ID: 1002535744

View in Genome Browser
Species Human (GRCh38)
Location 5:179874461-179874483
Sequence CAGCTGTTCCAGCGGGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002535736_1002535744 17 Left 1002535736 5:179874421-179874443 CCCTGGACATTTGGCGTGACTAG 0: 1
1: 0
2: 0
3: 5
4: 39
Right 1002535744 5:179874461-179874483 CAGCTGTTCCAGCGGGCCCAGGG 0: 1
1: 0
2: 0
3: 12
4: 167
1002535737_1002535744 16 Left 1002535737 5:179874422-179874444 CCTGGACATTTGGCGTGACTAGT 0: 1
1: 0
2: 0
3: 4
4: 31
Right 1002535744 5:179874461-179874483 CAGCTGTTCCAGCGGGCCCAGGG 0: 1
1: 0
2: 0
3: 12
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002535744 Original CRISPR CAGCTGTTCCAGCGGGCCCA GGG Intronic
902332229 1:15736253-15736275 CAGCTGTTCCAGCGGTCTGCCGG - Intergenic
902609435 1:17588458-17588480 CAGCTGCTCCACCCGGCACAGGG + Exonic
903853137 1:26320324-26320346 CAGCTGTTTCAGGGGGCACAGGG - Exonic
904699826 1:32351634-32351656 CAGCTGGGCCAGCGCGCCGAGGG + Intronic
905168806 1:36098411-36098433 CAGTTGGTCCAGGGGGTCCATGG + Exonic
905308208 1:37033373-37033395 CAGCTGGTCCCTCGGGGCCAAGG - Intronic
905694027 1:39961891-39961913 CAGCTGTTGCAGCCTCCCCATGG - Intronic
905743153 1:40389833-40389855 AACCTGTTCCAGTGGGCACAAGG - Intronic
906057936 1:42930656-42930678 CAGCTGGTGCAGGGTGCCCAGGG + Exonic
906537339 1:46558792-46558814 CTGCTGTTCCTGCAGGGCCAGGG + Exonic
913260201 1:116990855-116990877 CAGCTGTTCCAGGGGCCCGCAGG - Intergenic
919743247 1:200993029-200993051 CAGCTCTTCCTGCAGCCCCAGGG + Intronic
921217968 1:212952727-212952749 CAGCCGTACCAGCGTCCCCAGGG - Intronic
923370059 1:233300910-233300932 CAGCTGTTCATGGGGGCCCATGG - Intergenic
1063977803 10:11430988-11431010 CAGCAGGTCCCACGGGCCCAGGG + Intergenic
1070148465 10:73791365-73791387 CAGCAGTGCCAGTGGGCACACGG + Exonic
1070724375 10:78778280-78778302 CAGCTCACCCAGGGGGCCCAGGG + Intergenic
1071298168 10:84237545-84237567 CAGCTGCTCCAGGCGGCCCAGGG + Exonic
1072002831 10:91214383-91214405 CTGCTGCTCCAGCAGTCCCATGG - Intronic
1074503470 10:114045471-114045493 CCGCCGTTGCAGCCGGCCCAGGG - Exonic
1074881525 10:117663244-117663266 GAGCTGTTCCAGCCTGCCCGTGG + Intergenic
1075446724 10:122518459-122518481 CACCTGTCCCAGCTGGTCCAGGG - Intergenic
1077799381 11:5522963-5522985 TAGCTGTTCCAGCTGCTCCAGGG + Intronic
1082797856 11:57390828-57390850 GAGCTGTTCCAGATGGCCCCTGG - Intronic
1083431246 11:62614562-62614584 CAGCGGTTCCAAGAGGCCCAGGG - Intronic
1084438968 11:69159920-69159942 CAGCTGTTCCGGGTTGCCCAGGG + Intergenic
1086306117 11:85482805-85482827 GACCTGTTCCAGCAGACCCATGG + Intronic
1087267800 11:96079861-96079883 CAGCTGTATCAGCAGGCCTAGGG + Intronic
1089499666 11:118924941-118924963 TCGCTGCTCCAGCTGGCCCAAGG + Intronic
1091079236 11:132651037-132651059 GAGCGGTTGCAGCAGGCCCAGGG - Intronic
1091556129 12:1574709-1574731 CAGCTGTTCAAGCAGGCACGAGG - Intronic
1092252073 12:6905133-6905155 CTGGTGTACCAGAGGGCCCAAGG + Intronic
1095981552 12:47977346-47977368 CAGTTGGACCAGCGGGGCCAGGG + Exonic
1097934277 12:65227796-65227818 CAGTTCTTCCAGTGGGGCCAAGG + Intronic
1099033964 12:77562448-77562470 AAGCTGTTCTAGCAGACCCAGGG - Intergenic
1101589423 12:106112648-106112670 CAGCTCTGCCTGGGGGCCCATGG + Intronic
1102013087 12:109631019-109631041 CAGCTGATGCAGCGTTCCCAGGG - Intergenic
1104262438 12:127196902-127196924 CAGCTGCTCCAGCCAGCCAAAGG + Intergenic
1105869687 13:24493632-24493654 CATGTGTTCCAGGTGGCCCAGGG + Exonic
1114999239 14:28401440-28401462 CAGCTGCTCCTGGGGGCCCTTGG + Intergenic
1117500297 14:56344615-56344637 CAGCAGCACTAGCGGGCCCAGGG - Intergenic
1119023515 14:71135011-71135033 CAGCTGATCCAGGGAGCACAGGG - Intergenic
1123115829 14:105893652-105893674 CAGCTGTGCCAGGGGCCCCCAGG + Intergenic
1123120071 14:105912367-105912389 CAGCTGTGCCAGGGGCCCCCAGG + Intergenic
1123402809 15:20003953-20003975 CAGCTGTGCCAGGGGCCCCCAGG + Intergenic
1123512146 15:21010607-21010629 CAGCTGTGCCAGGGGCCCCCAGG + Intergenic
1123899046 15:24858027-24858049 CAGCTGATCCATCGGGAGCAGGG + Intronic
1126108378 15:45161749-45161771 CTGCGGTTCCAGCGGCCCCAGGG + Exonic
1127959351 15:63879374-63879396 CAGCTGAGCCACTGGGCCCAGGG - Intergenic
1129159658 15:73740257-73740279 CAGCTGCCCCAGCGGACCCCAGG - Exonic
1129801479 15:78418240-78418262 CAGCTCTTCCGGCAGACCCATGG - Intergenic
1136428783 16:30185434-30185456 CAGCTCCTCCACCGGACCCATGG + Intronic
1139668143 16:68472592-68472614 CAGCTGCTCCAGCTGGCCTCTGG - Intergenic
1140804854 16:78523781-78523803 CAGCTGTTCCAGAGGCCCCCAGG - Intronic
1141125465 16:81397825-81397847 CAGCAGCTCAAGTGGGCCCAGGG - Intergenic
1141917501 16:87109737-87109759 CAGCTTATCCATCGAGCCCAGGG + Intronic
1142142304 16:88478104-88478126 CAACTGTGCCAGCGGGCCTGGGG - Intronic
1143090085 17:4444958-4444980 CAGATGGCCCAGCAGGCCCAGGG - Intronic
1148663863 17:49360887-49360909 CAGGTGTTCCTGAGGGTCCACGG + Intronic
1150209290 17:63433467-63433489 CAGCAGCTCCAGCAGCCCCAGGG + Exonic
1150335648 17:64328702-64328724 TAGCTCTTCCAGTGGGCCCCTGG - Intronic
1150804619 17:68309171-68309193 CAGCTGGCCCTGCGGGCCCCGGG - Intronic
1151324287 17:73369340-73369362 CTGCTGGTGCAGCGGGCCCGGGG - Intronic
1151417907 17:73978622-73978644 CAGCTTTTCCTGTGGGCCTATGG - Intergenic
1151954417 17:77373344-77373366 CAGCTGAGCCAGGGGGCCTAGGG + Intronic
1151977947 17:77492903-77492925 CAGCTCCTCCCGGGGGCCCAGGG + Intronic
1152225391 17:79090400-79090422 CAGCTGTGCCAGGGGGCCGGCGG - Intronic
1152587505 17:81195601-81195623 CATCTGTGACAGCAGGCCCACGG + Intronic
1152783653 17:82237255-82237277 CAGCTGCCCCAGCGGGCTCAGGG - Exonic
1153774282 18:8439140-8439162 CAGCTGCTCCTGCTGGCCCCTGG - Intergenic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1159138948 18:64369484-64369506 CAGCTGCTCCTGGGGGCCCTTGG + Intergenic
1161162007 19:2767039-2767061 CAGCTGGTCCCTGGGGCCCAGGG - Intronic
1161756689 19:6138889-6138911 CAGCTGCTCCAGAGGGGCCTTGG + Intronic
1161932309 19:7349144-7349166 CAGCGTTTCGAGCTGGCCCAAGG - Exonic
1163130075 19:15266872-15266894 CAGCTCTGCCAGCTGGCCCCTGG + Intronic
1163602882 19:18259289-18259311 GAGCTGCTCCAAGGGGCCCATGG - Intronic
1163713247 19:18859529-18859551 CTGCTGTTACAGCGAGCACAGGG - Intronic
1164463206 19:28465652-28465674 CAGCTCTGCCAGCAGGGCCAGGG - Intergenic
1165308105 19:35014307-35014329 CAGCAGATCCAAGGGGCCCAGGG - Exonic
1166720375 19:44992834-44992856 CAGCTCTGCCAGCGAGCCCCAGG + Exonic
925997926 2:9307051-9307073 CTGCTGGTGCAGCTGGCCCAGGG - Intronic
926280046 2:11438660-11438682 CACCTGGTCCAGCGTGCCAATGG - Intergenic
927148027 2:20179726-20179748 AAGCTCTGCCAGCAGGCCCAGGG - Intergenic
927718404 2:25367514-25367536 CAGCTGCTCCAGGGCGGCCATGG - Intergenic
928174604 2:29025096-29025118 CAGCTGGTCCAACAGGCCCCTGG - Intronic
928823653 2:35392308-35392330 CTGCTGCGCCAGCGGGGCCAGGG - Intergenic
932574318 2:72954505-72954527 CAGCTGTTGCAGGGGCCCCTGGG - Intronic
934133392 2:88970934-88970956 CAGCTCTACCTGGGGGCCCAGGG - Intergenic
937284215 2:120739655-120739677 CAGCTGTTCCCGCTGGGCCAGGG + Intronic
937954784 2:127416085-127416107 CAGCCGTTCCTGCGATCCCAGGG - Intergenic
941531360 2:166675240-166675262 CTGCTGTTCAAGATGGCCCAGGG - Intergenic
941877384 2:170447959-170447981 CAGCTGATCCATCGAGTCCAGGG + Intronic
943076704 2:183204567-183204589 CAGCTGTTCCAGAAGGTCCTGGG + Intergenic
946420765 2:219563291-219563313 CAGCTGTTCCAGTGGGAGCAGGG + Intronic
947012677 2:225582937-225582959 CAGCTCCTCCAGCGGGCTCGTGG - Exonic
947913115 2:233814598-233814620 CAGCTGCTCCAGGGAGCTCAGGG - Exonic
1169143534 20:3238815-3238837 CAGCTGATGCAGCGGGTCGAGGG - Intronic
1170036573 20:11996070-11996092 CAGCTTTTCCAACAGTCCCAGGG + Intergenic
1172122787 20:32608454-32608476 CTGCTGTTCCTGTGGGCCCTTGG - Exonic
1174112261 20:48204984-48205006 CAGCAGCTCCAGGGGGCTCACGG - Intergenic
1179354862 21:40649755-40649777 CAGCTATGCCAGCAAGCCCAGGG + Intronic
1179790411 21:43753026-43753048 CAGCTGTTCTTTTGGGCCCATGG - Intronic
1180612739 22:17108451-17108473 CTGCTCTTCCAGCAGGTCCAGGG - Exonic
1180833676 22:18919246-18919268 CAGCTCACCCAGCGGGCCCCAGG - Intronic
1181066153 22:20307008-20307030 CAGCTCACCCAGCGGGCCCCAGG + Intergenic
1181277617 22:21696471-21696493 CTGCTGATGCAGCTGGCCCAAGG - Intronic
1182557249 22:31135917-31135939 CAGCTGTTCCAGAGACCCTAGGG - Exonic
1183593452 22:38795321-38795343 CAGCTGATCCATCGAGCGCAGGG - Intergenic
1184883718 22:47328989-47329011 GAGCTGTCCCTCCGGGCCCACGG - Intergenic
1185344033 22:50303721-50303743 CAGCTGTGCCAGAGGGGCCGGGG + Intronic
1185426176 22:50772522-50772544 CAGCTGTGCCAGCGGTTACAGGG - Intronic
1203283762 22_KI270734v1_random:144544-144566 CAGCTCACCCAGCGGGCCCCAGG - Intergenic
950573712 3:13817988-13818010 CAGCTGTGCAAGGGGCCCCATGG + Exonic
951562567 3:23982683-23982705 AAGCTGCTCCAGACGGCCCATGG - Intergenic
952901513 3:38114716-38114738 CAACTGTGCCAGGGGCCCCAGGG - Intronic
954755152 3:52835217-52835239 CAGCTGTCCCAGAGGGCAAAGGG - Exonic
961019913 3:123496846-123496868 CAGCTGGTTCAGAGGGCCCGGGG + Intronic
961517653 3:127448201-127448223 CAGCTGTGCCAGAAGTCCCAAGG - Intergenic
962845146 3:139267402-139267424 CAGCTGATCCAGCAGACACAGGG + Intronic
962990399 3:140572617-140572639 CAGGTGATGCAGCTGGCCCAGGG - Exonic
973230149 4:47831487-47831509 CAGCTGATTCAGCAGTCCCAAGG + Intronic
977213377 4:94247295-94247317 TATCTGTCTCAGCGGGCCCAAGG - Intronic
978249096 4:106609868-106609890 CAGCTGCACCAGATGGCCCATGG - Intergenic
979489736 4:121311635-121311657 CAGCTGTAGCAGAGGTCCCAGGG + Intergenic
979758796 4:124374290-124374312 CAGCAATTGCAGTGGGCCCATGG + Intergenic
980073809 4:128271754-128271776 CAGCTGTTCCAAGGGACCCAGGG + Intronic
984337728 4:178414977-178414999 CAGCTATTCCAGAGAGCGCAGGG - Intergenic
985636349 5:1037714-1037736 CAGCTCTTCCAGTGGGCCCTGGG + Intronic
991435742 5:66596187-66596209 CAGGCGCTCCAGCGGGACCACGG + Intergenic
991556684 5:67902610-67902632 CAGCTGTTACAGCAGCCTCATGG + Intergenic
991612826 5:68466432-68466454 CAGCTGTGGCAAAGGGCCCAAGG - Intergenic
991649673 5:68838930-68838952 CAGCTGTCCCAGCCTCCCCAAGG - Intergenic
994368632 5:98945050-98945072 CAGCTGTTCCCATGGACCCAGGG + Intergenic
995353133 5:111205350-111205372 CAGCTCCTCCAGAGGGACCAAGG + Intergenic
999641439 5:153677112-153677134 CAGCTGTTCCCTGGGGCCAAGGG + Exonic
1001820610 5:174707278-174707300 CGTCTGTTCCAGCAGGGCCACGG + Intergenic
1002092331 5:176812767-176812789 CAGCTCCTCCCGCAGGCCCAGGG - Intronic
1002535744 5:179874461-179874483 CAGCTGTTCCAGCGGGCCCAGGG + Intronic
1002800112 6:514646-514668 CAGCTGCTCCAGGGGCTCCAGGG + Intronic
1005569811 6:27133841-27133863 CAGCTGTTCCACGCGGGCCAGGG + Exonic
1005913240 6:30328703-30328725 CACTTCTTCCAGTGGGCCCAGGG + Intronic
1011073362 6:83410012-83410034 CAGCAGTTCCAGCTGGCACCAGG + Intronic
1015843897 6:137498006-137498028 CTGCTGTACCCGCGCGCCCAGGG + Intergenic
1016866306 6:148770795-148770817 CAGCTGGTGCAGCGGGCAGAGGG + Intronic
1020881828 7:13771300-13771322 GAGATGTTCCAGAGGGCCCCGGG - Intergenic
1021983679 7:26079144-26079166 CACCTGATCCCGCGGGCACAGGG - Intergenic
1022503882 7:30898694-30898716 CAGCCAGTCCAGCTGGCCCAAGG - Intergenic
1022898240 7:34774529-34774551 CAGCTGTTCCATCTTGACCAAGG + Intronic
1023829484 7:44030535-44030557 CAGCTGTTCCCCTGGGCCCTTGG - Intergenic
1026327998 7:69327589-69327611 CAGCTGTTCCAGCTGGAGGATGG + Intergenic
1028322428 7:89476870-89476892 CAGTTGGTCCAGCAGGTCCATGG + Intergenic
1028508794 7:91598995-91599017 CAGCTGGTGCAGAGGCCCCAAGG + Intergenic
1028743874 7:94306274-94306296 AAGCTATTCCAGAGGGCACAGGG - Intergenic
1029112156 7:98217933-98217955 CACCTGGTCCAGGGGCCCCACGG + Exonic
1029739793 7:102484793-102484815 CAGCTGTTCCCCTGGGCCCTTGG - Intronic
1029757792 7:102583972-102583994 CAGCTGTTCCCCTGGGCCCTTGG - Intronic
1029775728 7:102683033-102683055 CAGCTGTTCCCCTGGGCCCTTGG - Intergenic
1030964155 7:115968738-115968760 CTGCTGTGCCAGCGGTCTCAGGG - Intronic
1035166426 7:156993128-156993150 CAGCTGCTCCAGCTGCCCCTAGG - Intergenic
1035345281 7:158193248-158193270 CAGCTGTCCCATGGGGCCCCTGG - Intronic
1037973465 8:23191886-23191908 GAGCTGGTACAGCAGGCCCAGGG - Exonic
1041409320 8:57536034-57536056 CAGCTATCCCAGCAGGGCCAGGG - Intergenic
1048844511 8:138594107-138594129 CATCTTTTCCAGGGGGCCCTGGG + Exonic
1049496184 8:142934786-142934808 CAGCTGTACCAGCTGGCCCCCGG + Intergenic
1049496685 8:142938946-142938968 CAGCTGTTCCTGGGGGCCTGTGG + Intergenic
1049769202 8:144372067-144372089 CAGCTGAGCCACAGGGCCCAGGG - Intergenic
1049853778 8:144849115-144849137 CTGCTGTTCCTGCAGGGCCAGGG + Intronic
1053139883 9:35675854-35675876 CAGGAGTTCCAGGGGGCGCAGGG - Exonic
1059388478 9:113983894-113983916 CTGCTGTTCCAGTGGGCCCCGGG + Intronic
1059799670 9:117737581-117737603 CTGCTGTTCCAGGCAGCCCAGGG - Intergenic
1060727573 9:126016469-126016491 CAGCTGGGCCAGGGGGCCAAGGG + Intergenic
1061089031 9:128416273-128416295 CAGCTGATCCATCGGGTGCAGGG + Intronic
1061919746 9:133776282-133776304 CATCTGTTCCATCAGACCCACGG - Intronic
1062023536 9:134330154-134330176 CAGCTGTCCCAGCAGACACAGGG + Intronic
1062032289 9:134367171-134367193 CAGCAGCTCCAGCGGGCACGGGG - Intronic
1062156715 9:135053211-135053233 CAGCTTGTCCAGAGGGCTCATGG + Intergenic
1189010717 X:37043548-37043570 CACCTGCGACAGCGGGCCCAGGG + Intergenic
1189037176 X:37505320-37505342 CACCTGCGACAGCGGGCCCAGGG - Intronic
1201942551 Y:19475482-19475504 CATCTCTTCCATAGGGCCCATGG + Intergenic