ID: 1002539177

View in Genome Browser
Species Human (GRCh38)
Location 5:179894574-179894596
Sequence AACAAGAACCTGCAGCCCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 233}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002539177_1002539182 13 Left 1002539177 5:179894574-179894596 CCCTGGGGCTGCAGGTTCTTGTT 0: 1
1: 0
2: 1
3: 23
4: 233
Right 1002539182 5:179894610-179894632 ATTCCCTGGAGGAAGGCAAGAGG 0: 1
1: 0
2: 5
3: 34
4: 390
1002539177_1002539181 6 Left 1002539177 5:179894574-179894596 CCCTGGGGCTGCAGGTTCTTGTT 0: 1
1: 0
2: 1
3: 23
4: 233
Right 1002539181 5:179894603-179894625 TGCGATGATTCCCTGGAGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 106
1002539177_1002539185 19 Left 1002539177 5:179894574-179894596 CCCTGGGGCTGCAGGTTCTTGTT 0: 1
1: 0
2: 1
3: 23
4: 233
Right 1002539185 5:179894616-179894638 TGGAGGAAGGCAAGAGGACAAGG 0: 1
1: 0
2: 9
3: 99
4: 881
1002539177_1002539180 2 Left 1002539177 5:179894574-179894596 CCCTGGGGCTGCAGGTTCTTGTT 0: 1
1: 0
2: 1
3: 23
4: 233
Right 1002539180 5:179894599-179894621 CTTCTGCGATGATTCCCTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 92
1002539177_1002539186 20 Left 1002539177 5:179894574-179894596 CCCTGGGGCTGCAGGTTCTTGTT 0: 1
1: 0
2: 1
3: 23
4: 233
Right 1002539186 5:179894617-179894639 GGAGGAAGGCAAGAGGACAAGGG 0: 1
1: 0
2: 14
3: 122
4: 1019
1002539177_1002539179 -1 Left 1002539177 5:179894574-179894596 CCCTGGGGCTGCAGGTTCTTGTT 0: 1
1: 0
2: 1
3: 23
4: 233
Right 1002539179 5:179894596-179894618 TCTCTTCTGCGATGATTCCCTGG 0: 1
1: 0
2: 1
3: 12
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002539177 Original CRISPR AACAAGAACCTGCAGCCCCA GGG (reversed) Exonic
900447048 1:2686507-2686529 AACAGCACCCTGCACCCCCAGGG + Intronic
900448542 1:2693933-2693955 AACAGCACCCTGCACCCCCAGGG + Intronic
900452014 1:2754885-2754907 AACAGCACCCTGCACCCCCAGGG + Intronic
901089165 1:6629921-6629943 ACCCAGAACCTGCAGCCCCTGGG - Intronic
903056404 1:20639149-20639171 AACAAGAAACTGCATCCTCTAGG - Intronic
904886210 1:33740473-33740495 AGCAAGATCCAGCAGCCCCTAGG - Intronic
906659166 1:47570489-47570511 GACATGAAGCTGCAGCCACAGGG - Intergenic
908112884 1:60914682-60914704 AACAAGACACTCCAGCACCAAGG + Intronic
909923423 1:81409947-81409969 AAGAAGAACCTGCTTCCCAAAGG + Intronic
910638287 1:89433253-89433275 AACACGAAACTGCAGCACCATGG + Intergenic
910651318 1:89571180-89571202 AAAAAGAACCTGCACAGCCAAGG - Intronic
912743641 1:112225946-112225968 AAAAAGAGCCTGCATCACCAAGG + Intergenic
915249654 1:154579090-154579112 AACAAGACACAGCAGCCCCCAGG + Exonic
915820965 1:159023598-159023620 AACAAGACACTGCAGGCCAAAGG - Intronic
916317048 1:163460804-163460826 AAGCAGATCCTCCAGCCCCAGGG - Intergenic
917267691 1:173239217-173239239 AACAAAAATCTGCTGGCCCAAGG + Intergenic
917307546 1:173641697-173641719 AACAAGACACTGCAGGCCAAGGG + Intronic
917822412 1:178777564-178777586 AAAAAGAGCCTGCATCGCCAAGG + Intronic
919721169 1:200837542-200837564 AAAAAGAACCTGAATACCCAAGG - Intronic
920080418 1:203368900-203368922 AACAGGACTCTGGAGCCCCAAGG - Intergenic
922721723 1:227903240-227903262 GCCAAGAAGGTGCAGCCCCACGG + Intergenic
922888627 1:229042245-229042267 AAGAGGAAACTGCAGCCCAACGG + Intergenic
923318483 1:232805390-232805412 AACGAGAAGCTGAAGCCCCGGGG - Exonic
1062935832 10:1387798-1387820 AAAAAAAACCTACAGACCCATGG + Intronic
1064923045 10:20539031-20539053 AAAAAGAGCCTGCATCACCAAGG + Intergenic
1064926139 10:20571404-20571426 AAAAAGAGCCTGCATCACCAAGG + Intergenic
1065540122 10:26755889-26755911 AACAAAAACCTGCAGAACCTTGG + Intronic
1068677569 10:59783496-59783518 AAAAAGAGCCTGCATCACCAAGG - Intergenic
1070513975 10:77186601-77186623 AACAAAAACAAGCACCCCCATGG - Intronic
1071422336 10:85513030-85513052 AAAGATAAACTGCAGCCCCAGGG + Intergenic
1073569945 10:104572304-104572326 ATGAAGAACCTGCAGCCACCTGG - Intergenic
1073990558 10:109257836-109257858 ACCAAGAACCAGCACCTCCAGGG + Intergenic
1074618063 10:115090881-115090903 CTGAAGAACATGCAGCCCCACGG - Intergenic
1075062328 10:119265792-119265814 GACAAGAACCTGCAGGGCCCAGG - Intronic
1075254625 10:120915490-120915512 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
1075255222 10:120920883-120920905 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
1076471707 10:130723673-130723695 AACAAGAATCTGCAGTTCCAAGG - Intergenic
1077422688 11:2460406-2460428 AACAAGTACCTGTACCCGCAGGG - Intronic
1077468859 11:2747453-2747475 ACCAAGCACCGGCTGCCCCAGGG - Intronic
1077794969 11:5482027-5482049 AAAAAGAGCCTGCATCACCAAGG + Intronic
1079599094 11:22289297-22289319 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
1080839158 11:35968387-35968409 AACAGGAACAAGCAGCCACATGG - Intronic
1082314795 11:50704758-50704780 AAAAAGAGCCTGCATCACCAAGG - Intergenic
1082827476 11:57591002-57591024 AACTTGAACATGAAGCCCCATGG - Intergenic
1083904144 11:65659216-65659238 AAAACGAATCTGGAGCCCCAAGG - Intronic
1084152864 11:67299350-67299372 AACGAGGAGATGCAGCCCCAGGG - Intronic
1085387267 11:76164364-76164386 AACCTGAGCCTGTAGCCCCAAGG + Intergenic
1086305919 11:85481927-85481949 TATAGGATCCTGCAGCCCCAGGG + Intronic
1087087434 11:94233993-94234015 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
1087088025 11:94239626-94239648 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
1087837137 11:102886562-102886584 AACCAGAACCTCCTACCCCAAGG + Intergenic
1088920726 11:114258213-114258235 GAGAACACCCTGCAGCCCCACGG - Intronic
1089011381 11:115134900-115134922 TCCAAGATCCTGCACCCCCAGGG - Intergenic
1090239835 11:125174207-125174229 AACAAGCACCTGTCGCCCCTGGG - Intronic
1090573769 11:128077562-128077584 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
1094342008 12:29423053-29423075 AAGTAGAACCTGCAGCCCATTGG - Intronic
1095201782 12:39393289-39393311 AGCCAGATCCTGCAACCCCATGG - Intronic
1095410878 12:41920698-41920720 AACAATAACCTACAACTCCAAGG + Intergenic
1100746546 12:97652600-97652622 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
1101366821 12:104079754-104079776 AACCAGCACTTGTAGCCCCAGGG + Intronic
1102023665 12:109700926-109700948 AAAAGGAACTTCCAGCCCCATGG + Intergenic
1103587791 12:121968992-121969014 AACAGGAACCGGCTGCCACATGG - Intronic
1103735356 12:123057645-123057667 GGCCAGAACCTGAAGCCCCAGGG + Intronic
1105001964 12:132695870-132695892 AAGAAGAACCTGAGGCCCCCAGG - Exonic
1105591480 13:21796747-21796769 AAGAAGGACCTGCACCCTCACGG + Intergenic
1105597927 13:21857193-21857215 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
1107154562 13:37151425-37151447 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
1107393910 13:39995929-39995951 GACAAGAACCTGCAGGACAAGGG + Intergenic
1107712204 13:43161193-43161215 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
1108414290 13:50181767-50181789 AAAAAGAGCCTGCATCGCCAAGG - Intronic
1108860071 13:54846044-54846066 AAAAATAAACTGCAGCACCAAGG + Intergenic
1109210530 13:59530376-59530398 ATAGAGAACCTGCAGACCCATGG - Intergenic
1109366484 13:61363763-61363785 AACAAGATCTTTCTGCCCCATGG + Intergenic
1110842106 13:80154927-80154949 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
1111499099 13:89092422-89092444 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
1111821498 13:93221459-93221481 AAGAAGAATCTGCTGCCCCATGG + Intergenic
1112997177 13:105588066-105588088 CACAAGCACCAGTAGCCCCATGG - Intergenic
1113790749 13:113026779-113026801 AACAAAAAACTGCAGCCTGAGGG - Intronic
1115286833 14:31723411-31723433 AACAAGAACCTGAATAGCCAAGG - Intronic
1116768582 14:49101242-49101264 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
1118084210 14:62397073-62397095 AAAAAGGACCTGCATCGCCAAGG - Intergenic
1121112002 14:91318934-91318956 AAAAAGAACCTGCAGAGCCAAGG + Intronic
1121799697 14:96764293-96764315 AAGAAGAACTTACAGTCCCAAGG + Intergenic
1122860728 14:104581289-104581311 AACCTGCATCTGCAGCCCCAGGG + Intronic
1122935706 14:104955146-104955168 ACCAAGAAAGAGCAGCCCCAGGG + Intronic
1123429362 15:20201889-20201911 ACCAAAAACCTTCAGCTCCAAGG - Intergenic
1123933623 15:25183637-25183659 AACCACAACCTGGGGCCCCAGGG - Intergenic
1124159938 15:27259190-27259212 AAAGAGATACTGCAGCCCCATGG - Intronic
1125671436 15:41476203-41476225 ACCAAGAAACAGCAGCCCAAGGG - Intronic
1127263541 15:57343648-57343670 AACAAGTACAGGCAACCCCAGGG + Intergenic
1127350454 15:58146810-58146832 AACAGGCACCTGCATCCCCCAGG - Intronic
1127774999 15:62257546-62257568 GGCAAGAGGCTGCAGCCCCAGGG - Intergenic
1127997010 15:64158978-64159000 AACAGGAAACTGAAGCTCCAAGG + Intronic
1130926064 15:88386748-88386770 TCCAAGAAACTGCAGCCCAAAGG + Intergenic
1131575578 15:93587333-93587355 AACAAGCAGATGCAGACCCATGG + Intergenic
1132799964 16:1747149-1747171 AACGAGAGCCTGCAGCCCCTGGG + Exonic
1133052281 16:3124090-3124112 AACAGGAACCTGGGGCCGCAGGG - Intergenic
1134683332 16:16141772-16141794 ACCACAAAACTGCAGCCCCAAGG - Exonic
1135941100 16:26822567-26822589 GTCCAGAACCTGCAGCCTCAGGG - Intergenic
1136363919 16:29799760-29799782 AATGAGAGCCTGCAGCCTCATGG + Exonic
1136686252 16:31996458-31996480 AACAAGAACCTACAGGACCAGGG - Intergenic
1136786865 16:32939987-32940009 AACAAGAACCTACAGGACCACGG - Intergenic
1136854958 16:33647840-33647862 ACCAAAAACCTTCAGCTCCAAGG + Intergenic
1136882906 16:33913802-33913824 AACAAGAACCTACAGGACCACGG + Intergenic
1137735577 16:50720566-50720588 TACCCCAACCTGCAGCCCCAGGG + Intronic
1137950262 16:52776860-52776882 AACAGGCACCTGCGGCCCGAGGG - Intergenic
1139143316 16:64294400-64294422 AAAAAGAAACGGCAGCTCCAAGG + Intergenic
1139193987 16:64897027-64897049 AGCAGAAATCTGCAGCCCCAAGG - Intergenic
1141228672 16:82143765-82143787 AAAAAGAGCCTGCATCACCAAGG + Intergenic
1203089101 16_KI270728v1_random:1201657-1201679 AACAAGAACCTACAGGACCACGG - Intergenic
1203116536 16_KI270728v1_random:1496325-1496347 ACCAAAAACCTTCAGCTCCAAGG + Intergenic
1142479311 17:208446-208468 ACCCAGTCCCTGCAGCCCCAGGG - Intergenic
1142872338 17:2828943-2828965 GACAGGAACCTGCCCCCCCAGGG - Intronic
1143085957 17:4416290-4416312 AGAAAGAACCTGAAGACCCAGGG - Intergenic
1143130090 17:4672480-4672502 AAGAACTTCCTGCAGCCCCAGGG - Exonic
1147147214 17:38492126-38492148 AACAAGAACCTACAGGACCAGGG - Intronic
1150257259 17:63757401-63757423 AACAGGAACCTACACCCACAAGG + Intronic
1150754606 17:67900060-67900082 AACAAAAACCTCCAGCACCTAGG + Intronic
1156976519 18:43228089-43228111 AACATGACCCTTCATCCCCAAGG + Intergenic
1157812531 18:50707785-50707807 AACAAGGGCCTGCAGGCCTATGG + Intronic
1158751505 18:60266303-60266325 ATCAGGAACCTGCAGCCCCAAGG - Intergenic
1159053090 18:63439954-63439976 CACAACAACCACCAGCCCCATGG - Intergenic
1159103980 18:63984712-63984734 AACCAGATCCTTCAGCCCAAGGG + Intronic
1160187396 18:76686215-76686237 AACAAAACCCAGCAACCCCAAGG - Intergenic
1161362769 19:3860446-3860468 CTCAAGAACCTGCCGCCCTATGG - Intronic
1161499324 19:4604842-4604864 TGCAAGAACCTGCAGCCTCCAGG - Intergenic
1162256901 19:9498152-9498174 CCCAAGATCCTGTAGCCCCACGG - Exonic
1162303068 19:9855152-9855174 CCCAAGAAACTGCAGCCCCTGGG - Intronic
1163799573 19:19356429-19356451 TACAATCACCTGCACCCCCACGG - Exonic
1164501030 19:28820508-28820530 ATTAAGCCCCTGCAGCCCCAGGG + Intergenic
1164923673 19:32109057-32109079 AACAAAAACCTTCAGTTCCAAGG + Intergenic
1165419406 19:35715626-35715648 GACAAGAAGCTGCTGCCACAGGG + Intronic
925041353 2:733701-733723 CACAGGACCCTGCAGCCACACGG + Intergenic
925093418 2:1173632-1173654 AAGGAGAACCTGCAGCTCCCTGG + Intronic
926235904 2:11043544-11043566 TTCCAGAACCTGCAGCCCCGGGG - Intergenic
928271986 2:29864758-29864780 CAAAAGAACCTCCAGTCCCAGGG + Intronic
928275323 2:29895464-29895486 AGCAGGAAGCTGCAGCTCCAGGG + Intronic
929617729 2:43325284-43325306 AAAAAAAACCTGCAGCCACTGGG - Intronic
932126022 2:69146228-69146250 AACAGGAAGATGCAACCCCATGG + Intronic
933703455 2:85272852-85272874 ATGCAGAACCTGCAGCCACAGGG + Intronic
933921522 2:87052325-87052347 CACATAAAACTGCAGCCCCAGGG - Intergenic
933930100 2:87141471-87141493 CACATAAAACTGCAGCCCCAGGG + Intergenic
934001433 2:87717256-87717278 CACATAAAACTGCAGCCCCAGGG + Intergenic
935537461 2:104310757-104310779 AACAAGTACCTTCTGCCTCACGG - Intergenic
936362841 2:111821933-111821955 CACATAAAACTGCAGCCCCAGGG - Intronic
937836303 2:126473360-126473382 ACCAAGAAGATGGAGCCCCAGGG + Intergenic
938811962 2:134862044-134862066 AACACGAACCTTCAACACCAAGG - Intronic
941005895 2:160246584-160246606 AACCAGCAGCTGCAGCACCAGGG - Intronic
942402006 2:175612767-175612789 AACAAGAGTCTGCAGCCCTGGGG - Intergenic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
944339984 2:198584770-198584792 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
944406373 2:199388795-199388817 ACCGAGAACCAGAAGCCCCAAGG - Intronic
946312838 2:218892468-218892490 AGCAAGAGCCTCCAGCCCCAAGG + Intronic
946331937 2:219014413-219014435 AGCACCAACCAGCAGCCCCAGGG + Intronic
947142679 2:227033890-227033912 ACCAGGAGCCTGCAGCCCCTAGG - Intronic
947469598 2:230388828-230388850 AACCAGACCCTGGGGCCCCAGGG + Intronic
948754124 2:240149378-240149400 ATCAGCAACCTGCAGTCCCAGGG - Intergenic
948904513 2:240972258-240972280 TCCAAGATCCTGCAGCCACAGGG + Intronic
1170470846 20:16666515-16666537 ATCAAGAACTTGCACCTCCACGG + Intergenic
1171775914 20:29367525-29367547 AAAAAGAGCCTGCATCACCAAGG - Intergenic
1172132991 20:32668243-32668265 TACAAGAACATTGAGCCCCAGGG + Intergenic
1172905889 20:38369013-38369035 AACATGAACCTGGAACTCCAGGG + Exonic
1173038833 20:39440832-39440854 AAGAAGAACCAGCAGCCACTGGG + Intergenic
1175594488 20:60220024-60220046 AACAAGAAACTCCTGCACCAGGG + Intergenic
1175903985 20:62370941-62370963 AGCAGGAACCTGCAGACCCTCGG - Intergenic
1179392103 21:41003452-41003474 GACAACAGCCTGCAGCCCCAGGG + Intergenic
1179503332 21:41823403-41823425 AACAAGCACCTGCTCACCCACGG - Exonic
1180723531 22:17927526-17927548 AAGCAGGACCTGCAGCCCCAAGG - Intronic
1183931766 22:41239575-41239597 TACAAGAAGCGGCAGCACCAAGG + Exonic
1184971443 22:48024382-48024404 AACCAGGTCCTCCAGCCCCAAGG + Intergenic
950110986 3:10418594-10418616 AATAAAGACGTGCAGCCCCATGG - Intronic
952514342 3:34089307-34089329 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
953958219 3:47247510-47247532 AACAAGAACCTGAGCCCACAGGG + Intronic
955634871 3:61016654-61016676 CACAAGAACCCTCAGCTCCATGG + Intronic
960122029 3:113956824-113956846 AACAAAAACTAGCAGCCCCAGGG + Intronic
962274375 3:134001060-134001082 AGCAAGGATCTGGAGCCCCATGG + Intronic
962312915 3:134338564-134338586 AACATGCACCTGCTGCCCCAGGG + Intergenic
963262128 3:143203482-143203504 CACAAGAACCTGCTCCTCCAGGG + Intergenic
963365405 3:144327758-144327780 AAGAAAAGCCTGCAGCCCAATGG + Intergenic
964186558 3:153952309-153952331 AGCAACAAACTGCAGCACCATGG + Intergenic
964737195 3:159929192-159929214 CACTACAACCTCCAGCCCCAGGG - Intergenic
965947498 3:174261154-174261176 AAAAAGAGCCTGCATCGCCAAGG - Intronic
967107095 3:186262760-186262782 AACAAGCACGAGCAGACCCATGG - Intronic
968897594 4:3413726-3413748 AACAACAAACTACAGCCACAGGG - Intronic
973599812 4:52531045-52531067 AACAAGAATGTGCAGACCCCTGG - Intergenic
973867454 4:55127637-55127659 AACCAGAACCTGCAGGCCCGTGG + Intergenic
974610103 4:64206014-64206036 GACAAGAACCTGGGGCCCAAGGG - Intergenic
976105172 4:81609285-81609307 AACAAGAGCCTGCATAGCCAAGG + Intronic
978049052 4:104172559-104172581 AACAAGAACCTGAATAGCCAAGG + Intergenic
978680031 4:111369060-111369082 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
980216472 4:129858421-129858443 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
981626839 4:146766779-146766801 AAAAAGAAAATGCAGCCCCTAGG + Intronic
982511256 4:156286056-156286078 AAAAAGAGCCTGCATCGCCATGG - Intergenic
985245252 4:187974101-187974123 AACACCAACCTACAGCCACATGG - Intergenic
986130042 5:4921386-4921408 AAAAAGAATGTGCACCCCCAGGG + Intergenic
986285495 5:6355532-6355554 AGCAAGAAGCTGCAGCACCCAGG - Intergenic
986306414 5:6520089-6520111 AACAAGGAGCTGCCTCCCCAGGG + Intergenic
986317766 5:6601938-6601960 AACCAGCACCTGCTCCCCCAAGG + Intronic
988307414 5:29510359-29510381 ACCTAGGACCTGCAGCCACATGG + Intergenic
991046896 5:62232325-62232347 ACCAAAAACCTTCAGCTCCAAGG - Intergenic
993676113 5:90817883-90817905 AAAAAGAGCCTGCATCGCCAAGG - Intronic
993860045 5:93124893-93124915 AACCAGAATCTGCACCCACATGG - Intergenic
996039614 5:118795476-118795498 GAGAAGAATCAGCAGCCCCAGGG + Intergenic
1000433736 5:161182255-161182277 AAGAAAAACCTGCAACCCAATGG + Intergenic
1000535130 5:162470079-162470101 AACATGAACATTCTGCCCCAAGG + Intergenic
1000564712 5:162833774-162833796 AAAAAGCACCTGCAGCACCCTGG + Intergenic
1000872074 5:166589084-166589106 AAAATGAACTAGCAGCCCCATGG + Intergenic
1002058807 5:176614015-176614037 AACAAGTGCCTGCAGCTCCTTGG + Intergenic
1002539177 5:179894574-179894596 AACAAGAACCTGCAGCCCCAGGG - Exonic
1003298442 6:4854769-4854791 AACAAAAACCAGCCACCCCAGGG + Intronic
1003499973 6:6695813-6695835 AAAAAGAACCGTTAGCCCCAGGG + Intergenic
1004683785 6:17922124-17922146 GACAAGATCCTGCAGACACAGGG + Intronic
1004879658 6:19995355-19995377 AAGCAGAACCTACATCCCCATGG + Intergenic
1005178801 6:23079786-23079808 AAAAAGTACCTGTATCCCCATGG + Intergenic
1010538418 6:77060975-77060997 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
1011999209 6:93633056-93633078 AAAAAGAGCCTGCATCACCAAGG - Intergenic
1013935885 6:115593273-115593295 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
1014981041 6:127946778-127946800 GAAAGGAACCTGCAGCACCATGG + Intergenic
1019026311 6:168966698-168966720 TACAAGACACTGAAGCCCCAAGG - Intergenic
1019515907 7:1440109-1440131 AACCCGAACCACCAGCCCCAGGG + Intronic
1022438891 7:30415947-30415969 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
1022778140 7:33548948-33548970 AAAAAGAGCCTGCATCACCAAGG + Intronic
1024544300 7:50504122-50504144 CACAAGCAACTGCTGCCCCATGG + Intronic
1024638546 7:51310540-51310562 CCCAAGAACCTGAATCCCCATGG - Intronic
1024730048 7:52243726-52243748 CACAACAACCTTCATCCCCAGGG + Intergenic
1027988795 7:85331187-85331209 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
1028384078 7:90233952-90233974 AACATGAGCCTGGAGACCCATGG + Exonic
1030490080 7:110221239-110221261 AACAAAATCCTCCAGCTCCAAGG - Intergenic
1032941420 7:136797151-136797173 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
1033891176 7:146015031-146015053 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
1033923858 7:146431856-146431878 AAAAAGAACCTGGAGCCAGAAGG - Intronic
1037589758 8:20303127-20303149 CCCAGGAAGCTGCAGCCCCAGGG + Intronic
1038688121 8:29737253-29737275 AACGAAGACCTGCAGCCCCAGGG - Intergenic
1039109896 8:34030256-34030278 AATGAGAAACAGCAGCCCCAAGG + Intergenic
1040554392 8:48466359-48466381 AATAAGAAAATGGAGCCCCAGGG + Intergenic
1045184051 8:99818042-99818064 AAAAAGATTCTGCTGCCCCAGGG + Intronic
1045902434 8:107299150-107299172 AATATGAACCTGTTGCCCCATGG - Intronic
1047594596 8:126365669-126365691 AACAGAAACCTGGAGTCCCATGG - Intergenic
1048780981 8:138000730-138000752 AAAAAGAACCTGCATATCCAAGG - Intergenic
1049095816 8:140547471-140547493 AACAACATCCTGCTGCCCCAGGG - Exonic
1049532402 8:143160841-143160863 CACCAGAAGCCGCAGCCCCAGGG + Intergenic
1051026282 9:12615623-12615645 AACAAAAAGCTTCAGCCCCAGGG - Intergenic
1055695303 9:78877167-78877189 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
1056943890 9:90977535-90977557 CACAAGAACCAGTAGCACCAGGG + Intergenic
1057098864 9:92338813-92338835 TACAAGATCATCCAGCCCCAAGG - Intronic
1060556926 9:124512831-124512853 ACCCAGAACCTGCTGCCCCAAGG + Intergenic
1060912147 9:127359561-127359583 AACAAGGACCTGCTGCACCATGG - Intronic
1061063430 9:128262541-128262563 GGCAAGAGGCTGCAGCCCCATGG - Exonic
1061843058 9:133371287-133371309 AACAAGCACCTGCGGCCCAGCGG + Intronic
1187682224 X:21778973-21778995 TACAAGAAGATGCAGCCCCATGG + Intergenic
1187776497 X:22765338-22765360 AACAAAAACCAGCATCCCTAAGG - Intergenic
1191649112 X:63517876-63517898 ATCCAGAACCTCCAGCCCCTGGG + Intergenic
1193284817 X:79699493-79699515 AACAACAACCTGCAGGGACATGG + Intergenic
1196854241 X:119967890-119967912 AACTAGAACCTCCATCTCCAAGG - Intergenic
1198303178 X:135351052-135351074 ACGAAGAACTTGCAGCCTCATGG + Intronic
1199526405 X:148796920-148796942 AAAAATAACCTGTTGCCCCAAGG - Intronic
1199669655 X:150132879-150132901 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
1199674081 X:150170371-150170393 AAAAAGAGCCTGCATCGCCAAGG - Intergenic