ID: 1002537303

View in Genome Browser
Species Human (GRCh38)
Location 5:179883892-179883914
Sequence GGCCTTTCCCCTGCTGTGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 251}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002537301_1002537303 -10 Left 1002537301 5:179883879-179883901 CCACAGCTGGAGAGGCCTTTCCC 0: 1
1: 0
2: 4
3: 31
4: 216
Right 1002537303 5:179883892-179883914 GGCCTTTCCCCTGCTGTGGTCGG 0: 1
1: 0
2: 0
3: 19
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002537303 Original CRISPR GGCCTTTCCCCTGCTGTGGT CGG Intronic
900224686 1:1527405-1527427 TGCCTGACCCCTGCTGTGCTGGG - Intronic
900488669 1:2935545-2935567 GGCCTTTCCCCTGCACTGCAGGG + Intergenic
900711356 1:4116598-4116620 GGCCTCTCCCCAGCTGTTGGAGG + Intergenic
900957611 1:5896861-5896883 GGCCTTTCACCGGCTCTGATTGG - Intronic
901167388 1:7230117-7230139 GGGCTTTCCCCAGATGTGGTGGG - Intronic
902108260 1:14056139-14056161 GGCCTTTGCCCAACTGTGGTTGG + Intergenic
902450636 1:16494737-16494759 GGCTTCCCCCCTGCTCTGGTGGG - Intergenic
902627782 1:17686752-17686774 GGACTTTCTCCTGCAGTGGATGG + Intronic
903620658 1:24695809-24695831 GGCCTCTCCCCAGCTGTTGCTGG - Intergenic
904300708 1:29551538-29551560 GCCATTTCTCCTCCTGTGGTTGG + Intergenic
904457497 1:30656505-30656527 GCCATTTCTCCTCCTGTGGTTGG - Intergenic
905264244 1:36740067-36740089 GGCCTCTCCTATGCTGTGCTTGG + Intergenic
909738514 1:78998110-78998132 TGGCTTTCCCCTGTGGTGGTGGG - Intronic
913036277 1:114969375-114969397 TGGCTTTGCCATGCTGTGGTGGG + Intronic
916717622 1:167458392-167458414 GGCCTAGCCCCTGCTGGGGCAGG + Intronic
918340400 1:183563681-183563703 GGCCTCTCCCCTGCTGTATTGGG - Intronic
918927751 1:190809709-190809731 TGCCCTGCCACTGCTGTGGTGGG + Intergenic
919800382 1:201350558-201350580 GGCCCCTCTCCTGCTGGGGTGGG + Intergenic
922675655 1:227547429-227547451 GGACTTTGCCCAGCTGTGGAGGG + Intergenic
923144556 1:231188848-231188870 GGCCTCTCCTCTCCTGAGGTGGG - Intronic
923772874 1:236952562-236952584 GGGCTATGCCCTGCTATGGTAGG - Intergenic
1062889609 10:1048673-1048695 GGGCCTTCCCGGGCTGTGGTGGG - Intronic
1062892489 10:1074585-1074607 TGCCTTCCCCCTGCCGTGGGCGG + Intronic
1065373037 10:25009726-25009748 GGTCTTTCCCATGCTGTTCTTGG + Intronic
1066108018 10:32172370-32172392 GGCCTTTCCCCTGGGGTGGGAGG - Intergenic
1067793724 10:49306172-49306194 GGCGTCCTCCCTGCTGTGGTGGG + Intronic
1068591762 10:58860155-58860177 GGCCTTTCCCATGCAGCGGCTGG - Intergenic
1070675854 10:78410735-78410757 GGCCTTGCTCATGCTGTGGGCGG + Intergenic
1072800681 10:98390507-98390529 GGCCTGATCCCTGCTGTGGGTGG + Intronic
1072913150 10:99521399-99521421 GCCCTTTCCACTGCTTTGGATGG + Intergenic
1074738795 10:116464519-116464541 GGCATGCCCACTGCTGTGGTAGG + Intronic
1074935917 10:118181454-118181476 GGCCTTTTCCCTTCTGATGTAGG + Intergenic
1075181248 10:120214119-120214141 GGCCTTTTACCTGCTTTTGTAGG - Intergenic
1076438738 10:130464549-130464571 GGCCTTTCCTCTGGTGGAGTGGG + Intergenic
1076786195 10:132751277-132751299 GTCCTTTCCCCCACTGGGGTCGG + Intronic
1085034628 11:73292616-73292638 CCTCTTTCCCCTGCTGGGGTAGG + Intronic
1085321491 11:75576811-75576833 GGAGTTTCCCCTGCTGAGCTTGG - Intergenic
1085460478 11:76690147-76690169 AGCCTTTCCCCTCCTGCTGTTGG - Intergenic
1088584262 11:111346984-111347006 TACCTTTCCCCTCCAGTGGTGGG - Intergenic
1089452065 11:118605768-118605790 GTCCTCTCCCCTGCTGTGTCAGG - Intergenic
1089667624 11:120030446-120030468 GCCCTTTCCCCTGTTCAGGTTGG - Intergenic
1089699518 11:120236057-120236079 TCCCTTTTCCCTGCTGAGGTGGG + Intergenic
1089822512 11:121241370-121241392 GTCCTCTCCCCTGCTCTGGCAGG + Intergenic
1090385336 11:126355178-126355200 GGCCCTTCCTCTGCTTCGGTTGG - Intergenic
1091124681 11:133083444-133083466 GGCCCTTCCCAGGCTGGGGTGGG - Intronic
1091276901 11:134358841-134358863 AGCCCTGCCCCTGCTGTGATGGG + Intronic
1092162049 12:6320754-6320776 GGCCATTCCGTTCCTGTGGTGGG - Intronic
1093641105 12:21527745-21527767 GTCCTTTCTCCGGCTCTGGTCGG - Exonic
1094802402 12:34051910-34051932 GGCCTTTCACCTCCTTTGTTAGG - Intergenic
1095117896 12:38377827-38377849 GGCCTTTCACCTCCTTTGTTAGG + Intergenic
1095636593 12:44441415-44441437 TACCTTTCCCCTACTGTGGTAGG + Intergenic
1096077629 12:48815117-48815139 GTCCTTTCCCCCGCCGAGGTCGG + Intronic
1098792220 12:74837804-74837826 GGTCTTTCCCATGCTGTTCTTGG + Intergenic
1100201085 12:92298469-92298491 AGCCTTTCCCCTGGTGTCTTTGG - Intergenic
1101470620 12:104993488-104993510 GCTCTTCCCCCAGCTGTGGTAGG + Intronic
1101495998 12:105254760-105254782 AGCATTTCCACTGTTGTGGTAGG - Intronic
1101961230 12:109251974-109251996 GGACTCTTCCCTGCTGTGGGGGG + Intronic
1104894061 12:132153292-132153314 GGAGTTTCCCCCGCTGTGGGAGG + Intergenic
1105965297 13:25378149-25378171 GGTCACTCCCCAGCTGTGGTGGG + Intronic
1108574025 13:51776607-51776629 TGCCTTCTCTCTGCTGTGGTGGG - Intronic
1111627968 13:90813598-90813620 GGCTTTGCCAGTGCTGTGGTGGG - Intergenic
1112145611 13:96696532-96696554 GCCCCTTCCTCTGCTGTTGTTGG - Intronic
1113960542 13:114123433-114123455 GGCCTTTTCCCTGCTTTGAGGGG - Intronic
1114702816 14:24696000-24696022 GGCCATTTCAGTGCTGTGGTGGG + Intergenic
1116009403 14:39333326-39333348 AGCCTTTTCCCTTCTGTGGTGGG + Intronic
1116132075 14:40867103-40867125 GGGCTTTTCCCTGCTTTGCTTGG - Intergenic
1119180694 14:72603302-72603324 GGCCTTTACCCATCTGTTGTTGG - Intergenic
1121216628 14:92253536-92253558 TGGCTCTCCCCTGCTGTGCTTGG - Intergenic
1124077772 15:26462086-26462108 TGCCCTGCCACTGCTGTGGTGGG + Intergenic
1124616435 15:31245594-31245616 GGCCCATGCCCTGCTGGGGTGGG + Intergenic
1125592277 15:40862226-40862248 GGCTTTAGTCCTGCTGTGGTTGG - Intergenic
1126070166 15:44859080-44859102 GCCCTTTCCCCTCCAGTGTTGGG + Intergenic
1126087870 15:45026013-45026035 GCCCTTTCCCCTCCAGTGTTGGG - Intronic
1127296713 15:57615021-57615043 GTCCTCTCCCCTGGTGTGGCTGG + Intronic
1129273001 15:74429177-74429199 TGCACTTCCCCTGCTTTGGTCGG - Intronic
1129360207 15:75019759-75019781 GGCCTTACCCCTGATGTAGGAGG + Exonic
1129713340 15:77832676-77832698 GGCCTTGCCCCTTCTGAGCTGGG - Intergenic
1129834324 15:78692410-78692432 GGCCTTTGCCCTGGTGTGCATGG + Intronic
1129946488 15:79543175-79543197 GGGTTTTCCCCAGCTGTGGAAGG + Intergenic
1130079520 15:80720275-80720297 GGCCTTTCCCCTTTCTTGGTGGG + Intronic
1132765602 16:1532891-1532913 GTCCTGTCCCCAGCTGTGGGGGG + Intronic
1133025636 16:2987950-2987972 GCCCTCTCCCCAGCTGTGTTTGG + Intergenic
1133096731 16:3452258-3452280 GCCATTTGCCCTGCTGTAGTGGG + Intronic
1133618318 16:7500950-7500972 GGCTTTCCCCCTGCTTTGCTCGG + Intronic
1134092282 16:11397978-11398000 CCCCTTTCCCCTCCTGGGGTTGG - Intronic
1137001570 16:35234478-35234500 GGACTTTGCCCAGCTGTGGAGGG - Intergenic
1138343031 16:56303207-56303229 GCCCTGTCCCATGCTGGGGTGGG + Intronic
1139501448 16:67369793-67369815 GGTCTTTCCCATGCTGTTCTTGG - Intronic
1139951850 16:70676287-70676309 GGCCTCTCCCCAGCTGTGTGAGG + Intronic
1141443790 16:84045468-84045490 GACCTTTCCCGAGCTGTGGAGGG + Intergenic
1142227952 16:88886550-88886572 TGCATTTCCCCAGCTGTGTTGGG - Intronic
1142708970 17:1713318-1713340 GGCTCTCCCCCTGCTGTGGGTGG - Intergenic
1143205255 17:5136481-5136503 GGCCTTTGCCCTGGGGAGGTGGG - Intronic
1143387694 17:6541722-6541744 AGCCTTTCCCTTGCTGTTCTGGG - Intronic
1144876305 17:18399174-18399196 GGCCTTTGCCCTGGGGAGGTAGG - Intergenic
1145155924 17:20545246-20545268 GGCCTTTGCCCTGGGGAGGTGGG + Intergenic
1146815332 17:35937666-35937688 GGCCATTCCCAGGCTGTGGGTGG + Intronic
1146843376 17:36169313-36169335 GGCCTTTACCCTGGGGAGGTGGG + Intronic
1146855686 17:36257252-36257274 GGCCTTTACCCTGGGGAGGTGGG + Intronic
1146864935 17:36331123-36331145 GGCCTTTACCCTGGGGAGGTGGG - Intronic
1146871592 17:36381163-36381185 GGCCTTTACCCTGGGGAGGTGGG + Intronic
1146878952 17:36432245-36432267 GGCCTTTACCCTGGGGAGGTGGG + Intronic
1146882892 17:36453391-36453413 GGCCTTTACCCTGGGGAGGTGGG + Intergenic
1147067794 17:37931717-37931739 GGCCTTTACCCTGGGGAGGTGGG - Intronic
1147074478 17:37981787-37981809 GGCCTTTACCCTGGGGAGGTGGG + Intronic
1147079325 17:38011272-38011294 GGCCTTTACCCTGGGGAGGTGGG - Intronic
1147086001 17:38061326-38061348 GGCCTTTACCCTGGGGAGGTGGG + Intronic
1147095265 17:38135214-38135236 GGCCTTTACCCTGGGGAGGTGGG - Intergenic
1147101946 17:38185291-38185313 GGCCTTTACCCTGGGGAGGTGGG + Intergenic
1147746572 17:42698625-42698647 GGCCTTTCTGCTGCTGGGGCTGG + Exonic
1148341503 17:46876152-46876174 TGCCTCTGCCCTGCTGGGGTTGG + Intronic
1149846538 17:60011801-60011823 GGCCTTTACCCTGGGGAGGTGGG + Intergenic
1150007554 17:61479210-61479232 GGCCCTTCCCAGGCTGTGATAGG + Intronic
1150084884 17:62268376-62268398 GGCCTTTACCCTGGGGAGGTGGG + Intergenic
1152323231 17:79620806-79620828 GCCGTTTGCCCTGCTGTGGAGGG - Intergenic
1152445041 17:80337513-80337535 GCCCTTCTCCCTCCTGTGGTCGG - Intronic
1155467392 18:26152853-26152875 GCCCTTTCACCTTCTGTGATGGG + Intronic
1156253808 18:35376895-35376917 CGGCTCTACCCTGCTGTGGTGGG + Intronic
1157406138 18:47424094-47424116 GGCCTTCCCTCTGCTGTGGAGGG + Intergenic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1158626372 18:59075236-59075258 GGGCTTTCCCCTTCTTTGCTTGG + Intergenic
1160229018 18:77032471-77032493 GGCCTCTTCCCTGCCGTGGGAGG - Intronic
1160910516 19:1471772-1471794 GGCCTTGCCCATGCTGGGGATGG - Exonic
1163034393 19:14562816-14562838 AGCCTTGCCCCTGCTGAGGCCGG + Intronic
1163477039 19:17532553-17532575 GTCCCATCCCCTGCTGTGCTGGG + Intronic
1163638631 19:18449520-18449542 GCCCCGTCCCCTGCTGTGGCTGG - Intronic
1163825806 19:19524219-19524241 GGCCTTGGCCCCCCTGTGGTTGG + Intronic
1164622446 19:29704750-29704772 GGCCTCTCCCCTGCTGAGATTGG + Intronic
1164658836 19:29944376-29944398 TGCCTTTCCTCTGCTGCAGTGGG + Intronic
1165004104 19:32790145-32790167 GGCCTTACCCATGTTGGGGTTGG + Intronic
1165106172 19:33470818-33470840 GGCTTTGCCCCTGCTGTGCCCGG - Intronic
1165706588 19:37980576-37980598 GGCCTTCCCCCTGCTCTGGAGGG - Intronic
1165828172 19:38717438-38717460 GGCCTTTCGGATGCAGTGGTCGG + Intronic
1165831792 19:38734192-38734214 GGCTTTGCCCATGCTGTGTTGGG + Exonic
1167820862 19:51926744-51926766 GGCCTTCCCTCTGCTGTAGGTGG - Intronic
926137290 2:10345875-10345897 GTCCTTGCCCCTTTTGTGGTGGG - Intronic
926140811 2:10366818-10366840 TGCCTTCACCGTGCTGTGGTGGG - Intronic
929256118 2:39813409-39813431 TGGCTTTGCCGTGCTGTGGTGGG + Intergenic
930112399 2:47689755-47689777 GGCATTTCCTCTGCAGAGGTGGG - Intergenic
930971375 2:57398627-57398649 GCCCTTTAGCCTGCAGTGGTGGG + Intergenic
931453163 2:62385683-62385705 GGCTTATCCCCTGTTGTGGGAGG + Intergenic
932500931 2:72182128-72182150 GCCCTTTGCTCTGCTGTGTTTGG + Intronic
932618798 2:73253580-73253602 GGCCTGCACCCTGCTGTAGTTGG + Intergenic
933789388 2:85872002-85872024 GGCTTGTCTCCTGCTGTGCTGGG - Intronic
933897111 2:86821761-86821783 GGGCTTTCCCCTGCTGCAGCGGG - Intronic
936373246 2:111920268-111920290 GGCTTTTCTCCTCCTGTGGCTGG + Intronic
936430562 2:112458849-112458871 GGCCATTCCACTGCTGTGTCAGG - Intergenic
937243887 2:120479919-120479941 GGCCTTTTTCCTCCTGTGTTTGG + Intergenic
937534406 2:122867936-122867958 GGCCTTTCCTCTCCTCTGCTAGG + Intergenic
937839297 2:126509712-126509734 GGCCTGTGCCCTGCTGAAGTGGG + Intergenic
938086285 2:128404275-128404297 GGCCTTGCCCATGCTGTTCTAGG + Intergenic
938794335 2:134705557-134705579 AGAGTTTCCCCTGCTGGGGTAGG + Intronic
940199076 2:151130178-151130200 GGTCTTTCCCATGCTGTTCTTGG - Intergenic
940612824 2:156011648-156011670 GGCCTTCCCCCATCTGTTGTGGG - Intergenic
945207242 2:207344861-207344883 GGGCTTTCCCAAGCTGTGGTGGG - Intergenic
946435671 2:219651056-219651078 GGCATTTCAGCTTCTGTGGTGGG + Intergenic
947681402 2:232037272-232037294 GGGCTTTGCGGTGCTGTGGTGGG + Intronic
948365008 2:237449136-237449158 TGCCCTCACCCTGCTGTGGTGGG - Intergenic
1168890642 20:1293666-1293688 CGCATTTCCCCTGCTGGGATGGG - Intronic
1169276977 20:4239977-4239999 GGCCTTTCACCTGCTGGTTTTGG - Intronic
1170062421 20:12273100-12273122 GGACTCTGCCCTGCTGTGATGGG - Intergenic
1173846064 20:46189461-46189483 GCCCTTTCCCCTGCAGTGGAGGG + Intronic
1175266561 20:57706928-57706950 GGCCTCTCCCCTGCTGAGCCTGG - Intronic
1175712896 20:61235249-61235271 GCCCCTTCCCCTGCTGCCGTGGG - Intergenic
1176075340 20:63245662-63245684 GGCCTCTGCCCAGCTGTGCTGGG - Intronic
1176515326 21:7779543-7779565 AGGCTGTCCCCTGCTGGGGTGGG - Intergenic
1177459885 21:21396642-21396664 GGCACTTCAGCTGCTGTGGTGGG + Intronic
1178649354 21:34409555-34409577 AGGCTGTCCCCTGCTGGGGTGGG - Intergenic
1178684012 21:34697278-34697300 GGCCTTTCCCCTCCTGGCTTTGG - Intronic
1179717350 21:43296557-43296579 GGCCTTTCCTCTGCAGCTGTTGG + Intergenic
1180145352 21:45915632-45915654 GGCCCTTCACCTGCTGCAGTAGG - Intronic
1181242239 22:21483303-21483325 GGCTCTGCCCCTGCTGTGGGCGG + Intergenic
1182108381 22:27705219-27705241 GGCTTGTGCCCTGCTGTGGTTGG - Intergenic
1183547618 22:38463275-38463297 GGCCTTTCTGGTGCTGTGGGAGG - Intergenic
1184331651 22:43831618-43831640 GTTCTTTCCTGTGCTGTGGTCGG - Intronic
1185127846 22:49021728-49021750 CACCTGTCCCCTGCTGTGGGAGG - Intergenic
950615975 3:14158472-14158494 GGGCTTTCCTCTGCTTTGGAGGG + Exonic
952986233 3:38786777-38786799 CGCCTTTTCCCTGCTGTTCTGGG + Intronic
953102331 3:39842193-39842215 GGGCTTTGCTATGCTGTGGTGGG + Intronic
953115645 3:39989855-39989877 GGCTTTTCCCCTGCTGGAGCTGG - Intronic
953171669 3:40512665-40512687 GGCCCTTCCCCAGTTGAGGTAGG - Intronic
954099748 3:48360795-48360817 GGTCTTTCCCATGCTGTTCTTGG + Intergenic
954625318 3:52019283-52019305 TGCCTGTCCCCTGCTCAGGTGGG - Intergenic
956592254 3:70927236-70927258 TGCCTCTCCCCTCCTCTGGTTGG + Intergenic
957409784 3:79824565-79824587 GGCATTCCCAATGCTGTGGTTGG + Intergenic
958093323 3:88905450-88905472 GGCCTTTCACCTCCTTTGTTAGG + Intergenic
962389863 3:134962443-134962465 GGCACTTCCCAAGCTGTGGTAGG + Intronic
962975084 3:140439137-140439159 GGCCTTCCCCATGCTGTGAGAGG - Intronic
963222216 3:142825282-142825304 TGCCCTTCTCCTGCTTTGGTGGG + Intronic
966871586 3:184293389-184293411 GGCCCTTACCCTGCAGTGGTGGG + Intronic
967891030 3:194364821-194364843 GCACTTTCCACTGCTGTGGCTGG + Intronic
969441881 4:7222058-7222080 GCCCTTTCCCCTTGTCTGGTGGG - Intronic
969445409 4:7242112-7242134 GGCCTTCCTCCTGCTGTGGCTGG + Intronic
970225231 4:13850648-13850670 GTCCTTTCTCCTGCTCTGCTTGG + Intergenic
972705433 4:41538239-41538261 GGCATTTCGGCTGCTGTGCTGGG + Intronic
974569346 4:63624932-63624954 GCCCTTTAACCTGCTGTTGTGGG - Intergenic
977015191 4:91683456-91683478 GGTCTTTCCCATGCTGTTCTGGG - Intergenic
977891384 4:102315949-102315971 GGCCTTTCAATTTCTGTGGTGGG - Intronic
978531231 4:109716023-109716045 AGCCTCTCCACTTCTGTGGTTGG - Intronic
981481453 4:145243231-145243253 GGGCTTTGCCAAGCTGTGGTGGG + Intergenic
982099222 4:151952197-151952219 GTCCTTTGCCCTGCAGTTGTGGG - Intergenic
982286466 4:153741256-153741278 ATCTTTTCCCTTGCTGTGGTAGG + Intronic
983779031 4:171644872-171644894 TGCCTTTCCCTTTCTGTGGTTGG - Intergenic
985726180 5:1516831-1516853 GGTCTTTCCTCTGCTGTGACTGG - Intronic
985825999 5:2192065-2192087 GGCCTCTGCCCTGCTGAGCTGGG + Intergenic
986718482 5:10540974-10540996 GGCCTGTCCACTGCTCTGGTTGG + Intergenic
989203128 5:38785699-38785721 GGTCTTTCCCATGCTGTTCTTGG + Intergenic
990362116 5:55031094-55031116 GGCCTTTGCCCTGCATTGGATGG - Intronic
992267612 5:75034138-75034160 GGCCTCTTCCCAGCTGCGGTGGG + Intergenic
992603750 5:78433949-78433971 GCCCTTTCCCCAGCTGCAGTGGG + Intronic
992619015 5:78574289-78574311 GGCCTTTGCCCTGCTGCTGGAGG - Intronic
995896225 5:117013977-117013999 TGCCTTGCCAGTGCTGTGGTGGG - Intergenic
997733713 5:136198623-136198645 CGTCTTTCCTCTGCTGAGGTTGG + Intergenic
999303483 5:150505336-150505358 GGCATTTCCCCAGCCCTGGTGGG + Intronic
1002537303 5:179883892-179883914 GGCCTTTCCCCTGCTGTGGTCGG + Intronic
1005075311 6:21901365-21901387 GCCCCATCCCCTGCTGTGGGTGG + Intergenic
1006719838 6:36142963-36142985 GTCCATTCTCCTGCTGTGGGGGG + Intronic
1007374915 6:41449972-41449994 GGACTTTGCCCTGCTGAGTTTGG + Intergenic
1011776769 6:90739494-90739516 AGGCTTTGCCCAGCTGTGGTGGG + Intergenic
1012676313 6:102117258-102117280 GGCCTTTCAGCTACTGTGTTGGG - Intergenic
1013311629 6:108900263-108900285 GCCATTTCCCATGCTGTGGGTGG - Intronic
1017051449 6:150397727-150397749 TGCCTTTCCTCTACTGTAGTTGG + Intronic
1017854993 6:158343038-158343060 TCCATTTTCCCTGCTGTGGTGGG - Intronic
1018659213 6:166069658-166069680 GGGCTTTCCCCACCTTTGGTTGG + Intergenic
1019434983 7:1017886-1017908 CGCCTTTCCCATGCTGCGGTAGG + Intronic
1019611209 7:1937560-1937582 CGGCTGTCCCCTGCTGTGGGGGG - Intronic
1019611222 7:1937600-1937622 CGGCTGTCCCCTGCTGTGGGCGG - Intronic
1020088224 7:5323052-5323074 GGCCTTGCTCCTGCGGTGATGGG - Intronic
1020444823 7:8258079-8258101 GCCCTTTCTCCTGTTGGGGTGGG + Intronic
1022098488 7:27155585-27155607 GGCCATTCCCCTGCCTTGCTAGG + Intronic
1024215681 7:47246284-47246306 GGCCTTGGACCTGCTCTGGTAGG + Intergenic
1026646663 7:72176725-72176747 GGGCTTTCCTATGCTGTAGTAGG - Intronic
1026969029 7:74456794-74456816 GGCCTTTCCCCTGAGGAGGCTGG + Intronic
1026979078 7:74516164-74516186 TGCCTTTCCCCTCCTGTGTCTGG + Intronic
1027937688 7:84631268-84631290 GGTCTTTCCCATGCTGTTCTTGG + Intergenic
1029747686 7:102525531-102525553 GCCCTTTCCCCGGCTGGGGGTGG - Intergenic
1029765637 7:102624621-102624643 GCCCTTTCCCCGGCTGGGGGTGG - Intronic
1030771093 7:113475645-113475667 TGGCTTTGCCATGCTGTGGTGGG + Intergenic
1031922015 7:127609158-127609180 GGCCTTTCTCCTGCACTTGTTGG + Intergenic
1032080197 7:128854813-128854835 GGCCTGTCCATTGCTGTGGAGGG + Exonic
1034276538 7:149826330-149826352 GGCCCTGCCCCAGCTGTGGGGGG + Intergenic
1034499644 7:151441128-151441150 GACCTTGCCTCTGCTGTGGGAGG + Intergenic
1038560696 8:28576675-28576697 GAACTTTTCCCAGCTGTGGTCGG + Intergenic
1039718604 8:40137941-40137963 GACCTTTCCACTGCTGTGCAGGG - Intergenic
1040075012 8:43220417-43220439 GGCCTTCACCCTCCTGTGCTAGG - Intergenic
1040489918 8:47910291-47910313 GGCCTTTACACTGCTGTAGAGGG - Intronic
1040668531 8:49658919-49658941 TGCCCTGCCACTGCTGTGGTGGG + Intergenic
1040802507 8:51358757-51358779 GGCCTGTCCCCTGGGGTTGTGGG - Intronic
1043698376 8:83251349-83251371 TGCCCTGCCACTGCTGTGGTAGG - Intergenic
1049259765 8:141632616-141632638 GGCCTTTCCCATGCTGTTTGAGG - Intergenic
1049259980 8:141633742-141633764 GGCCTTTCCCATGCTGTTTGAGG - Intergenic
1052241395 9:26277808-26277830 TGGCTTTGCCATGCTGTGGTGGG - Intergenic
1053139422 9:35673583-35673605 TGCCTTTCCCCTTCTGTGCCTGG + Intronic
1056116776 9:83448442-83448464 GGCCTTACCGCTGCTCTGCTGGG - Intronic
1056369235 9:85937637-85937659 CGCCATTCACCTGCTGAGGTGGG + Intergenic
1057521351 9:95762940-95762962 GGCCTTTTTCCTCCTGTGATGGG - Intergenic
1061191746 9:129086300-129086322 GCCCTGTCCCCTCCTGTGGGTGG + Intronic
1061390818 9:130316229-130316251 GGACTGTACCCTGCGGTGGTGGG + Intronic
1061512588 9:131070036-131070058 GGCCCTTCCCCTGCTCTAGGTGG + Intronic
1061664582 9:132153115-132153137 GGCCTTTCCCCCTTTGAGGTGGG + Intergenic
1062036515 9:134384968-134384990 GGCCTGTCCCCAGCACTGGTTGG + Intronic
1062156973 9:135055588-135055610 GGTCTTTCCCATGCTGTTTTCGG - Intergenic
1062172017 9:135140090-135140112 TTCCTTTCCCCTGCAGTGCTGGG - Intergenic
1062393878 9:136344880-136344902 GGCCTTGCCCCTTCTCTGCTGGG - Intronic
1062580972 9:137229099-137229121 GGCATTTCCCCTGCAGGGGTGGG - Exonic
1188952130 X:36389551-36389573 GACCTATGCCTTGCTGTGGTTGG - Intergenic
1189652620 X:43206738-43206760 GGGCTTTCCCCTGCTTTGCTTGG + Intergenic
1189877831 X:45455147-45455169 GGGCTTTTCCCTGCTTTGCTTGG + Intergenic
1190160637 X:48029168-48029190 GCCCCTTCCCCTGCTGGTGTGGG + Intronic
1197054609 X:122101782-122101804 GGCCTTTCACCTCCTTTGTTAGG - Intergenic
1197329091 X:125131700-125131722 TGCATTTCCCCTGCTATTGTTGG - Intergenic