ID: 1002536972 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:179881148-179881170 |
Sequence | GGCGGCTTTCGGCAGAAGCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1002536964_1002536972 | 17 | Left | 1002536964 | 5:179881108-179881130 | CCTGGCGAGGCGGCAAGCGTGGC | 0: 1 1: 0 2: 0 3: 3 4: 82 |
||
Right | 1002536972 | 5:179881148-179881170 | GGCGGCTTTCGGCAGAAGCTTGG | No data | ||||
1002536969_1002536972 | -7 | Left | 1002536969 | 5:179881132-179881154 | CCAAGCTCAGGGACCAGGCGGCT | No data | ||
Right | 1002536972 | 5:179881148-179881170 | GGCGGCTTTCGGCAGAAGCTTGG | No data | ||||
1002536961_1002536972 | 29 | Left | 1002536961 | 5:179881096-179881118 | CCAACGTGTGCTCCTGGCGAGGC | 0: 1 1: 0 2: 0 3: 8 4: 148 |
||
Right | 1002536972 | 5:179881148-179881170 | GGCGGCTTTCGGCAGAAGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1002536972 | Original CRISPR | GGCGGCTTTCGGCAGAAGCT TGG | Intronic | ||