ID: 1002536666

View in Genome Browser
Species Human (GRCh38)
Location 5:179879684-179879706
Sequence GGAGGCGCCAACCGCATCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 87}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002536666_1002536670 -2 Left 1002536666 5:179879684-179879706 CCTGGGATGCGGTTGGCGCCTCC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1002536670 5:179879705-179879727 CCTGCGCACAGAAGCTCTGGCGG 0: 1
1: 0
2: 1
3: 14
4: 175
1002536666_1002536673 9 Left 1002536666 5:179879684-179879706 CCTGGGATGCGGTTGGCGCCTCC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1002536673 5:179879716-179879738 AAGCTCTGGCGGCTGCTGAGGGG 0: 1
1: 0
2: 1
3: 16
4: 183
1002536666_1002536671 7 Left 1002536666 5:179879684-179879706 CCTGGGATGCGGTTGGCGCCTCC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1002536671 5:179879714-179879736 AGAAGCTCTGGCGGCTGCTGAGG 0: 1
1: 0
2: 0
3: 24
4: 295
1002536666_1002536676 19 Left 1002536666 5:179879684-179879706 CCTGGGATGCGGTTGGCGCCTCC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1002536676 5:179879726-179879748 GGCTGCTGAGGGGAGAGGCTGGG 0: 1
1: 0
2: 5
3: 98
4: 789
1002536666_1002536668 -5 Left 1002536666 5:179879684-179879706 CCTGGGATGCGGTTGGCGCCTCC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1002536668 5:179879702-179879724 CCTCCTGCGCACAGAAGCTCTGG 0: 1
1: 0
2: 4
3: 14
4: 198
1002536666_1002536675 18 Left 1002536666 5:179879684-179879706 CCTGGGATGCGGTTGGCGCCTCC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1002536675 5:179879725-179879747 CGGCTGCTGAGGGGAGAGGCTGG 0: 1
1: 0
2: 4
3: 63
4: 571
1002536666_1002536679 27 Left 1002536666 5:179879684-179879706 CCTGGGATGCGGTTGGCGCCTCC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1002536679 5:179879734-179879756 AGGGGAGAGGCTGGGCTGGCGGG 0: 1
1: 0
2: 22
3: 119
4: 1146
1002536666_1002536678 26 Left 1002536666 5:179879684-179879706 CCTGGGATGCGGTTGGCGCCTCC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1002536678 5:179879733-179879755 GAGGGGAGAGGCTGGGCTGGCGG 0: 1
1: 3
2: 21
3: 210
4: 1708
1002536666_1002536672 8 Left 1002536666 5:179879684-179879706 CCTGGGATGCGGTTGGCGCCTCC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1002536672 5:179879715-179879737 GAAGCTCTGGCGGCTGCTGAGGG 0: 1
1: 0
2: 0
3: 17
4: 246
1002536666_1002536674 14 Left 1002536666 5:179879684-179879706 CCTGGGATGCGGTTGGCGCCTCC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1002536674 5:179879721-179879743 CTGGCGGCTGCTGAGGGGAGAGG 0: 1
1: 0
2: 6
3: 85
4: 999
1002536666_1002536677 23 Left 1002536666 5:179879684-179879706 CCTGGGATGCGGTTGGCGCCTCC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1002536677 5:179879730-179879752 GCTGAGGGGAGAGGCTGGGCTGG 0: 1
1: 1
2: 17
3: 169
4: 1226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002536666 Original CRISPR GGAGGCGCCAACCGCATCCC AGG (reversed) Exonic
900001226 1:15913-15935 GGAGGGGTCAACCACTTCCCTGG + Intergenic
900585617 1:3431061-3431083 TGAGGAGCCAGCCGCCTCCCTGG + Exonic
900780143 1:4612575-4612597 AGAGACCCCAACCCCATCCCTGG - Intergenic
902220009 1:14958769-14958791 GGAGGGGCCAAGGGCAGCCCTGG - Intronic
902520170 1:17011510-17011532 GGCGGCGCCATCCCCAGCCCCGG + Intronic
912432563 1:109636764-109636786 GGAGGCTCCTGCCACATCCCGGG + Intergenic
1062825837 10:567955-567977 GGAGGCTCCCATCCCATCCCAGG + Intronic
1067211754 10:44265398-44265420 GGAGGTGCCCACTGAATCCCTGG + Intergenic
1067528302 10:47051657-47051679 GGTGGAGCCAACCCCATCCAGGG - Intergenic
1075106495 10:119543004-119543026 GGACGCGCTAACCGCCTCCGCGG - Intergenic
1076114980 10:127888977-127888999 GGATGCCTCACCCGCATCCCAGG + Intronic
1080503842 11:32893377-32893399 GAAGGCCCCAAACGCATCCCCGG - Intronic
1084020326 11:66413457-66413479 GGAGGAGCCAACTGCACCCAGGG - Intergenic
1085512170 11:77093928-77093950 GGGGGCCCCCACCCCATCCCTGG - Intronic
1088738873 11:112750752-112750774 GGAGGCGTCAATCTCATCTCTGG - Intergenic
1089500014 11:118926158-118926180 AGACGCGCCAACAACATCCCAGG + Intronic
1094405387 12:30110790-30110812 GCAAGCGCCACCCGCAGCCCCGG + Intergenic
1098236504 12:68423201-68423223 GGAGGCGTCAACAGGATGCCGGG - Intergenic
1102492581 12:113297969-113297991 GGAGGGGCCAGCAGCACCCCGGG + Exonic
1106547387 13:30742565-30742587 GGAAGGGCCCACCTCATCCCAGG - Intronic
1113800463 13:113083657-113083679 GGAGGCGCCACCCCCATAACTGG - Intronic
1119779922 14:77270807-77270829 GCAGCCTCCACCCGCATCCCCGG + Intronic
1121271138 14:92639007-92639029 GCAGGGGCCAGCCCCATCCCAGG + Intronic
1123130475 14:105981678-105981700 GAAGGCGCCATCTGCATGCCAGG - Intergenic
1202849765 14_GL000225v1_random:9278-9300 GCTTGCGCCACCCGCATCCCAGG + Intergenic
1202864192 14_GL000225v1_random:104660-104682 GCTTGCGCCAACCGCATCCCAGG - Intergenic
1124707525 15:31977945-31977967 GGAGGCGCCAGCCCCAGCCCTGG - Intergenic
1125429683 15:39581903-39581925 TGTGGCACCAACCGCATTCCAGG + Exonic
1127414932 15:58749208-58749230 GGAGGCGACCCCCGCCTCCCGGG + Intronic
1128089866 15:64912035-64912057 GAGGGCGCCAACCTCACCCCTGG - Intronic
1132452281 15:101975025-101975047 GGAGGGGTCAACCACTTCCCTGG - Intergenic
1133049001 16:3106281-3106303 TGAGGCGCCAACCCCCGCCCGGG - Intergenic
1133768614 16:8854867-8854889 GGAGGTTCCAACCCCATCCCAGG - Exonic
1136419458 16:30122955-30122977 GGAGGCGCCGAGCGCTTTCCGGG - Intronic
1136514899 16:30762240-30762262 GCAGGCGCCAAAGGCAGCCCCGG - Exonic
1150641722 17:66953911-66953933 GGATGCTCCAGCCCCATCCCTGG - Intergenic
1151553944 17:74837218-74837240 GGTGGCACCTACCGCCTCCCAGG - Exonic
1152538242 17:80962578-80962600 GTAGGCGCCACCCACCTCCCTGG + Intronic
1160063424 18:75552088-75552110 GGAGGTGCCAGCTGCATCACTGG + Intergenic
1163819724 19:19489274-19489296 GGAGGCGCCAGGCTCACCCCAGG - Intronic
1164722615 19:30443733-30443755 GGAGAAGCCCCCCGCATCCCTGG + Exonic
1166884696 19:45953171-45953193 GGAGTGGCCAATCGCTTCCCGGG - Intronic
1167250582 19:48396658-48396680 GGAGCCCCCAACCCCTTCCCTGG + Intronic
1167504414 19:49863602-49863624 GGAGGCCCCAACCGGAGGCCGGG + Intronic
1168335038 19:55592758-55592780 GGAGGCGGCGACCGCCGCCCGGG - Exonic
926873121 2:17445669-17445691 GGAGCCTCCACCCTCATCCCAGG + Intergenic
927809960 2:26175310-26175332 GGAGGCGCCAACCCCAGCAACGG - Intronic
938500692 2:131830217-131830239 GGCGGCCCCATCCGCAGCCCAGG + Intergenic
1176167224 20:63680600-63680622 GGAGGCCCCGACCCCAGCCCCGG - Intronic
1176655779 21:9588106-9588128 TGAGGCGCCTACTGCATGCCAGG + Intergenic
1178992541 21:37367408-37367430 GGAGGCGACAGCCCCCTCCCCGG - Intronic
1179582270 21:42351453-42351475 GGAGGCTCTAACCACAGCCCTGG - Intergenic
1180248323 21:46563117-46563139 GGAGGCTCCAACAGCATCTGGGG + Intronic
1180831597 22:18909722-18909744 GGAGGGGCCAACCACACACCTGG + Intronic
1181775731 22:25158958-25158980 AGAAGCGCCAACTGCATGCCTGG - Intronic
1182426818 22:30278032-30278054 GGAGGCGCCAACCGGAAAGCTGG + Intergenic
1183702358 22:39457620-39457642 GGGGGCGCCAAGCGCAGCGCGGG - Intronic
1203281680 22_KI270734v1_random:134993-135015 GGAGGGGCCAACCACACACCTGG + Intergenic
950262947 3:11555227-11555249 GGAGGTGGCACCCTCATCCCCGG + Exonic
955840842 3:63111078-63111100 GTAGGCTTCAACCGCATCCTGGG + Intergenic
985212855 4:187613585-187613607 GCAGGCGGCAACCGCTTACCAGG - Intergenic
990437587 5:55808942-55808964 GGTGGAGCCCACCGCATCTCAGG - Intronic
994712926 5:103287378-103287400 GGAGCCACCAACTGCATCCAAGG - Intergenic
1002536666 5:179879684-179879706 GGAGGCGCCAACCGCATCCCAGG - Exonic
1005529621 6:26689776-26689798 GGACTCGCCACCCGCAGCCCTGG - Intergenic
1005541175 6:26811871-26811893 GGACTCGCCACCCGCAGCCCTGG + Intergenic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1009011984 6:57853943-57853965 GGACTCGCCACCCGCAGCCCTGG + Intergenic
1015390525 6:132676704-132676726 GGAGGCTCCCTCCGCCTCCCGGG + Intergenic
1017540277 6:155394778-155394800 GGGGGTGCAAACAGCATCCCCGG + Intergenic
1018370449 6:163163159-163163181 GGAGCTGCCAGCCACATCCCCGG - Intronic
1018723832 6:166595448-166595470 GGAGGATACAACCGCTTCCCTGG - Intronic
1018795114 6:167179588-167179610 GGAGGAGCCAACAGTACCCCTGG + Intronic
1018821204 6:167375474-167375496 GGAGGAGCCAACAGTACCCCTGG - Intronic
1019535756 7:1529314-1529336 GGAGGCTCCCAGCGCATCCCAGG + Intergenic
1019578127 7:1747267-1747289 CGGGGCGACAAGCGCATCCCAGG - Exonic
1019909742 7:4092586-4092608 GGAGTCAACAACCGCTTCCCGGG - Intronic
1020106764 7:5425829-5425851 GGAGGCGCCCGGTGCATCCCCGG + Intergenic
1023874092 7:44277653-44277675 GGAGGCTCCAGCAGCCTCCCCGG - Intronic
1030262581 7:107580577-107580599 GGTGGCGACACCCGCTTCCCGGG + Intronic
1032262258 7:130347167-130347189 GAGGGCACCAACCCCATCCCAGG + Intronic
1035757194 8:2043262-2043284 GGAGGGGACAATCTCATCCCGGG - Intergenic
1042117732 8:65450491-65450513 GGGGGCGCCACCCGCAGCACTGG - Intergenic
1046091960 8:109513660-109513682 GGAGGCACCAGCCCCTTCCCAGG + Intronic
1049687337 8:143944218-143944240 GGAGGGGCCAGCCGCACGCCTGG + Intronic
1049773884 8:144395919-144395941 GGAAGCACTCACCGCATCCCAGG + Intronic
1049801121 8:144517945-144517967 GGAGGCGTCAACGTCATCGCGGG + Intergenic
1059440311 9:114302893-114302915 TCAGGCCCCAACAGCATCCCAGG + Intronic
1062468545 9:136692094-136692116 GGAGGAGCCGACTGCAGCCCAGG - Intergenic
1203740130 Un_GL000216v2:171356-171378 GCTTGCGCCAACCGCATCCCAGG + Intergenic
1189002154 X:36958282-36958304 TGAGGCTCCAACCACCTCCCTGG + Intergenic
1195379018 X:104254115-104254137 GGAGGCGCCCAGTTCATCCCGGG - Intronic
1199643591 X:149884548-149884570 GGAGGGGCCAAGCACCTCCCCGG + Exonic
1200217625 X:154374964-154374986 GGGGGAGCCAAGCGCACCCCAGG + Intergenic