ID: 1002536972

View in Genome Browser
Species Human (GRCh38)
Location 5:179881148-179881170
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002536961_1002536972 29 Left 1002536961 5:179881096-179881118 CCAACGTGTGCTCCTGGCGAGGC 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1002536972 5:179881148-179881170 GGCGGCTTTCGGCAGAAGCTTGG No data
1002536964_1002536972 17 Left 1002536964 5:179881108-179881130 CCTGGCGAGGCGGCAAGCGTGGC 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1002536972 5:179881148-179881170 GGCGGCTTTCGGCAGAAGCTTGG No data
1002536969_1002536972 -7 Left 1002536969 5:179881132-179881154 CCAAGCTCAGGGACCAGGCGGCT 0: 1
1: 0
2: 1
3: 17
4: 193
Right 1002536972 5:179881148-179881170 GGCGGCTTTCGGCAGAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr