ID: 1002539298

View in Genome Browser
Species Human (GRCh38)
Location 5:179895448-179895470
Sequence ACTTGGCCCCCTGTATGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002539294_1002539298 -6 Left 1002539294 5:179895431-179895453 CCTGGAGGACGTCCTGCACTTGG 0: 1
1: 0
2: 0
3: 17
4: 116
Right 1002539298 5:179895448-179895470 ACTTGGCCCCCTGTATGCCAGGG 0: 1
1: 0
2: 0
3: 11
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002539298 Original CRISPR ACTTGGCCCCCTGTATGCCA GGG Intronic
904851919 1:33466102-33466124 ACACGGCCCCCAGTGTGCCACGG - Intergenic
906479235 1:46189417-46189439 ACTAGGCCTCCTGTTTCCCAGGG + Intronic
910428878 1:87141647-87141669 ATTAGGCCTCCTGTATGCGATGG - Intronic
911034220 1:93521752-93521774 AATTGGCCCTCTGTATTCCAGGG - Intronic
923749071 1:236729601-236729623 ACATGCTACCCTGTATGCCATGG - Intronic
1063144310 10:3283090-3283112 ATTAAGCCCCCTGCATGCCAGGG + Intergenic
1067144659 10:43686399-43686421 GCTTGGCCCCCTGTTAGCCGAGG + Intergenic
1070312907 10:75286774-75286796 CCCTGGCCCCCTGTAAGCCCTGG - Intergenic
1071025402 10:81107165-81107187 AGATGGCCAACTGTATGCCAGGG + Intergenic
1072744156 10:97928285-97928307 ACCTGGCCCCCTGCAGGGCATGG - Intronic
1074701425 10:116095966-116095988 ACTTGGACCCCTGGATACCAGGG - Intronic
1074758755 10:116648139-116648161 ACTAGCCACCCTGTATGGCAGGG - Intergenic
1075220837 10:120583110-120583132 ACTTGGGACCTTGTATGCCTTGG - Intronic
1076744177 10:132504564-132504586 ACTTGGCCTCCCAAATGCCACGG + Intergenic
1081122690 11:39285944-39285966 ACTTGGTGCCCTGTATGTCAGGG - Intergenic
1081530923 11:43958847-43958869 AGTTGACCCCCTGTTGGCCAAGG - Intergenic
1082089120 11:48074989-48075011 ACTAGCTCCCCTGTATGCAAAGG - Intronic
1083469822 11:62876298-62876320 ACTTGGCCCCCTGCATTTCAGGG + Intronic
1084569142 11:69949130-69949152 CCCTGGCTCCCTGTCTGCCATGG - Intergenic
1088643476 11:111896575-111896597 TCTTGGCCTCCTGGATGCAAGGG + Intergenic
1088814752 11:113413293-113413315 ACTGGGCCCCTTGTTTGACAGGG - Intronic
1090271138 11:125387209-125387231 TCCTGGCCCCCTGGCTGCCATGG - Intronic
1091444167 12:534134-534156 ACTAGGACCCCAGTGTGCCACGG - Intronic
1098114145 12:67156538-67156560 AATGGACCCCCTGTTTGCCAGGG - Intergenic
1101728187 12:107405148-107405170 ACCTGGCCTACTGTATGCCATGG - Intronic
1104858411 12:131912620-131912642 ACTGGTCCCCGTGTCTGCCAGGG + Intronic
1105491602 13:20893638-20893660 ACTTGGCCTCCTGTGTTCCTGGG - Intronic
1108215654 13:48181741-48181763 ACTTGGGCAACTGTATGTCAAGG - Intergenic
1108665365 13:52624574-52624596 ATTTGGCCCTCTGTATGCGTAGG + Intergenic
1111107769 13:83669159-83669181 CCTTGGCCCCTTTTTTGCCATGG - Intergenic
1111709734 13:91796091-91796113 ACTTGGCCTCATGGATTCCAAGG + Intronic
1113659189 13:112093347-112093369 ACTTTGCTCCCTGTGTGCCAAGG + Intergenic
1114806903 14:25848064-25848086 ACTTTGGCTCCTGGATGCCAAGG + Intergenic
1116126597 14:40796548-40796570 ACTTTGACCCCTTTAAGCCATGG + Intergenic
1122900643 14:104780923-104780945 ACTTGGCACCCTCTGTGCCCTGG - Intronic
1123063684 14:105605834-105605856 ACTGTGCCCCGTCTATGCCATGG + Intergenic
1124002448 15:25770399-25770421 ACTTGGACCCCAGCAGGCCAAGG + Intronic
1124372537 15:29111745-29111767 ACTTGTGCCCCTGCAGGCCAGGG + Intronic
1124864652 15:33477440-33477462 ACTTTGATTCCTGTATGCCATGG + Intronic
1124965387 15:34429395-34429417 ACTTGGCCCTCCCTATGCCCAGG + Intronic
1124982005 15:34575597-34575619 ACTTGGCCCTCCCTATGCCCAGG + Intronic
1125264469 15:37863192-37863214 ATTAGGCCCTCTGTAGGCCAAGG - Intergenic
1130103566 15:80912339-80912361 CCTTGCTGCCCTGTATGCCAAGG + Intronic
1130270279 15:82442582-82442604 ACTTTGCTCCCTGTGAGCCACGG - Intergenic
1130357310 15:83145317-83145339 ACTGGGCCCCCTGAAAACCACGG + Intronic
1130462622 15:84169903-84169925 ACTTTGCTCCCTGTGAGCCATGG - Intergenic
1130485679 15:84397053-84397075 ACTTTGCTCCCTGTGAGCCACGG - Intergenic
1130490056 15:84424890-84424912 ACTTTGCTCCCTGTGAGCCACGG + Intergenic
1130501642 15:84503640-84503662 ACTTTGCTCCCTGTGAGCCATGG + Intergenic
1132199859 15:99943947-99943969 ACATGGTCCCCTGTGTCCCAGGG - Intergenic
1133420637 16:5643408-5643430 ACTTGGCCCCATGTTCTCCAAGG + Intergenic
1133773825 16:8883153-8883175 AGTGGGCTCACTGTATGCCAGGG - Intergenic
1137597751 16:49736064-49736086 ATATGTCCCTCTGTATGCCAGGG - Intronic
1142435571 16:90054824-90054846 ACTTGGGCCCCTTTGAGCCATGG - Intergenic
1143741964 17:8961002-8961024 ACTGGTCCCCCTGTAGGCCTGGG + Intronic
1146461211 17:33047279-33047301 ACATGTGCCCCAGTATGCCAAGG - Intronic
1148601547 17:48898227-48898249 ACCTGGCCCCAGATATGCCAAGG - Intergenic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1155038582 18:22045796-22045818 AAATGGCCCCCTGTGGGCCAGGG + Intergenic
1156235523 18:35199904-35199926 ACATTGCCCCCTGTTTGCCTAGG - Intergenic
1157320445 18:46630114-46630136 ACTGGGCCCTCTGAATGCAAGGG + Intronic
1160073069 18:75645344-75645366 CCTCGGCCTCCTGGATGCCAGGG - Intergenic
1160451994 18:78972727-78972749 ACCTGGCCCCCGGTTTGCCCAGG + Intergenic
1160691553 19:462521-462543 ACTGAGCCCTCTGTGTGCCAGGG - Intergenic
1162016641 19:7849903-7849925 ACATGGGCCCCTGTACCCCAGGG + Intronic
1162361017 19:10220507-10220529 ACTTAGCTCCCTCTTTGCCATGG - Intronic
1163201279 19:15771246-15771268 ACTGGGCCTCCTGCAGGCCAAGG + Intergenic
1163295827 19:16412155-16412177 AGTTGGCCCTCTGTATCCAAGGG - Intronic
1165253212 19:34557077-34557099 ACTTGGCCCCCAGGAGCCCATGG - Intergenic
1166155795 19:40910162-40910184 ACTTGGCTCCGTGTATGACACGG + Intergenic
1167371005 19:49081972-49081994 ACTTGGGACCCTGTGTGTCATGG - Intergenic
925055370 2:853089-853111 AATGGGCCCCCTCTTTGCCACGG - Intergenic
925117240 2:1389979-1390001 ACTTAACCTCTTGTATGCCAGGG - Intronic
931402505 2:61943976-61943998 ACTTGGCCCCCAGTCACCCAGGG + Intronic
936439374 2:112537615-112537637 TCTTGGCCACTTGTATGCCAAGG + Exonic
938174692 2:129114690-129114712 AGTTGGCCCTCTGGATCCCAGGG + Intergenic
941081100 2:161061511-161061533 ACTTGGACCAGTGTTTGCCAGGG + Intergenic
945158955 2:206868981-206869003 CCTTGAGCCCCTATATGCCAGGG + Intergenic
1170368937 20:15627421-15627443 ACTTGGTCTCCTGTATGGCATGG - Intronic
1170948564 20:20913338-20913360 ACTTGGACCCCCTTATGCCCCGG + Intergenic
1171432408 20:25091361-25091383 CCTGGGGCCCCTGCATGCCAGGG + Intergenic
1174296560 20:49549482-49549504 AGTTGGCCCCCTGTATCCATGGG - Intronic
1181369038 22:22401811-22401833 CCATGGCCCCCTTTCTGCCAAGG - Intergenic
1182449050 22:30407486-30407508 AATTGGACCTCTGGATGCCAAGG + Exonic
1184113648 22:42409674-42409696 ACTAGGCCCCCTGGGAGCCAGGG + Intronic
950831733 3:15881286-15881308 ACTTGGCCCTCTGTATCCATGGG - Intergenic
952674293 3:36008482-36008504 ACCTGGACCCCTTTAAGCCATGG + Intergenic
953626492 3:44576388-44576410 AGTTGGCCCCCTGTATTCTTGGG - Intronic
958685436 3:97386974-97386996 CCTTGGCCCCCTTTTAGCCATGG + Intronic
968321719 3:197775376-197775398 ACTTGGCCCTCTGTGTCTCAAGG + Intronic
969141016 4:5071946-5071968 AATTGGCAACCTGCATGCCATGG - Intronic
975740743 4:77426561-77426583 AGTCTGCCCCCTGTATTCCAGGG - Intronic
975753518 4:77549630-77549652 ACTTGAGCCCCTGTTTGCCTGGG + Intronic
977342133 4:95772004-95772026 TCTTGGCCTCCTGGATTCCAAGG - Intergenic
987542784 5:19276752-19276774 ACTTGGTCCCCTTTTAGCCATGG - Intergenic
988998895 5:36740929-36740951 ACCTGGCCACCTGCAAGCCAAGG - Intergenic
994911663 5:105917251-105917273 ACTTGGCTCCCTTTCTTCCAGGG - Intergenic
995591606 5:113705781-113705803 ACCTGGGCCCCTGTGAGCCATGG + Intergenic
997262183 5:132473830-132473852 TCTTGACCCCCTCCATGCCATGG + Intronic
999490647 5:152047087-152047109 AGTTGGCCCCCTGTATCCATGGG + Intergenic
1001138752 5:169125370-169125392 TCTTAGCCACCTGCATGCCATGG + Intronic
1001268597 5:170293500-170293522 ACTGGGCCCTCTGTTAGCCAAGG - Intronic
1002539298 5:179895448-179895470 ACTTGGCCCCCTGTATGCCAGGG + Intronic
1002655654 5:180744635-180744657 GCCTTGCCCCCTGTGTGCCAGGG + Intergenic
1007260537 6:40559941-40559963 ACTTGGCCCTCCCCATGCCAAGG + Intronic
1013221110 6:108078022-108078044 AGTTGGCCCTCTGTATGCATGGG - Intronic
1017103025 6:150865472-150865494 ACTTGGCGCCCTGAGTACCAAGG + Intergenic
1018290984 6:162292483-162292505 ACTTGACCCTCTGTTTGCCTGGG - Intronic
1019042579 6:169119080-169119102 CCTGGGCCCCATCTATGCCATGG - Intergenic
1020097772 7:5378018-5378040 ACCTGGCCCCCTGCAGGGCACGG - Exonic
1020810718 7:12846833-12846855 ACTTGGACCCCTTTGAGCCATGG + Intergenic
1023890106 7:44385927-44385949 TCTTGGCTCCCTGCATTCCAGGG - Exonic
1026553266 7:71385687-71385709 ACTTTGCCCCCAGCAGGCCATGG + Intronic
1026568959 7:71512779-71512801 ACTTGTCTCCTTGTATGCAAGGG + Intronic
1027595991 7:80174824-80174846 ACTTGGATCCCTGAATGACATGG - Intronic
1028784222 7:94773808-94773830 ACTTTGCCCCCTTTTAGCCATGG - Intergenic
1029054651 7:97729158-97729180 AGTTGGCCCCCTGTATCCATGGG + Intergenic
1029611212 7:101627561-101627583 ACTGGGCCCGGTGCATGCCAGGG - Intronic
1030939777 7:115631679-115631701 ACTTGGCTCCCTGAATGTCTGGG - Intergenic
1037147963 8:15596433-15596455 AGTTGGCACTCTGTATGCAAAGG - Intronic
1037496330 8:19444413-19444435 AGTTGGCCCACTGTATCCAAGGG - Intronic
1041351406 8:56951232-56951254 ACTTTGGCCCCTTTATGCCATGG + Intergenic
1041777060 8:61534952-61534974 AGTTGGCCCTCTGTAAGCCCAGG - Intronic
1044337366 8:91003143-91003165 ACTTGCACAACTGTATGCCATGG + Intronic
1044849836 8:96417614-96417636 TCTTGGCCCACTGAAAGCCAAGG + Intergenic
1045520175 8:102896574-102896596 AATTTGCTCCCTGTATACCAAGG + Intronic
1046640452 8:116724144-116724166 ACTTGACACCATATATGCCAGGG - Intronic
1047940436 8:129823512-129823534 ACCTGGGCCCCTTTGTGCCAAGG - Intergenic
1052460259 9:28753785-28753807 ACTTGGCTCTGTATATGCCAGGG - Intergenic
1059550658 9:115225658-115225680 ACATGGCCCACAGTTTGCCATGG + Intronic
1062070944 9:134554709-134554731 CCTTGCCCCCATCTATGCCATGG + Intergenic
1188948310 X:36336073-36336095 ACTAGGCCACCTGTATGACTGGG - Intronic
1189886065 X:45546015-45546037 ACCTGGGCCCCTTTAAGCCATGG - Intergenic
1192242333 X:69342740-69342762 AGTTGGCCCCCTGTATCCACAGG - Intergenic
1194558926 X:95396641-95396663 ACTTGTACCCCTTCATGCCATGG - Intergenic
1198062435 X:133060793-133060815 AGTTGGTCCTCTGTATTCCATGG + Intronic
1198141918 X:133812967-133812989 ACTTGCCCCACTCTATGCCTTGG + Intronic
1198943830 X:141987488-141987510 CCTTAGCCCCCTATAAGCCATGG - Intergenic
1199220555 X:145311270-145311292 ACTTGGTCCCCTCTGAGCCATGG + Intergenic
1199251397 X:145666246-145666268 ACTTGGCCCCCTGTCACCCACGG - Intergenic
1199321743 X:146447632-146447654 ACTTGGCCCCCAGTCACCCAGGG + Intergenic
1202337829 Y:23829160-23829182 ACTGGACCCCCTGGAGGCCATGG - Intergenic
1202532937 Y:25840911-25840933 ACTGGACCCCCTGGAGGCCATGG + Intergenic