ID: 1002536969

View in Genome Browser
Species Human (GRCh38)
Location 5:179881132-179881154
Sequence AGCCGCCTGGTCCCTGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002536969_1002536977 25 Left 1002536969 5:179881132-179881154 CCAAGCTCAGGGACCAGGCGGCT No data
Right 1002536977 5:179881180-179881202 CACCTTACATTCGGGCTTACTGG 0: 1
1: 0
2: 0
3: 1
4: 30
1002536969_1002536972 -7 Left 1002536969 5:179881132-179881154 CCAAGCTCAGGGACCAGGCGGCT No data
Right 1002536972 5:179881148-179881170 GGCGGCTTTCGGCAGAAGCTTGG No data
1002536969_1002536974 17 Left 1002536969 5:179881132-179881154 CCAAGCTCAGGGACCAGGCGGCT No data
Right 1002536974 5:179881172-179881194 TCAAGTCCCACCTTACATTCGGG 0: 1
1: 0
2: 0
3: 10
4: 95
1002536969_1002536973 16 Left 1002536969 5:179881132-179881154 CCAAGCTCAGGGACCAGGCGGCT No data
Right 1002536973 5:179881171-179881193 CTCAAGTCCCACCTTACATTCGG 0: 1
1: 0
2: 0
3: 7
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002536969 Original CRISPR AGCCGCCTGGTCCCTGAGCT TGG (reversed) Intronic