ID: 1002536964

View in Genome Browser
Species Human (GRCh38)
Location 5:179881108-179881130
Sequence GCCACGCTTGCCGCCTCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 82}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002536964_1002536966 -10 Left 1002536964 5:179881108-179881130 CCTGGCGAGGCGGCAAGCGTGGC 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1002536966 5:179881121-179881143 CAAGCGTGGCACCAAGCTCAGGG No data
1002536964_1002536968 -1 Left 1002536964 5:179881108-179881130 CCTGGCGAGGCGGCAAGCGTGGC 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1002536968 5:179881130-179881152 CACCAAGCTCAGGGACCAGGCGG 0: 1
1: 0
2: 1
3: 25
4: 261
1002536964_1002536972 17 Left 1002536964 5:179881108-179881130 CCTGGCGAGGCGGCAAGCGTGGC 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1002536972 5:179881148-179881170 GGCGGCTTTCGGCAGAAGCTTGG No data
1002536964_1002536970 6 Left 1002536964 5:179881108-179881130 CCTGGCGAGGCGGCAAGCGTGGC 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1002536970 5:179881137-179881159 CTCAGGGACCAGGCGGCTTTCGG 0: 1
1: 0
2: 0
3: 17
4: 136
1002536964_1002536967 -4 Left 1002536964 5:179881108-179881130 CCTGGCGAGGCGGCAAGCGTGGC 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1002536967 5:179881127-179881149 TGGCACCAAGCTCAGGGACCAGG 0: 1
1: 0
2: 2
3: 16
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002536964 Original CRISPR GCCACGCTTGCCGCCTCGCC AGG (reversed) Intronic