ID: 1002536961

View in Genome Browser
Species Human (GRCh38)
Location 5:179881096-179881118
Sequence GCCTCGCCAGGAGCACACGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 148}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002536961_1002536967 8 Left 1002536961 5:179881096-179881118 CCAACGTGTGCTCCTGGCGAGGC 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1002536967 5:179881127-179881149 TGGCACCAAGCTCAGGGACCAGG 0: 1
1: 0
2: 2
3: 16
4: 189
1002536961_1002536968 11 Left 1002536961 5:179881096-179881118 CCAACGTGTGCTCCTGGCGAGGC 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1002536968 5:179881130-179881152 CACCAAGCTCAGGGACCAGGCGG 0: 1
1: 0
2: 1
3: 25
4: 261
1002536961_1002536970 18 Left 1002536961 5:179881096-179881118 CCAACGTGTGCTCCTGGCGAGGC 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1002536970 5:179881137-179881159 CTCAGGGACCAGGCGGCTTTCGG 0: 1
1: 0
2: 0
3: 17
4: 136
1002536961_1002536972 29 Left 1002536961 5:179881096-179881118 CCAACGTGTGCTCCTGGCGAGGC 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1002536972 5:179881148-179881170 GGCGGCTTTCGGCAGAAGCTTGG No data
1002536961_1002536965 1 Left 1002536961 5:179881096-179881118 CCAACGTGTGCTCCTGGCGAGGC 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1002536965 5:179881120-179881142 GCAAGCGTGGCACCAAGCTCAGG No data
1002536961_1002536966 2 Left 1002536961 5:179881096-179881118 CCAACGTGTGCTCCTGGCGAGGC 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1002536966 5:179881121-179881143 CAAGCGTGGCACCAAGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002536961 Original CRISPR GCCTCGCCAGGAGCACACGT TGG (reversed) Intronic