ID: 1002536977

View in Genome Browser
Species Human (GRCh38)
Location 5:179881180-179881202
Sequence CACCTTACATTCGGGCTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 30}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002536971_1002536977 12 Left 1002536971 5:179881145-179881167 CCAGGCGGCTTTCGGCAGAAGCT 0: 1
1: 0
2: 0
3: 1
4: 126
Right 1002536977 5:179881180-179881202 CACCTTACATTCGGGCTTACTGG 0: 1
1: 0
2: 0
3: 1
4: 30
1002536969_1002536977 25 Left 1002536969 5:179881132-179881154 CCAAGCTCAGGGACCAGGCGGCT No data
Right 1002536977 5:179881180-179881202 CACCTTACATTCGGGCTTACTGG 0: 1
1: 0
2: 0
3: 1
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002536977 Original CRISPR CACCTTACATTCGGGCTTAC TGG Intronic