ID: 1002536974

View in Genome Browser
Species Human (GRCh38)
Location 5:179881172-179881194
Sequence TCAAGTCCCACCTTACATTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002536969_1002536974 17 Left 1002536969 5:179881132-179881154 CCAAGCTCAGGGACCAGGCGGCT No data
Right 1002536974 5:179881172-179881194 TCAAGTCCCACCTTACATTCGGG 0: 1
1: 0
2: 0
3: 10
4: 95
1002536971_1002536974 4 Left 1002536971 5:179881145-179881167 CCAGGCGGCTTTCGGCAGAAGCT 0: 1
1: 0
2: 0
3: 1
4: 126
Right 1002536974 5:179881172-179881194 TCAAGTCCCACCTTACATTCGGG 0: 1
1: 0
2: 0
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002536974 Original CRISPR TCAAGTCCCACCTTACATTC GGG Intronic