ID: 1002536864

View in Genome Browser
Species Human (GRCh38)
Location 5:179880518-179880540
Sequence GTCCCACTCCACCCAGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 6, 3: 32, 4: 360}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002536849_1002536864 16 Left 1002536849 5:179880479-179880501 CCCTCACACCCTCCCACTGGCTC 0: 2
1: 0
2: 2
3: 57
4: 594
Right 1002536864 5:179880518-179880540 GTCCCACTCCACCCAGGGCTGGG 0: 1
1: 0
2: 6
3: 32
4: 360
1002536852_1002536864 8 Left 1002536852 5:179880487-179880509 CCCTCCCACTGGCTCTGGTCCCG 0: 1
1: 0
2: 2
3: 39
4: 249
Right 1002536864 5:179880518-179880540 GTCCCACTCCACCCAGGGCTGGG 0: 1
1: 0
2: 6
3: 32
4: 360
1002536855_1002536864 4 Left 1002536855 5:179880491-179880513 CCCACTGGCTCTGGTCCCGTGGC 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1002536864 5:179880518-179880540 GTCCCACTCCACCCAGGGCTGGG 0: 1
1: 0
2: 6
3: 32
4: 360
1002536848_1002536864 17 Left 1002536848 5:179880478-179880500 CCCCTCACACCCTCCCACTGGCT 0: 1
1: 0
2: 5
3: 84
4: 695
Right 1002536864 5:179880518-179880540 GTCCCACTCCACCCAGGGCTGGG 0: 1
1: 0
2: 6
3: 32
4: 360
1002536856_1002536864 3 Left 1002536856 5:179880492-179880514 CCACTGGCTCTGGTCCCGTGGCC 0: 1
1: 0
2: 2
3: 27
4: 207
Right 1002536864 5:179880518-179880540 GTCCCACTCCACCCAGGGCTGGG 0: 1
1: 0
2: 6
3: 32
4: 360
1002536850_1002536864 15 Left 1002536850 5:179880480-179880502 CCTCACACCCTCCCACTGGCTCT 0: 1
1: 0
2: 7
3: 67
4: 724
Right 1002536864 5:179880518-179880540 GTCCCACTCCACCCAGGGCTGGG 0: 1
1: 0
2: 6
3: 32
4: 360
1002536853_1002536864 7 Left 1002536853 5:179880488-179880510 CCTCCCACTGGCTCTGGTCCCGT 0: 1
1: 0
2: 0
3: 6
4: 161
Right 1002536864 5:179880518-179880540 GTCCCACTCCACCCAGGGCTGGG 0: 1
1: 0
2: 6
3: 32
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002536864 Original CRISPR GTCCCACTCCACCCAGGGCT GGG Intronic
901538908 1:9901972-9901994 CTCTCCCTCCAGCCAGGGCTGGG - Intronic
901658718 1:10785613-10785635 GTGGCCCTCCACCCAGGCCTGGG + Intronic
901794674 1:11673439-11673461 TACCCACTCCTCCCAGGGCCAGG + Intronic
902181375 1:14691527-14691549 GTGCCACTGCACTCCGGGCTGGG - Intronic
902466063 1:16619556-16619578 GTCCCACCCCACGCTGGGCATGG - Intergenic
902508628 1:16953748-16953770 GTCCCACCCCACGCTGGGCATGG + Intronic
902533990 1:17108432-17108454 CTCTCACTCCCCCTAGGGCTGGG + Intronic
903491487 1:23732092-23732114 GTCCCACTGCACTCTGGCCTGGG + Intergenic
903666903 1:25013600-25013622 ATCACAGTCCACCCAGGGCTTGG + Intergenic
903741920 1:25563217-25563239 GTCCCACTCCTGCCTGGGCTGGG + Intronic
903904697 1:26676395-26676417 GTGCCACTCCACTCAAGCCTGGG - Intergenic
904413092 1:30336797-30336819 GTCCCACTCCATCCAGGACGAGG - Intergenic
905687195 1:39916970-39916992 GTGCCACTGCACCCCAGGCTGGG - Intergenic
906001298 1:42428005-42428027 GTGCCACTCCACTCTAGGCTGGG + Intergenic
906211497 1:44014714-44014736 CTCCCACTCAGCCCTGGGCTTGG + Intronic
908535267 1:65071047-65071069 TTAGCACCCCACCCAGGGCTGGG - Intergenic
909072722 1:71015973-71015995 GTGCCACTGCACCCAAGCCTTGG - Intronic
910686467 1:89922104-89922126 GCCCCACTGCACCCTGGCCTGGG - Intronic
912319080 1:108693114-108693136 GCCCAACTCCCCCCAGGGGTGGG - Intronic
912429275 1:109620593-109620615 TTCCCCCTCCTCCCAGAGCTGGG + Intronic
912859795 1:113203613-113203635 GTGCCACTGCACCCCAGGCTGGG - Intergenic
912912375 1:113775065-113775087 GTGCCACTCCACTCAAGCCTGGG - Intronic
914883382 1:151565154-151565176 CTCCCATTCCCCCCAGGTCTGGG + Intronic
915132036 1:153702070-153702092 GTGCCACTGCACTCTGGGCTGGG + Intergenic
916535541 1:165699565-165699587 GTGCCACTGCACTCAGGCCTGGG + Intergenic
918216344 1:182394645-182394667 CTCCCACTCCACCCACCCCTTGG - Intergenic
919159228 1:193806920-193806942 CCCCCAATCCACCCAGGGTTGGG + Intergenic
919784262 1:201249182-201249204 GTGCCAAACCACCCACGGCTGGG + Intergenic
920341754 1:205279557-205279579 TTCCCACAGCCCCCAGGGCTTGG - Intergenic
920415273 1:205795300-205795322 GGCCCACTCCCCCCAGGGCTGGG + Intronic
920744235 1:208610970-208610992 GTGCCACTGCACCCAAGCCTGGG - Intergenic
924279581 1:242422889-242422911 GTGCCACTGCACCCAAGCCTGGG - Intronic
1063030905 10:2232907-2232929 GTCCCACTGCACTCCAGGCTGGG - Intergenic
1063387038 10:5622327-5622349 GCCTCATTCCACCCAGGGTTGGG + Intergenic
1063409441 10:5825720-5825742 GTGCCACTGCACCCCAGGCTGGG + Intronic
1063851308 10:10194897-10194919 GTCCCAGCACACCCAGTGCTTGG + Intergenic
1065352710 10:24809910-24809932 GTGCCACTGCACCCAAGCCTGGG - Intergenic
1067846381 10:49725101-49725123 GTCCAACTGCACTCCGGGCTGGG + Intergenic
1068468314 10:57425450-57425472 GTGCCACTGCACTCAGGCCTGGG + Intergenic
1069717133 10:70528506-70528528 GCCCAACTCCACCCACCGCTTGG - Intronic
1069753455 10:70759765-70759787 GCCCCACTCCAGCCAGGGTCAGG - Intronic
1069893141 10:71664411-71664433 ATCAGCCTCCACCCAGGGCTGGG + Intronic
1070172128 10:73940825-73940847 CTCCTACTCCAGCCAGAGCTCGG - Intergenic
1070753667 10:78978291-78978313 CTCTCCCTCCACCCTGGGCTGGG + Intergenic
1070791506 10:79192222-79192244 GACCCAACCCACACAGGGCTGGG - Intronic
1074148860 10:110740593-110740615 CTCCCTCTCCCACCAGGGCTTGG + Intronic
1074520293 10:114214778-114214800 GTGCCACTGCACTCAGGCCTGGG - Intronic
1075944877 10:126424163-126424185 TTCCCTCTCAGCCCAGGGCTAGG + Intergenic
1076335789 10:129705783-129705805 GGCCCCATCCACACAGGGCTGGG + Intronic
1076455183 10:130587804-130587826 GTCCCATTGCACCCAGAGCCAGG + Intergenic
1076556239 10:131323038-131323060 TTCTCCCTCCACCCAGTGCTGGG - Intergenic
1078509600 11:11975661-11975683 GTCCTGGTTCACCCAGGGCTAGG + Intronic
1078769056 11:14330030-14330052 GTGCCACTGCACCCCAGGCTGGG + Intronic
1079450942 11:20599286-20599308 GTCCCACTGCACCCAAGGCAAGG - Intergenic
1080764975 11:35287653-35287675 CCCCCACTCCTCCCAGGCCTGGG + Intronic
1081485816 11:43527711-43527733 TTCCCACTCAACCCAAGGCCAGG - Intergenic
1081519050 11:43863641-43863663 GTGCCACTGCACTCAGGCCTGGG - Intergenic
1081659971 11:44882130-44882152 GTCACACAGCACCCAGGGATAGG + Intronic
1081937818 11:46917510-46917532 GTCCAGCTCCCCCGAGGGCTGGG + Intronic
1083718836 11:64593973-64593995 CACCCACTTCAACCAGGGCTTGG + Intronic
1084006726 11:66327015-66327037 CACCCACCCCACCCAGGGCCAGG - Intergenic
1084251664 11:67904033-67904055 GCACCACTCCACCCAAGCCTGGG + Intergenic
1084621770 11:70276147-70276169 GTGCCACTGCACTCCGGGCTGGG - Intronic
1084821175 11:71691997-71692019 GCACCACTCCACCCAAGCCTGGG - Intergenic
1085539484 11:77253676-77253698 GTGCCACTCTACTCAGGCCTTGG + Intronic
1085564682 11:77502727-77502749 GTCCCACTCCACCAAGCAGTGGG + Intergenic
1087080210 11:94162912-94162934 GTGCCACTACACTCAGGCCTGGG - Intronic
1087286407 11:96269552-96269574 GTGCCACTGCACTCTGGGCTGGG - Intronic
1087781751 11:102308919-102308941 GTCCCACTGCACTCAAGCCTGGG - Intergenic
1089065324 11:115658379-115658401 GTGCCACTGCACCCAAGCCTGGG - Intergenic
1089532634 11:119140907-119140929 GTGCCACTGCACCCCGGCCTGGG - Intergenic
1089535768 11:119160146-119160168 CCTCCACTCCACCCAAGGCTGGG - Intronic
1089595301 11:119575013-119575035 GTGCCACTGCACCCCAGGCTGGG + Intergenic
1089775485 11:120832608-120832630 GCCCTGCTCCACTCAGGGCTGGG - Intronic
1090574540 11:128086605-128086627 GTCCCACTTCTCCCGGGACTCGG - Intergenic
1091197508 11:133744591-133744613 GGCCCACTCAAGCCATGGCTGGG - Intergenic
1091715361 12:2772778-2772800 GTCCTACACCATCCAGAGCTGGG + Intergenic
1091761024 12:3087469-3087491 GTACCACTGCACTCCGGGCTGGG + Intronic
1092421934 12:8338821-8338843 GCACCACTCCACCCAAGCCTGGG + Intergenic
1092522423 12:9288558-9288580 GTCCCACTGCACTCCGGCCTGGG - Intergenic
1092544861 12:9443343-9443365 GTCCCACTGCACTCCGGCCTGGG + Intergenic
1093090122 12:14911356-14911378 CAGCCACTCCACCCAGGGCCAGG + Intergenic
1093740471 12:22679741-22679763 GTGCCACTGCACTCAAGGCTGGG - Intronic
1094508088 12:31078728-31078750 GTCCCACTGCACTCTGGCCTGGG - Intronic
1095886268 12:47191592-47191614 GCCTCTCTCCACCCAGGACTTGG + Intronic
1097081894 12:56438082-56438104 GTGCCACTGCACCCCAGGCTGGG - Intronic
1100442079 12:94626639-94626661 GTCCCTCTCTACCCAGAGGTGGG - Intronic
1101248806 12:102911132-102911154 TTCCCTGTCCAGCCAGGGCTGGG - Intronic
1102205977 12:111091183-111091205 TTCCCACTCCAGCCAGGGCCAGG + Intronic
1102263727 12:111463335-111463357 GTACCACTGCACTCAGGCCTGGG - Intronic
1102447170 12:113012250-113012272 GTCCCCATCCTCACAGGGCTTGG + Intergenic
1104151477 12:126088066-126088088 ATACGACTCCACCCTGGGCTAGG + Intergenic
1105241752 13:18614849-18614871 ATCCCTCTCCATCCAGGACTTGG + Intergenic
1105276580 13:18934483-18934505 GTGCCACTCCACCCCAGCCTGGG - Intergenic
1105305085 13:19162707-19162729 GTGCCACTGCACCCTGGCCTGGG + Intergenic
1106233666 13:27843093-27843115 GTGCCACTGCACCCCAGGCTGGG - Intergenic
1106279318 13:28250235-28250257 GTGCCACTGCACTCAGGCCTGGG - Intronic
1106615903 13:31327406-31327428 GTCCCACTCCATCCCGCACTGGG - Intronic
1107646902 13:42503667-42503689 GTGCCACTGCACCCAAGCCTGGG + Intergenic
1108377359 13:49825865-49825887 GTACCACTCCACCCCAGCCTGGG + Intergenic
1110382954 13:74875645-74875667 GCCCCTCTCTACCCTGGGCTGGG + Intergenic
1113807834 13:113120309-113120331 CTCCCACTGCAGCCAGGGCCTGG - Exonic
1115214018 14:30996821-30996843 GTGCCACTGCACTCAGGGCTGGG + Intronic
1115535721 14:34371390-34371412 GTGCCACTGCACTCAGGCCTGGG + Intronic
1116115727 14:40647795-40647817 GTGCCACTCCACTCCGGCCTGGG - Intergenic
1116617056 14:47153449-47153471 ATCCCACTCCACCCACAGCCAGG - Intronic
1117678842 14:58182354-58182376 GTCCCACTGCACCCCAGCCTGGG + Intronic
1118416142 14:65538556-65538578 GTCTCACTCCAGCCAGAGCTTGG - Intronic
1119861165 14:77937122-77937144 GTGCCACTGCACCCAAGCCTGGG + Intergenic
1120485602 14:85109812-85109834 GTGCCACTACACTCAGGCCTGGG + Intergenic
1122092002 14:99347117-99347139 GTCCCACCCCTGCCAGGGCCAGG + Intergenic
1122270189 14:100565522-100565544 CTCCCACACCCCCCAGGGCCTGG - Intronic
1122722933 14:103732222-103732244 GCCCACCTGCACCCAGGGCTGGG - Intronic
1122930368 14:104930665-104930687 ACCCCACTCCACCCAGGCCAGGG - Intronic
1123489666 15:20770571-20770593 GTCCTTCTCCACCCAGGACTTGG - Intergenic
1123546165 15:21339658-21339680 GTCCTTCTCCACCCAGGACTTGG - Intergenic
1124225846 15:27894227-27894249 CTCCCACTCCCACCAGAGCTTGG + Intronic
1124248877 15:28094852-28094874 GCCCCACTCCGCCCTGGGCACGG - Intronic
1124569223 15:30845421-30845443 GTCCCACTGCACTCCAGGCTGGG + Intergenic
1124569288 15:30846655-30846677 GTCCCACTGCACTCCAGGCTGGG + Intergenic
1124569300 15:30846902-30846924 GTCCCACTGCACTCCAGGCTGGG + Intergenic
1125751739 15:42033791-42033813 GGCCCACTCCACCCAGGGCCAGG - Intronic
1127445676 15:59060842-59060864 GTGCCACTGCACACAGGCCTGGG - Intronic
1127560823 15:60134330-60134352 GTGCCATTCCACTCTGGGCTGGG + Intergenic
1128264779 15:66256160-66256182 GGCCCCCTCCACGCTGGGCTGGG + Intergenic
1128780821 15:70357560-70357582 GGCCCACTCAGCCCAGGGTTGGG - Intergenic
1129376217 15:75133923-75133945 GTGCCACTGCACCCCGGCCTGGG + Intergenic
1129388740 15:75209980-75210002 GTCCCACATCACTCAGGGCTGGG + Intronic
1129656031 15:77526404-77526426 GTCCCTCTCCTCACAGGGCCTGG - Intergenic
1130241843 15:82200923-82200945 GTGCCACTGCACCCTGGCCTGGG - Intronic
1130397291 15:83513708-83513730 TTCCCACTCTACCCAGGGCATGG + Intronic
1131801367 15:96072973-96072995 TTTCCATTCCACCCAGGCCTGGG - Intergenic
1202954492 15_KI270727v1_random:66874-66896 GTCCTTCTCCACCCAGGACTTGG - Intergenic
1132584200 16:699243-699265 CTCCCACTCCACCCTGTGCGTGG - Intronic
1134060567 16:11197302-11197324 GTCCCCCTGCACCCAGGTCCTGG + Intergenic
1135333382 16:21580475-21580497 ATCCCACTGCACCCCGGCCTGGG + Intergenic
1136180526 16:28548763-28548785 GTCCCACCCCACCCACCCCTGGG + Intergenic
1136191924 16:28621938-28621960 ACCTCATTCCACCCAGGGCTGGG - Intronic
1138163523 16:54778238-54778260 TTCTGACTCCAGCCAGGGCTGGG + Intergenic
1138469814 16:57225099-57225121 GTGCCACTGCACCCTGGCCTGGG - Intronic
1139274401 16:65714177-65714199 TTCCCACCCCACCCAGCCCTAGG + Intergenic
1139388907 16:66592839-66592861 GTGCCACTGCACTCAGGCCTGGG + Intergenic
1140115313 16:72036640-72036662 GGCCCATTCCATCCAGGGGTGGG + Intergenic
1141523446 16:84596625-84596647 TTCCCACGGCACCCAGGGCATGG + Intronic
1141558437 16:84851435-84851457 GGCCCACTCTACACAGGGCACGG - Intronic
1141655998 16:85416896-85416918 GTGCCACTGCACCCCGGCCTGGG - Intergenic
1141667911 16:85475335-85475357 GTCCCACCCCACCCAGGTACAGG - Intergenic
1141982974 16:87561201-87561223 TTCCTTCTCCAACCAGGGCTGGG - Intergenic
1142602208 17:1059179-1059201 GCCCCACGTCACCCAGGGCCAGG + Intronic
1143090745 17:4448026-4448048 CCCCCACTACCCCCAGGGCTTGG + Intronic
1144037381 17:11379726-11379748 ATCCCACTCCACCCATGGCGGGG + Intronic
1144626692 17:16847497-16847519 TGCCCACTCCATCCAGGCCTGGG - Intergenic
1144682436 17:17204842-17204864 GCCCCACACCACCCAGAGCAGGG + Intronic
1144830170 17:18126728-18126750 CTCCCACACCTCCCAGGGATTGG - Intronic
1144879740 17:18425213-18425235 TGCCCACTCCATCCAGGCCTGGG + Intergenic
1145094145 17:20009786-20009808 GTCCCACTGCGGCGAGGGCTGGG - Intronic
1145152495 17:20519172-20519194 TGCCCACTCCATCCAGGCCTGGG - Intergenic
1145762033 17:27430521-27430543 GCCCCTCTCTTCCCAGGGCTGGG - Intergenic
1146273588 17:31500141-31500163 GTCACACCCCATCCAGGACTTGG + Intronic
1147580832 17:41626189-41626211 TGCCCACTCCATCCAGGCCTGGG - Intergenic
1147606266 17:41775508-41775530 GTCCCTCTCCACCCTGGACCTGG + Intronic
1147790542 17:43012000-43012022 GGCCCCCTCCACCCAGGGCTTGG - Intronic
1147958712 17:44153007-44153029 ACCCCACCCCACCCAGGGCCTGG - Intronic
1147967073 17:44199393-44199415 GGCCCCCTCCCCCCAGGTCTGGG - Intronic
1147972960 17:44229624-44229646 GACCCACTCCACCCAGTGTCTGG - Intergenic
1148343727 17:46889641-46889663 GACCCCCTCCATCCAGGGTTGGG - Intergenic
1148384006 17:47221574-47221596 GTCTGACAGCACCCAGGGCTTGG - Intronic
1149218133 17:54383261-54383283 GTGCCACTGCACTCAAGGCTGGG - Intergenic
1149936264 17:60810309-60810331 GTCCCACTCCACCAACTTCTGGG + Intronic
1151378280 17:73706807-73706829 GCCCCTCTCCGGCCAGGGCTGGG + Intergenic
1152278756 17:79372989-79373011 GGCCCCATCCACCCTGGGCTGGG - Intronic
1152574495 17:81134105-81134127 CTCCCACTCCAGCCTGGGGTTGG - Intronic
1152703223 17:81829780-81829802 ACCCCACCCCACCCAGTGCTGGG + Intronic
1156298114 18:35810940-35810962 GTGTCACTGCTCCCAGGGCTGGG - Intergenic
1156474635 18:37397859-37397881 CGCCCACTCCACCCAGGGTCTGG - Intronic
1156501748 18:37564659-37564681 CCCCCACTCCACCCAGGGGATGG + Intronic
1158343270 18:56489087-56489109 TTCACAATCTACCCAGGGCTTGG - Intergenic
1158461836 18:57653325-57653347 GTGCCACTGCACTCCGGGCTGGG - Intronic
1159008688 18:63038254-63038276 GTCCCACTCCAGCCTGGGCTGGG + Intergenic
1159420644 18:68215351-68215373 GTACCACTGCACCCAAGCCTGGG - Intergenic
1160747129 19:717310-717332 GTCCCCCTCCCCCCAGCCCTCGG + Intronic
1160884528 19:1339436-1339458 GTACCACTGCACCCAAGTCTGGG - Intergenic
1160980591 19:1814965-1814987 GCCCAGCTCCACACAGGGCTGGG + Intergenic
1160990130 19:1857066-1857088 GTCCCACTCCCGCCGGGGCCAGG + Intronic
1161283702 19:3458493-3458515 GCCCCACCCCACCCAAGCCTGGG + Intronic
1161327475 19:3670663-3670685 GCCCCCTCCCACCCAGGGCTGGG - Intronic
1161565181 19:4997894-4997916 GTCCCTCTCCACCCAGGCCTTGG + Intronic
1161863179 19:6814015-6814037 GTGCCACTCCACTCCGGCCTGGG + Intronic
1161870434 19:6865502-6865524 GTCCCACTGCACCCCAGCCTGGG + Intergenic
1163399191 19:17081841-17081863 GACCCACTCCGCCCTGGGCTGGG - Intronic
1163580030 19:18133054-18133076 GTGCCACTGCACCCAAGCCTGGG + Intronic
1163748353 19:19061119-19061141 GTCTCCCTCCAGCCAGGGATGGG + Intergenic
1164686326 19:30168913-30168935 CTCCCACTCCACCCCTAGCTGGG + Intergenic
1166366660 19:42281426-42281448 GTGCCACCACACCCAGGCCTGGG - Intronic
1167464739 19:49644861-49644883 CTCCCACTCCACCCTGTGCTTGG - Intronic
1167615496 19:50530649-50530671 GACTCACTCCGCTCAGGGCTTGG + Intronic
1168236289 19:55065339-55065361 GTGCCACTGCACCCCAGGCTGGG + Intronic
1168432920 19:56295550-56295572 GTCCCACTGCACCCCAGTCTGGG + Intronic
925194212 2:1910253-1910275 GTCCAAGTCCAGCCAGGCCTCGG - Exonic
926702728 2:15814514-15814536 GTCCGACTATACCCAGGACTGGG - Intergenic
927894975 2:26775774-26775796 TACCCACCTCACCCAGGGCTTGG - Intronic
927937877 2:27085763-27085785 GTCCCGCTCCAACCAGGGCGTGG + Exonic
928743919 2:34389269-34389291 GTGCCACTCCACTCAAGCCTGGG + Intergenic
929494691 2:42430323-42430345 GTGCCACTGCACCCAGGCCTGGG + Intergenic
929904079 2:46030784-46030806 ATCCCACATCACACAGGGCTAGG - Intronic
930050563 2:47212562-47212584 GTCCCACTGCACTCCAGGCTAGG + Intergenic
931066753 2:58596363-58596385 TTCCCACTGCTCCTAGGGCTAGG - Intergenic
931273481 2:60723208-60723230 GTGCCACTGCACTCAGGCCTGGG - Intergenic
931769997 2:65489162-65489184 GTCCCACTGGACCCTGTGCTGGG + Intergenic
933637074 2:84720178-84720200 TTCCCACACCACCCATGGCCAGG - Intronic
934677689 2:96261190-96261212 GTCTATCTCCACCCAGGGCCAGG + Intronic
934710490 2:96511083-96511105 GCTCCACTCTACCCTGGGCTAGG - Intergenic
934756485 2:96828083-96828105 TTGCCACTCCTCCCAGGGCAGGG + Exonic
935011691 2:99141766-99141788 GTGCCACTTTTCCCAGGGCTTGG + Exonic
935570800 2:104658908-104658930 GAGCCACTGCACCCAGGCCTGGG - Intergenic
935965189 2:108465895-108465917 GTGCCACTGCACCCCGGCCTGGG - Intronic
936861923 2:117029411-117029433 GGCCCACTCCACGCTGGCCTTGG + Intergenic
937990267 2:127658340-127658362 GTGCCACTGCACTCAGGCCTGGG + Intronic
938001913 2:127748789-127748811 GCACCACTGCACCCAGGCCTGGG - Intronic
938397711 2:130963410-130963432 CTCCCACGCCATCCAGGGCGAGG - Intronic
938482795 2:131675503-131675525 GTCCTTCTCCACCCAGGACTTGG + Intergenic
940132393 2:150397018-150397040 GTGCCACTGCACTCAGGCCTGGG + Intergenic
940453693 2:153871740-153871762 CTCCCGCTCCTCCCCGGGCTGGG - Intergenic
942276934 2:174329813-174329835 TTCCTCCTCCATCCAGGGCTTGG - Intergenic
948247592 2:236499469-236499491 GTGCCACTGCACTCTGGGCTGGG - Intronic
948480266 2:238245346-238245368 CTCCCACTGCACCCTGGGTTGGG - Exonic
949041907 2:241853405-241853427 GCCACACTCCTCCCAGGGCTGGG - Intronic
1171869084 20:30511854-30511876 GGCACACCCCACCCAGGGCGAGG + Intergenic
1173710707 20:45153278-45153300 GGCCCAGTCCTCCCAGGGTTTGG + Intergenic
1173846954 20:46194230-46194252 CACCCACCCCAGCCAGGGCTGGG - Intronic
1174460235 20:50677412-50677434 GCGCCACTGCACCCAGGCCTGGG - Intronic
1174563367 20:51446888-51446910 GTCAGACTCCAGACAGGGCTGGG - Intronic
1174813323 20:53665873-53665895 GTACCACTCCACTCTGGCCTGGG - Intergenic
1176039140 20:63055208-63055230 GTCCCCCACAAACCAGGGCTGGG + Intergenic
1176285360 21:5016448-5016470 GCCCTCCTGCACCCAGGGCTGGG + Intergenic
1177834294 21:26171836-26171858 AGCCCACTCCACACAGGGCTTGG + Intergenic
1178344589 21:31814035-31814057 ATCCTTCTCCACCCAGGGATTGG + Intergenic
1179802030 21:43815541-43815563 GCCCCACTGCACCCTGGCCTCGG - Intergenic
1179871821 21:44247027-44247049 GCCCTCCTGCACCCAGGGCTGGG - Intronic
1179880508 21:44291553-44291575 GTCCCACTCCAGACAGGGCTGGG + Intronic
1181178429 22:21051107-21051129 GTCCCACTGCACTCCGGGTTGGG + Intronic
1182775756 22:32829853-32829875 GTCCCATTCTACCCAAGGGTGGG - Intronic
1183617728 22:38955402-38955424 GTCCCCCTGCAGCCAGGGCAAGG - Intronic
1183962202 22:41418232-41418254 GTCCCGCTCATACCAGGGCTGGG - Intergenic
1184246042 22:43236218-43236240 GTGCCTCTCCAGCCAGGGCTGGG + Intronic
1184643421 22:45883952-45883974 GGGCCACTCCACCCAGGGAGGGG - Intergenic
1185039365 22:48496616-48496638 CACCCACTCCACCCAGAGCTGGG + Intronic
1185066553 22:48635204-48635226 GTCCCAAGCCAGCCAGGGCTGGG + Intronic
949774233 3:7613498-7613520 GTACCACTTCTCCCAGGGCAGGG + Intronic
950529872 3:13547089-13547111 GTGCCTCTCCTCCCAGGCCTGGG + Intergenic
953127824 3:40108953-40108975 GCCCCAATCACCCCAGGGCTAGG + Intronic
953334322 3:42080915-42080937 GTGCCACTCCACCCCAGCCTGGG - Intronic
953417106 3:42728936-42728958 GGGCCTCTCCACACAGGGCTAGG - Intronic
953484550 3:43283013-43283035 GTCCCACTCCAGTCAGAGCCAGG - Intergenic
953679569 3:45029291-45029313 GACCCACTCTAGCCAGGGCAAGG + Intronic
954142832 3:48618790-48618812 GCCCCACGGCACCCAGTGCTGGG + Intergenic
954278981 3:49562316-49562338 CTCACACTTCACCCAGGGATAGG - Intronic
954373544 3:50182838-50182860 GCCCTGCTCCAGCCAGGGCTTGG + Intronic
954402322 3:50325473-50325495 TTCTCCCTCTACCCAGGGCTGGG - Exonic
954604295 3:51896802-51896824 CTCCCAAACCACACAGGGCTGGG - Intronic
954611401 3:51946362-51946384 GTGCCAACCCTCCCAGGGCTTGG - Intronic
956022711 3:64949399-64949421 GTGCCACTGCACCCAAGACTGGG + Intergenic
960876983 3:122306591-122306613 GTCCCACTCCACTCTAGCCTGGG + Intergenic
961356878 3:126344945-126344967 GGCCCTCTCCACCCCTGGCTTGG + Intronic
961792510 3:129386277-129386299 GTGCCACTGCACCCTGGCCTGGG - Intergenic
961899675 3:130198346-130198368 GCACCACTCCACCCAAGCCTGGG + Intergenic
963646256 3:147918445-147918467 GTGCCACTGCACCCTGGCCTGGG - Intergenic
964415704 3:156445251-156445273 GTGCCACTGCACTCAGGCCTGGG + Intronic
966714466 3:183001365-183001387 GTGCCACTGCACCCTGGCCTGGG - Intergenic
966912128 3:184565521-184565543 GTCCCCCTCCAGCCAAGCCTTGG + Intronic
966949654 3:184804628-184804650 GTGCCACTGCACCCCGGCCTGGG - Intergenic
968534936 4:1118887-1118909 GTGCCACTCTACCCAGGCCAAGG - Intergenic
968669319 4:1840332-1840354 GTGCCACTGCACTCAGGCCTGGG + Intronic
968888383 4:3350637-3350659 GTCCCACTGCACCCCAGCCTGGG + Intronic
969050403 4:4369002-4369024 GTCCCACTCCACCATGGGGCTGG - Intronic
969428805 4:7140988-7141010 GGCCCACCCCACCCAGGACGAGG - Intergenic
969516793 4:7652508-7652530 CGCCCACTCCTCCCAGGTCTAGG + Intronic
969521059 4:7677970-7677992 GTCCCACCCCACCCTGTTCTTGG - Intronic
969743713 4:9053392-9053414 GCACCACTCCACCCAAGCCTGGG - Intergenic
970425042 4:15938185-15938207 TTCTCACTCCACCAAGGGCCTGG - Intronic
970452984 4:16190379-16190401 GTCCCACTGCACCCCAGCCTGGG - Intronic
970544009 4:17108168-17108190 GAGCCACTCCACCCAGCCCTTGG - Intergenic
972487588 4:39557055-39557077 GTCCCACTGCACTCTGGCCTTGG - Intronic
972740434 4:41881984-41882006 GTCCCACTCCACCCGCGCCCAGG + Intergenic
975188289 4:71429236-71429258 TTCACACTCCACTCAGGTCTTGG - Intronic
976269504 4:83217105-83217127 CTCCCACTGCACCCAGGCCTTGG - Intergenic
976600700 4:86935250-86935272 GCCCTGCGCCACCCAGGGCTGGG + Intronic
978444745 4:108769776-108769798 GTCCCACTGCACTCCAGGCTGGG - Intergenic
979783332 4:124683712-124683734 GTGCCACTCCACTCCAGGCTGGG + Intronic
980081302 4:128347330-128347352 GTGCCACTGCACTCAGGCCTGGG - Intergenic
981063210 4:140449715-140449737 GTGCCACTGCACCCCAGGCTGGG + Intronic
981917816 4:150053842-150053864 GTGCCACTGCACTCAGGCCTGGG + Intergenic
982002196 4:151031295-151031317 GTGCCACTGCACTCAAGGCTGGG + Intergenic
983339675 4:166443463-166443485 GTGCCACTCCACTCTGGCCTGGG + Intergenic
985493893 5:193753-193775 GTCCCTCCCCACCCAGGACTGGG - Intronic
985930153 5:3050980-3051002 GTGCCAGTGCACCCAGGGCAGGG - Intergenic
987321168 5:16770809-16770831 GTGCCACTGCACCCCAGGCTGGG - Intronic
987625925 5:20400433-20400455 GTTCCACTGCACCCCAGGCTGGG + Intronic
987672752 5:21033797-21033819 GTACCACTGCACTCAGGCCTGGG + Intergenic
991733786 5:69613459-69613481 GCCTCACCCCACCCAGGTCTGGG + Intergenic
991810220 5:70468601-70468623 GCCTCACCCCACCCAGGTCTGGG + Intergenic
991860481 5:71008687-71008709 GCCTCACCCCACCCAGGTCTGGG - Intronic
992732211 5:79683358-79683380 ATACCACTACACCCAGGGGTGGG - Intronic
997568292 5:134905913-134905935 GCGCCACTCCACTCCGGGCTCGG - Intronic
998166501 5:139847389-139847411 GGCCCTCTCCTCCCAGGGGTCGG + Intronic
999004664 5:147962475-147962497 GCCCAGCTCCATCCAGGGCTAGG - Intergenic
999241724 5:150131878-150131900 CTCCCACTCCTCCCATGGGTGGG + Intronic
999691216 5:154147535-154147557 GTGCCACTGCACTCCGGGCTGGG - Intronic
1000263079 5:159608264-159608286 GTCCCACTGCACTCAAGTCTGGG + Intergenic
1001025732 5:168222960-168222982 GCCCCACTCCAGCCAAGGCTGGG + Intronic
1001415654 5:171543366-171543388 GTCAGACTCCAGCCAGGGATGGG + Intergenic
1002053908 5:176587571-176587593 TTCCCACACCACCGAGGGCTGGG + Intronic
1002093242 5:176816983-176817005 CTCCCACTTCAAACAGGGCTGGG - Intronic
1002327445 5:178419083-178419105 GTCCTCCTCCACCCAGGCGTTGG + Intronic
1002536864 5:179880518-179880540 GTCCCACTCCACCCAGGGCTGGG + Intronic
1003803984 6:9704359-9704381 TTCACACTGCACCCAGGACTGGG - Intronic
1003852904 6:10243033-10243055 GTGCCACTGCACCCTGGCCTGGG - Intergenic
1004198061 6:13523644-13523666 ATTTCACTCCAGCCAGGGCTGGG + Intergenic
1006101754 6:31689955-31689977 GTCCCACTCACCTGAGGGCTGGG - Intronic
1006881876 6:37347186-37347208 GTGCCACTACACTCAGGCCTGGG + Intergenic
1007966513 6:46008376-46008398 GTCCCACCCTACCCAAAGCTGGG + Intronic
1010063058 6:71646658-71646680 GTCCCACTTAAGCCATGGCTGGG + Intergenic
1010233732 6:73557841-73557863 GTCCCACTGCACTCAAGCCTGGG - Intergenic
1011211736 6:84963032-84963054 GTGCCACTCCCCCATGGGCTGGG + Intergenic
1013161918 6:107553369-107553391 GTGCCACTGCACTCAGGCCTGGG - Intronic
1013819302 6:114135599-114135621 CTCCCTCTCCACCCAGGGCACGG + Intronic
1014819478 6:125971575-125971597 GTGCCACTGCACTCAGGTCTAGG - Intronic
1016880609 6:148907949-148907971 GTGCCACTGCACTCAAGGCTGGG - Intronic
1018940844 6:168308152-168308174 GTCCCACTCCAGGGATGGCTGGG + Exonic
1019406966 7:888984-889006 GTCCCACGCCACCCACTGCCTGG - Intronic
1019418182 7:936899-936921 GTCCCCCACCAGCCAGGGGTGGG - Intronic
1022970518 7:35512947-35512969 GGCCACCTCCAGCCAGGGCTGGG + Intergenic
1024006186 7:45226152-45226174 GCCTCACTCCAGGCAGGGCTGGG - Intergenic
1024833575 7:53490301-53490323 GTCCCCTTCCACCAAGTGCTCGG + Intergenic
1025144429 7:56492202-56492224 GTCCCTTTTCTCCCAGGGCTTGG + Intergenic
1025260034 7:57412680-57412702 GTCCCTTTTCTCCCAGGGCTTGG + Intergenic
1026053503 7:66966084-66966106 ACCCCACTGCACCCAAGGCTGGG + Intergenic
1026586408 7:71659599-71659621 GTCTCACACAACCCAGGACTAGG - Intronic
1027206727 7:76106305-76106327 GTGCCACTGCACGCAGGCCTGGG + Intergenic
1028396625 7:90376190-90376212 GCCCCACTCCACTCCAGGCTGGG + Intronic
1028684257 7:93574983-93575005 GTCTCGCTCCAGTCAGGGCTGGG + Intergenic
1029069624 7:97884504-97884526 GCACCACTCCACCCAAGCCTGGG + Intergenic
1031220346 7:118957630-118957652 CTCCCACTCCCCCTAGGGATAGG + Intergenic
1032228757 7:130055557-130055579 GAGCCACTGCACCCAGCGCTAGG - Intergenic
1032724041 7:134574895-134574917 CTCCCACACCAACCATGGCTTGG - Intronic
1033003619 7:137535797-137535819 GTAACAGTCCACCCAGAGCTCGG - Intronic
1033116047 7:138626433-138626455 GTGCCACTGCACCCAAGGCTGGG - Intronic
1034326397 7:150237730-150237752 GTCCCACACCTGCCAGGGCGAGG - Intergenic
1034338314 7:150337448-150337470 GCCTGGCTCCACCCAGGGCTGGG - Exonic
1034497646 7:151431983-151432005 ATCCAGCTCCTCCCAGGGCTGGG + Intronic
1034498697 7:151436616-151436638 GTCACACTCAGACCAGGGCTGGG + Intronic
1034501485 7:151453534-151453556 GTCCCACACCAGCCAGGGGCGGG + Intergenic
1034747599 7:153536867-153536889 GTCCAACTCCCCACAGAGCTTGG + Intergenic
1034766817 7:153731526-153731548 GTCCCACACCTGCCAGGGCGAGG + Intergenic
1034902410 7:154915632-154915654 CCGCCTCTCCACCCAGGGCTGGG - Intergenic
1034976513 7:155452005-155452027 GTCTCACTCCCACCAGGGATGGG - Intergenic
1035261141 7:157662426-157662448 CTCCCACGCCACCCAGAGCTGGG + Intronic
1036248921 8:7145161-7145183 GCACCACTCCACCCAAGCCTGGG - Intergenic
1036400518 8:8403689-8403711 GTGCCACTGCACTCCGGGCTGGG + Intergenic
1036645946 8:10611518-10611540 GTCCCACCCCGCCCAGGGGGCGG - Exonic
1036828361 8:11998406-11998428 GTCCTGCTCCACCCAAGCCTGGG + Intergenic
1036885327 8:12547814-12547836 GCACCACTCCACCCAAGCCTGGG + Intergenic
1037987461 8:23298990-23299012 GGCCACCTCCACCCAGGCCTGGG + Intronic
1038450130 8:27634253-27634275 CCCCCGCTCCACCCAGGGCCTGG + Intronic
1038801523 8:30753813-30753835 GTACCACTCCACCCCAGCCTGGG - Intronic
1039379591 8:37072621-37072643 GTGCCACTGCACCCCGGTCTGGG - Intergenic
1039899496 8:41741076-41741098 AACCCACTCCACCCAGAACTGGG + Intronic
1042887002 8:73563430-73563452 TTTCCACTCAATCCAGGGCTGGG + Intronic
1042934636 8:74046234-74046256 GTGCCACTGCACTCAGGCCTGGG + Intergenic
1049251270 8:141590517-141590539 CTCCCTCTGGACCCAGGGCTTGG + Intergenic
1052911301 9:33884325-33884347 ATACCACTGCACTCAGGGCTGGG - Intronic
1053410951 9:37915819-37915841 GTGCCACTGCACCCCAGGCTGGG + Intronic
1055640521 9:78315733-78315755 GAGCCACTGCACCCAGGCCTTGG + Intronic
1057598073 9:96433523-96433545 GTGCCACTCCACTCCAGGCTGGG + Intergenic
1058063298 9:100522478-100522500 GTGCCACTCCACTCCGGCCTGGG - Intronic
1059199941 9:112405307-112405329 GTGCCACTTCACCCAAGCCTGGG + Intronic
1060228310 9:121809443-121809465 ATCCCACCCCAGCCAGGGCCTGG - Intergenic
1060424278 9:123491860-123491882 CTCCCACTCCACCCAAGTCTAGG - Intronic
1060514848 9:124258942-124258964 GTCTCTCTCCAGCCAGGCCTGGG + Intronic
1060735105 9:126061737-126061759 GTCCAAGGCCACACAGGGCTGGG - Intergenic
1061536268 9:131252213-131252235 GTCCCCCTCCTCTCAGGTCTCGG - Intergenic
1062269739 9:135702931-135702953 GGCCCTCTCCTCCCAGGGATAGG - Intronic
1062580258 9:137226237-137226259 GTCCCTCTCCAGCCAGGACCTGG - Exonic
1062623315 9:137432235-137432257 GTGCCACTCCACTCCGGCCTGGG + Intronic
1186351584 X:8745216-8745238 GTGCCACTGCACCCCAGGCTGGG + Intergenic
1187442580 X:19333263-19333285 GTCTCACTCTGCCCAAGGCTGGG - Intergenic
1187477698 X:19626608-19626630 GTGCCACTGCACTCAGGCCTAGG - Intronic
1188173391 X:26956861-26956883 GTGCCACTGCACTCCGGGCTGGG + Intergenic
1188916186 X:35913911-35913933 GTCCCACTGCACTCAGGCCTGGG - Intergenic
1189112707 X:38310019-38310041 GTCCCACTGCACTCAAGCCTGGG - Intronic
1190094444 X:47467427-47467449 GTCCCTCTGCAGCCAGGGCCGGG + Exonic
1190302641 X:49065487-49065509 GCCCCTCACCACCCAAGGCTTGG + Exonic
1193258694 X:79380017-79380039 AGCCCACGCCACCCAGGCCTTGG + Intergenic
1197893521 X:131288376-131288398 CTCCCACTCCTCTCAGGGCCAGG + Intronic
1198263556 X:134988264-134988286 GTGCCACTGCACCCCAGGCTGGG - Intergenic
1198822884 X:140667822-140667844 GTGCCACTGCACCCTGGCCTGGG - Intergenic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic
1201940367 Y:19452319-19452341 GTGTCACTCCCCCCTGGGCTGGG - Intergenic
1201945120 Y:19502895-19502917 GGCCCACCCCACCCAGATCTCGG - Intergenic