ID: 1002536973

View in Genome Browser
Species Human (GRCh38)
Location 5:179881171-179881193
Sequence CTCAAGTCCCACCTTACATT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002536969_1002536973 16 Left 1002536969 5:179881132-179881154 CCAAGCTCAGGGACCAGGCGGCT No data
Right 1002536973 5:179881171-179881193 CTCAAGTCCCACCTTACATTCGG 0: 1
1: 0
2: 0
3: 7
4: 81
1002536971_1002536973 3 Left 1002536971 5:179881145-179881167 CCAGGCGGCTTTCGGCAGAAGCT 0: 1
1: 0
2: 0
3: 1
4: 126
Right 1002536973 5:179881171-179881193 CTCAAGTCCCACCTTACATTCGG 0: 1
1: 0
2: 0
3: 7
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002536973 Original CRISPR CTCAAGTCCCACCTTACATT CGG Intronic