746362 TCACAGTGAAACAGACACTGAGG + Exonic
1092422759 12:8346160-8346182 TGTCAGTGAATCCAACATTCTGG + Intergenic
1092867017 12:12771045-12771067 TCTCAGACAAACAAAAATTGGGG + Intronic
1095093701 12:38131896-38131918 TCTCAGTTAAACCTACAATTTGG - Intergenic
1097456304 12:59802670-59802692 TCTCAGAAAAACAAAAATTGAGG - Intergenic
1097478079 12:60083981-60084003 TCTCAGTGATACCCACTGTGTGG + Intergenic
1097800943 12:63913162-63913184 TCTCAGTGCAACCAATTTTCTGG + Intronic
1104296119 12:127515255-127515277 TCTCAGTGAAAACCATATTTAGG - Intergenic
1104431292 12:128718450-128718472 AATCAGGGAAACCAACAGTGTGG - Intergenic
1105880774 13:24604952-24604974 CCTCAGAGAAACAAACACTGAGG - Intergenic
1107484801 13:40815411-40815433 GCTCAGAGAAACAAACACTGAGG + Intergenic
1110360358 13:74617639-74617661 TCTCAGACAAACAAAAATTGAGG + Intergenic
1110769832 13:79329092-79329114 TCTCACTGACACCAACATGTGGG - Intronic
1111267774 13:85841157-85841179 TTTCAGTAAAAGCAACAATGAGG + Intergenic
1111591664 13:90354832-90354854 TCTCAGCCAAACAAAAATTGAGG + Intergenic
1111979063 13:94997954-94997976 TATCAGACAAACCAACACTGAGG - Intergenic
1115668684 14:35583894-35583916 TCTCAGGCAAACAAAAATTGAGG + Intronic
1116202519 14:41816481-41816503 CCTCAGACAAACAAACATTGAGG - Intronic
1116638804 14:47434833-47434855 TTTAATTAAAACCAACATTGAGG + Intronic
1117745313 14:58863284-58863306 TTTAATTGAAAACAACATTGTGG + Intergenic
1117771179 14:59136006-59136028 TCCCAGTGACACTGACATTGTGG - Intergenic
1118175727 14:63438176-63438198 TCTCTGTGAATTCCACATTGAGG + Intronic
1120234833 14:81878169-81878191 TCTCAGACAAACAAAAATTGAGG + Intergenic
1120795706 14:88630849-88630871 TATCGGTGAAGCCAACACTGTGG + Intronic
1121976790 14:98412011-98412033 TCTCAGTGCAAAGAACAGTGTGG - Intergenic
1122457329 14:101864640-101864662 GCTCAGTGAAAGCAATATAGAGG + Intronic
1124559983 15:30762966-30762988 AGTCAGTGAAACCAAAAGTGGGG + Intronic
1124703722 15:31941631-31941653 TCTCAGACAAACAAAAATTGAGG - Intergenic
1125951202 15:43753385-43753407 TCCCTGGGAAACCAGCATTGTGG - Intronic
1128556759 15:68637076-68637098 TATCTGTGGAACCAACATTTGGG - Intronic
1129085228 15:73082273-73082295 TCTCAGTGAAAAAAACTTAGGGG - Intronic
1129643640 15:77409485-77409507 TCTGAGAGTAAGCAACATTGTGG - Intronic
1129713405 15:77833103-77833125 TCTGCCTGAAACCTACATTGAGG + Intergenic
1130953944 15:88613566-88613588 TCTCAGTGAAACAAGCATCTCGG + Intergenic
1131288074 15:91079412-91079434 TCTTAGACAAACAAACATTGAGG - Intergenic
1132297007 15:100745830-100745852 TCTCAGACAAACAAATATTGAGG - Intergenic
1133375492 16:5283376-5283398 TGTCAGTGAATCCACCATTCTGG - Intergenic
1134435153 16:14249886-14249908 TCTGGGTGAAACCAGCTTTGGGG + Intronic
1136248116 16:28986529-28986551 TCTCTTTGAAGCCAACAGTGTGG + Exonic
1138176527 16:54903574-54903596 TCTCAGACAAACAAAAATTGAGG + Intergenic
1140717177 16:77737354-77737376 TATCAGACAAACCAAAATTGGGG - Intronic
1144337145 17:14281562-14281584 TCTCACTGAAACCAAGGTTGAGG + Intergenic
1150363641 17:64561373-64561395 CCTCAGTGATACAAACATTAGGG + Intronic
1150511944 17:65763010-65763032 TCTCAGACAAACAAAAATTGGGG - Intronic
1151795482 17:76342346-76342368 TCACGGTGAAACCCAAATTGAGG + Intronic
1155623527 18:27808400-27808422 CCTCAGTGAAAGCTACACTGAGG - Intergenic
1155921483 18:31607667-31607689 TGTTAGTGAAAGCAACATAGAGG + Intergenic
1157925037 18:51754789-51754811 TCTCAGTTCAACAAACATTCGGG + Intergenic
1158783784 18:60684194-60684216 AGTCAGTGAAACCCACATGGTGG - Intergenic
1159467818 18:68808090-68808112 TCCCAGTGAAATCAACATTTTGG + Intronic
1159862797 18:73669208-73669230 TCTCAGTGAAACACACAGAGGGG + Intergenic
1163817624 19:19476567-19476589 TTGCAGTGAAACCAACCTGGAGG + Intronic
1165087455 19:33361030-33361052 TCCCAGTGACACCAACATTCTGG - Intergenic
1167190481 19:47985439-47985461 TCTCAGACAAACAAACATTGAGG + Intronic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
926500262 2:13644244-13644266 TGTCAGTGAATCTACCATTGTGG - Intergenic
928479414 2:31667009-31667031 TCTCAGTGAAAACATCACTGTGG + Intergenic
929559202 2:42945297-42945319 TTTCAGTGACCCCCACATTGGGG + Intergenic
931071711 2:58658989-58659011 TCTCAGTGAATCCCGCATTCTGG + Intergenic
932176359 2:69606448-69606470 CCTCAGTGAATCAGACATTGAGG - Intronic
933245963 2:79975242-79975264 TCTGAATGAAACCAACTGTGAGG - Intronic
933885244 2:86713222-86713244 TCTCAGACAAACGAAAATTGAGG + Intronic
934649348 2:96082097-96082119 TCTCAGACAAACGAAAATTGAGG - Intergenic
934796181 2:97101545-97101567 TCTCAGACAAACAAAAATTGAGG + Intergenic
935107701 2:100060994-100061016 CATCAGTCAAACCTACATTGAGG - Intronic
937527148 2:122785381-122785403 TCTAAGGGAAAACAAAATTGAGG + Intergenic
940083417 2:149830621-149830643 TCTCAGACAAACAAAAATTGAGG - Intergenic
943334648 2:186599294-186599316 TCTCAGGGACAACAACATTTAGG - Intronic
943491111 2:188557649-188557671 TCTCAGTGGATCCACCATTCTGG + Intronic
948815217 2:240507058-240507080 TCTCGGTGAAAACAAGATTCAGG - Intronic
1170215394 20:13885733-13885755 TCATACTAAAACCAACATTGGGG + Intronic
1172890112 20:38258388-38258410 TTTCAGTGATACTAACATTTGGG + Intronic
1173378311 20:42510912-42510934 TCTCAGTGATTGCCACATTGGGG - Intronic
1174935928 20:54868536-54868558 TATCAGAGAAACCCAAATTGAGG - Intergenic
1175088447 20:56481501-56481523 TCTCTTTTAAACCACCATTGGGG + Intronic
1178301328 21:31455761-31455783 TATCAGGCAAACCAAAATTGAGG + Intronic
1182688879 22:32142105-32142127 TATCAGTGTTACCAACATTGAGG - Intergenic
949834009 3:8248414-8248436 TCTCAATGAAGCCAACCCTGTGG + Intergenic
952199114 3:31107065-31107087 TCTTAGTGAAACCCTCACTGGGG - Intergenic
952320115 3:32269163-32269185 TCTCAGAGTAAACAATATTGAGG + Intronic
952917481 3:38259710-38259732 TCTCAGGGAAACAAAAACTGGGG - Intergenic
953147894 3:40295558-40295580 TCTCAGTACTGCCAACATTGGGG - Intergenic
954083432 3:48225670-48225692 TCTCAGTGGAACCCCCAGTGGGG + Intergenic
954498919 3:50991041-50991063 TTTCAGATAAACAAACATTGAGG + Intronic
954585531 3:51732595-51732617 TCTCAGACAAACAAAAATTGAGG - Intergenic
957066570 3:75527799-75527821 TGTCAGTGAATCCACCATTCTGG + Intergenic
957192501 3:77027990-77028012 TTTCAGTGAAACCAAGCCTGTGG + Intronic
957233354 3:77550653-77550675 TATCAGTGAAACCCACTGTGTGG + Intronic
958859419 3:99428131-99428153 TCTCATTTAAAACAACATGGAGG - Intergenic
959529579 3:107417837-107417859 TCTCAGACAAACAAAAATTGAGG + Intergenic
960020217 3:112942023-112942045 TCTCAGACAAACAAAAATTGTGG + Intronic
961900191 3:130202716-130202738 TGTCAGTGAATCCAACATTCTGG + Intergenic
962000946 3:131296507-131296529 TCTCAGACAAACAAAAATTGAGG - Intronic
962951916 3:140227514-140227536 TCTCAGTGGATCTACCATTGTGG + Intronic
963232577 3:142923719-142923741 TCTCAGACAAACAAACATTGAGG - Intergenic
963270678 3:143283123-143283145 TCTCAATTCAACAAACATTGAGG - Intronic
963849177 3:150192631-150192653 TCTCAGACAAACTAAAATTGAGG - Intergenic
963995833 3:151707756-151707778 TGTCAGGGAAACCAATATTATGG + Intergenic
969011163 4:4063866-4063888 TGTCAGTGAATCCACCATTCTGG + Intergenic
969742906 4:9046032-9046054 TGTCAGTGAATCCACCATTCTGG - Intergenic
969802283 4:9578111-9578133 TGTCAGTGAATCCACCATTCTGG - Intergenic
970328573 4:14955008-14955030 TCTCAGGGACACCAACATCTGGG - Intergenic
970430742 4:15986797-15986819 TCTCAGTGAGACCAACATCATGG - Intronic
970840887 4:20467755-20467777 TCTCAGTGAAAACCAAATTCAGG + Exonic
973240771 4:47953956-47953978 TCTCAGAAAATGCAACATTGAGG - Intronic
974285244 4:59856332-59856354 TCTCACTGAAGCCAGCATTATGG + Intergenic
974518072 4:62942100-62942122 TTTCAGTGAAAATAAAATTGAGG - Intergenic
975159388 4:71108340-71108362 TCTCAGATAAACAAAAATTGAGG - Intergenic
975301667 4:72797737-72797759 TGTCAGTGAATCCACCATTCTGG + Intergenic
975664089 4:76717028-76717050 TCTCAGGTAAACAAAAATTGAGG - Intronic
976214288 4:82700831-82700853 TCTCAGACAAACCAAAATTGAGG + Intronic
976828730 4:89289076-89289098 TTTCAGTAAAACCAACATTTCGG - Intronic
978058305 4:104302025-104302047 TCTCAGAGAAACAAAAACTGAGG + Intergenic
978231836 4:106409298-106409320 TCTCAGTGAAAATTACATAGAGG - Intergenic
978643910 4:110906242-110906264 TCTCATGGAAACCAAGAGTGGGG - Intergenic
979354261 4:119684499-119684521 TTCCAGTGCAACCAACAATGTGG - Intergenic
979359969 4:119750434-119750456 CCTCTGTGTAACCAACAGTGTGG - Intergenic
981046181 4:140267400-140267422 TCTGAGTGAGACCAGCTTTGCGG + Intronic
982922146 4:161289328-161289350 TCTCAGACAAACAAAAATTGAGG + Intergenic
984071662 4:175121479-175121501 TCTCAGACAAACAAACACTGAGG + Intergenic
986087542 5:4466608-4466630 TATCAGTGAAAACTGCATTGAGG - Intergenic
986433080 5:7701138-7701160 TATGTTTGAAACCAACATTGAGG - Intronic
986644712 5:9905491-9905513 TCTCAGACAAACAAACATTGAGG + Intergenic
986962447 5:13231704-13231726 TTTCTGTGCAACAAACATTGAGG + Intergenic
987168746 5:15230070-15230092 TCCCAGATAAACAAACATTGAGG - Intergenic
987182383 5:15381262-15381284 TCTCAGTGAAACCTAACCTGAGG - Intergenic
987384125 5:17312869-17312891 TTTCAGTGAAAACAAAAATGGGG + Intergenic
987411476 5:17619536-17619558 TTTCTGTAAAACCAACATTTTGG - Intergenic
987444029 5:17994059-17994081 ATTCATTTAAACCAACATTGTGG + Intergenic
988142964 5:27266953-27266975 ACTCAGTGATGCCAACATGGAGG - Intergenic
988240849 5:28606894-28606916 TCTCATTGTAACAAACATGGCGG + Intergenic
988647964 5:33116590-33116612 TCTCAGACAAACAAAAATTGAGG - Intergenic
989347110 5:40441418-40441440 TCTCAGAGAAAAAAACATTTCGG + Intergenic
989689096 5:44119424-44119446 TATCCGTGAAACCAAAATTCTGG - Intergenic
990141133 5:52705722-52705744 TCTCAGTGGAACAAAAATTTGGG + Intergenic
991412603 5:66359714-66359736 TCTCAGGGGACCCAACATGGAGG - Intergenic
992113517 5:73517925-73517947 ACTCAGTGAACCCAACCTTCAGG - Intergenic
992789879 5:80203845-80203867 TATCAGTGGAACCAACCATGTGG + Intronic
992855785 5:80860347-80860369 TCTCAGACAAACAAAAATTGAGG - Intronic
993240137 5:85372202-85372224 TTTCAATGAAACAAAAATTGTGG + Intergenic
994850917 5:105053783-105053805 TCCCAGTGAGACCAACAGAGAGG - Intergenic
996233512 5:121096869-121096891 TCTCAGACAAACAAAAATTGAGG + Intergenic
996287947 5:121817081-121817103 TCTCCGAGAATCCAAAATTGTGG + Intergenic
996743634 5:126826131-126826153 TTTAAGTGAAATTAACATTGTGG - Intronic
996827846 5:127705501-127705523 TCTCAGTGACACCCTCATAGAGG - Intergenic
1000120759 5:158195670-158195692 TCTCTGTGAAACCCTCATTTAGG + Intergenic
1000200406 5:159004300-159004322 TCTCAGTGATATCAAATTTGAGG + Intronic
1000220836 5:159212125-159212147 TCTAAATGCATCCAACATTGAGG + Intergenic
1000902968 5:166930991-166931013 TCTCAGCCAAACAAAAATTGAGG + Intergenic
1001207012 5:169773635-169773657 TCACAGTGAAAACAAAATTTTGG - Intronic
1001480142 5:172082886-172082908 TCTCAGTGGAAGCTACATAGTGG - Intronic
1001988375 5:176095267-176095289 AATCAGTGTTACCAACATTGGGG + Intronic
1002084593 5:176765309-176765331 TCTCAGGCAAACAAAAATTGAGG - Intergenic
1002228493 5:177742866-177742888 AATCAGTGTTACCAACATTGGGG - Intronic
1002529737 5:179837097-179837119 TCTCAGTGAAACCAACATTGCGG - Exonic
1003368217 6:5497702-5497724 TCTCAGTCAGAACAATATTGAGG - Intronic
1004793007 6:19050198-19050220 TCTCAGAAAAACAAAAATTGAGG - Intergenic
1005185925 6:23163048-23163070 TCTCAGAGAAGCCACCACTGGGG + Intergenic
1005800910 6:29423180-29423202 TCTCAGAGGAACAAAAATTGAGG + Intronic
1005886972 6:30104326-30104348 TCTCAGTGACAACAAGAGTGTGG + Intronic
1008910983 6:56732992-56733014 TCTAAGTAAAACTAACTTTGAGG + Intronic
1009042130 6:58191275-58191297 TCCCAGGGACACAAACATTGCGG + Intergenic
1009217966 6:60945507-60945529 TCCCAGGGACACAAACATTGCGG + Intergenic
1009518305 6:64648621-64648643 TGTCAGATAAACCAAAATTGAGG + Intronic
1009693779 6:67069492-67069514 TGTCAGTGGATCCAACATTCTGG - Intergenic
1009750509 6:67873691-67873713 TATCCGTGAAACCAAAATTCCGG - Intergenic
1009918290 6:70024263-70024285 TCAGAGTGAAACCCACATTTGGG - Intronic
1013572273 6:111440797-111440819 TCTCAGACAAATAAACATTGAGG - Intronic
1014939662 6:127423011-127423033 TCTCAGTAAAATCAACACAGAGG - Intergenic
1015718038 6:136211993-136212015 TCTCAAGCAAACCAACATAGTGG + Intergenic
1017659587 6:156660771-156660793 TCTCAGAAAAACAAAAATTGAGG + Intergenic
1021163641 7:17306599-17306621 CCTCAGTAATACCAACATTTAGG - Intronic
1021331609 7:19345299-19345321 TCTCAGGCAAACAAAAATTGAGG - Intergenic
1021949775 7:25763256-25763278 TCTCAGTGCATCCATCATTCTGG + Intergenic
1022296387 7:29058595-29058617 TCTCAGACAAACAAAAATTGAGG - Intronic
1022420480 7:30216525-30216547 TCTCAGACAAACAAACATTGAGG + Intergenic
1022857528 7:34330058-34330080 TTTCAGTGAAACCATCATCTGGG + Intergenic
1023160926 7:37294615-37294637 TCTTTGTGATACCAAAATTGAGG + Intronic
1024339814 7:48245886-48245908 TCTCAGAGAAACGACCATTCGGG - Exonic
1024705974 7:51959905-51959927 TATCACTGAAACAACCATTGAGG - Intergenic
1025731782 7:64114279-64114301 TCTCAGTGACAGCCACAGTGCGG - Intronic
1025759197 7:64374436-64374458 TATCAGTGAAACCAGCATACAGG + Intergenic
1030792098 7:113742839-113742861 TCTCAGACAAACAAAAATTGAGG - Intergenic
1032709503 7:134449731-134449753 TCCCAGTGACACCAACATTCTGG - Exonic
1032874841 7:136027033-136027055 TTTAAGTCAAATCAACATTGGGG + Intergenic
1035412011 7:158652098-158652120 TCTCAGTGTATCCACCATGGGGG + Intronic
1036248113 8:7137846-7137868 TGTCAGTGAATCCACCATTCTGG - Intergenic
1036886135 8:12555152-12555174 TGTCAGTGAATCCACCATTCTGG + Intergenic
1036893751 8:12614240-12614262 TGTCAGTGAATCCACCATTCTGG + Intergenic
1037022400 8:13989647-13989669 TCTCTGGGAAACCAATAGTGTGG - Intergenic
1037964084 8:23119647-23119669 TTTCATTAAAATCAACATTGAGG + Intergenic
1037976672 8:23218968-23218990 TTTCATTAAAATCAACATTGAGG - Intronic
1038358727 8:26856347-26856369 GCTTAGTGAAAACAAGATTGTGG - Intronic
1040359205 8:46649228-46649250 TGTCACTGAAACCAACATCCAGG + Intergenic
1040722278 8:50339236-50339258 CCTCAGTCAAACAAAAATTGGGG + Intronic
1041733117 8:61083019-61083041 TCTCAGACAAACAAACATTAAGG + Intronic
1042386338 8:68179484-68179506 TGTCATTGAAAACAACACTGGGG + Intronic
1045891046 8:107157785-107157807 TCTCAGGTAGAGCAACATTGAGG - Intergenic
1045921878 8:107539857-107539879 TATGAGAGAAACCTACATTGTGG + Intergenic
1046261667 8:111776207-111776229 TCACAGTGAAACCCAAATTGTGG - Intergenic
1046776535 8:118169640-118169662 TCTCCCTGAAAGAAACATTGGGG - Intergenic
1050821679 9:9887311-9887333 TCTCAGTGACAAAAACATAGAGG - Intronic
1051015887 9:12475179-12475201 TGTCAGTGGATCCACCATTGTGG - Intergenic
1051121042 9:13752747-13752769 TCTAAATTAAACCAACACTGAGG - Intergenic
1051814611 9:21090746-21090768 TCTCAGACAAACAAAAATTGAGG - Intergenic
1052093887 9:24361785-24361807 TCACAGAGAAAGCAACATGGGGG + Intergenic
1055207424 9:73749873-73749895 TCTCAGACAAGCAAACATTGAGG - Intergenic
1055489077 9:76786294-76786316 TCTGAGTGATATCAACATTAGGG + Intronic
1056123629 9:83513707-83513729 TCCCAGTGAGACCAACACAGAGG + Intronic
1061688638 9:132305652-132305674 TATCAGAGAAACCAAAATGGAGG + Intronic
1185996445 X:4955370-4955392 ACTCATGAAAACCAACATTGTGG - Intergenic
1188280487 X:28262015-28262037 TCCCAGTAAAACAAAAATTGAGG + Intergenic
1188749294 X:33885409-33885431 TGTCAGTGAATCCACCATTTTGG - Intergenic
1189069889 X:37852094-37852116 TATGGGTGAAACCAAGATTGAGG - Intronic
1189934051 X:46046556-46046578 TCTTAGACAAACAAACATTGAGG + Intergenic
1191897293 X:66006498-66006520 TCTCAAAGAAACCTTCATTGAGG + Intergenic
1192791859 X:74390081-74390103 TCTCAGAAAAACAAAAATTGAGG + Intergenic
1193075088 X:77347219-77347241 TCCCAGTGAAATCAACATAGAGG + Intergenic
1195611218 X:106869298-106869320 TCACAGTAAAAAGAACATTGGGG - Intronic
1195879031 X:109573524-109573546 TCTGAGTAAACCCAACATAGAGG + Intergenic
1196472448 X:116043878-116043900 TCCCAATGACACCAGCATTGTGG + Intergenic
1197452484 X:126637279-126637301 TCTTAGTCAAACAAAAATTGAGG - Intergenic
1197908784 X:131457202-131457224 TCTCAGGCAAACAAACATTGAGG + Intergenic
1202255005 Y:22911830-22911852 TATCACTGAAACCAACATCCGGG + Intergenic
1202407996 Y:24545579-24545601 TATCACTGAAACCAACATCCGGG + Intergenic
1202462786 Y:25124502-25124524 TATCACTGAAACCAACATCCGGG - Intergenic