ID: 1002536977 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:179881180-179881202 |
Sequence | CACCTTACATTCGGGCTTAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 32 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 30} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1002536969_1002536977 | 25 | Left | 1002536969 | 5:179881132-179881154 | CCAAGCTCAGGGACCAGGCGGCT | No data | ||
Right | 1002536977 | 5:179881180-179881202 | CACCTTACATTCGGGCTTACTGG | 0: 1 1: 0 2: 0 3: 1 4: 30 |
||||
1002536971_1002536977 | 12 | Left | 1002536971 | 5:179881145-179881167 | CCAGGCGGCTTTCGGCAGAAGCT | 0: 1 1: 0 2: 0 3: 1 4: 126 |
||
Right | 1002536977 | 5:179881180-179881202 | CACCTTACATTCGGGCTTACTGG | 0: 1 1: 0 2: 0 3: 1 4: 30 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1002536977 | Original CRISPR | CACCTTACATTCGGGCTTAC TGG | Intronic | ||