ID: 1002539400

View in Genome Browser
Species Human (GRCh38)
Location 5:179896051-179896073
Sequence GGGATGAAACCGATGGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002539400_1002539404 11 Left 1002539400 5:179896051-179896073 CCTTACTCCATCGGTTTCATCCC 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1002539404 5:179896085-179896107 TTCTCACAGTTTCCTGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002539400 Original CRISPR GGGATGAAACCGATGGAGTA AGG (reversed) Intronic
900900665 1:5513588-5513610 GGGATGAAGCCAAGGAAGTATGG + Intergenic
902618500 1:17636978-17637000 GTGATGATACAGATGGAGTAAGG - Intronic
904533907 1:31186683-31186705 GGGAGGAAAGTGATGGAGTGAGG - Intronic
905489864 1:38334909-38334931 GGGAGGTGACTGATGGAGTAAGG - Intergenic
905958270 1:42018781-42018803 GGGAGGAAACTAATGGAGTGAGG - Intronic
907929824 1:58988967-58988989 AGGATGAAATGGATGGAGTGAGG - Intergenic
913552969 1:119934996-119935018 GGGAGGATACTGATGGTGTAAGG - Intronic
920701036 1:208218264-208218286 GAGATGAAAACGATGGCTTAAGG - Intronic
1063238174 10:4141108-4141130 GGGAAGAAACCCCTGGGGTAAGG + Intergenic
1063382807 10:5596945-5596967 TGGCTGAAACCGATGGGGCAGGG - Intergenic
1063739175 10:8797938-8797960 GGGCTGAAAGGGATGGAGAACGG + Intergenic
1065966010 10:30770845-30770867 GGGATGAAGCAGAAGAAGTATGG - Intergenic
1071719030 10:88124061-88124083 TGGACCAAACAGATGGAGTATGG + Intergenic
1073664015 10:105509682-105509704 GGGATGAAATCATTGGAGTATGG + Intergenic
1081722877 11:45302958-45302980 AGGAAGAAACAGATGGAGAAAGG + Intergenic
1083144105 11:60745621-60745643 GGAAAGAAACTAATGGAGTAAGG + Intergenic
1087333975 11:96819287-96819309 ATGATGAAACCCATAGAGTAAGG - Intergenic
1091099285 11:132855284-132855306 GGGATGAAATCACAGGAGTATGG - Intronic
1094293050 12:28873547-28873569 GGGATGAAAGGGACTGAGTAGGG + Intergenic
1095933641 12:47653998-47654020 TGGATGAAACCGATGAAATCAGG - Intergenic
1096188424 12:49599134-49599156 GGGATGAAACAGAAAGAGAAAGG + Intronic
1101568044 12:105928104-105928126 GGGATGGAACAGATGGTGTTGGG + Intergenic
1103452236 12:121037346-121037368 GGCATGAAACAGCTGGAGGAAGG + Intronic
1112318943 13:98389754-98389776 GGGAAGAAAATGATGGACTAGGG + Intronic
1125307924 15:38343077-38343099 GGGAGGACAGTGATGGAGTAAGG + Intronic
1136328453 16:29551295-29551317 GTGATGACACTGATGGAGGAGGG + Intergenic
1136443138 16:30291309-30291331 GTGATGACACTGATGGAGGAGGG + Intergenic
1138882300 16:61031057-61031079 GGGATGAAACCCCTGGGGGAAGG - Intergenic
1142590341 17:1002223-1002245 GGGATGACACTGCTGGAGTCAGG + Exonic
1148020851 17:44552511-44552533 GGGGTGAAATAGATGGAGTAGGG - Intergenic
1153208218 18:2728298-2728320 GGGATGAAACTGATTAAGCATGG + Intronic
1158141722 18:54262659-54262681 GGGATCAAACCCATGAAGAAGGG + Intergenic
1163588475 19:18176911-18176933 GGGATGAAACCAAGGGAGCTAGG + Intronic
1164591979 19:29512314-29512336 GGGATGAAAAGGAAGGAGAAGGG + Intergenic
1165155679 19:33785926-33785948 AGGATGAAAGCGATCCAGTATGG - Intergenic
926715374 2:15919995-15920017 GGGATGGCACAGATGGTGTATGG - Intergenic
927925134 2:27006930-27006952 GGGAAGAAACCAATGGTGTAAGG + Intronic
927985868 2:27409889-27409911 GGGATGAAAACACTGGAGGACGG - Intergenic
931430592 2:62205949-62205971 AGGATGAAATCGATGGACTGGGG + Intronic
933215334 2:79623457-79623479 GGGAAGAAATAGATGGAGTGAGG - Intronic
939817276 2:146911389-146911411 GGGATGAAAGCAAGGAAGTAGGG + Intergenic
942783670 2:179675607-179675629 GAGAGGAAACAGGTGGAGTAAGG + Intronic
1178595242 21:33947575-33947597 GGGATGCAACAGATGGAGGGTGG + Intergenic
1180832171 22:18911927-18911949 GGGATGTGCCCGGTGGAGTAAGG - Exonic
1181067673 22:20314415-20314437 GGGATGTGCCCGGTGGAGTAAGG + Exonic
1182065126 22:27425592-27425614 GGGAGGAAGACGATGGAGAAGGG - Intergenic
1182278782 22:29206339-29206361 GGGTTGAAAGGGAGGGAGTAGGG - Intronic
1185169036 22:49281516-49281538 AGGATGGAACAGATTGAGTAAGG + Intergenic
1203282256 22_KI270734v1_random:137232-137254 GGGATGTGCCCGGTGGAGTAAGG - Intergenic
949778906 3:7663886-7663908 GGGATGAAACCACTGGACTCAGG - Intronic
949830669 3:8210835-8210857 GGGAAGAAACCAAAGCAGTAGGG - Intergenic
955395985 3:58557832-58557854 GGGAGGAAACCACTGGAGTGAGG + Intergenic
955425559 3:58785919-58785941 GGGAGGAAACCAATGGAGTGAGG - Intronic
955663435 3:61325805-61325827 TGGATGAAAGAGAGGGAGTAAGG + Intergenic
959687052 3:109158918-109158940 GGGAAGACACTAATGGAGTAAGG + Intergenic
961663811 3:128484243-128484265 GGGATGGAAACGAAGGAGGAGGG + Intronic
964081650 3:152766067-152766089 GGGATGAAGCCGATTGATCATGG - Intergenic
964370998 3:156000393-156000415 GGGATGAAGCCGATTGATCATGG + Intergenic
968607288 4:1541556-1541578 GGGATGGCACCGCTGGAGTTGGG - Intergenic
972114834 4:35618912-35618934 GGAAGGAAACTGATGGAGTAAGG - Intergenic
972489084 4:39569925-39569947 GGGAGGAAACTAATGGAGTAAGG - Intronic
976883435 4:89958478-89958500 GGTATGAAATCTATGGATTAAGG + Intergenic
982550162 4:156787712-156787734 GAGATGAATGAGATGGAGTAAGG + Intronic
985182402 4:187279661-187279683 GGGATGAAACGGAGGGAGTGTGG + Intergenic
986517390 5:8578451-8578473 GGCATGAGACCCATGGTGTAGGG - Intergenic
995201177 5:109426595-109426617 GGGATGGAGCAGATGGAGAAGGG - Intergenic
996560741 5:124826276-124826298 GTGATGAGAGAGATGGAGTATGG + Intergenic
997692916 5:135839106-135839128 GGGAAGAAACTGAGGGAGAAAGG - Intronic
997864703 5:137450826-137450848 GGGATGACACGGATGCAGCATGG - Intronic
1000608930 5:163354419-163354441 GGGATGAAATCGTAGGGGTATGG + Intergenic
1002404055 5:179015142-179015164 TGGAGGAAACCAATGGAGTAAGG + Intergenic
1002539400 5:179896051-179896073 GGGATGAAACCGATGGAGTAAGG - Intronic
1019332345 7:466636-466658 GGGATGAAGTCGAGGGAGGAGGG - Intergenic
1019603129 7:1895225-1895247 GAAATGAAACCGATGGACCAAGG + Intronic
1023530107 7:41144197-41144219 GTGATGAAAGGGAAGGAGTATGG - Intergenic
1030490314 7:110224461-110224483 GGGATGAAAAGGAGGGAATATGG + Intergenic
1033246459 7:139720500-139720522 GGGAAGAAACGGGTGAAGTACGG - Intronic
1036412608 8:8516584-8516606 GGGATCAAAGCAATGGAGGAAGG - Intergenic
1038914805 8:32009248-32009270 AAGATGAAACTGTTGGAGTAGGG - Intronic
1039003454 8:33007551-33007573 GGGATGAAACAGATGTAGGCCGG - Intergenic
1040894005 8:52346887-52346909 AGGAGGAAACGGCTGGAGTAGGG + Intronic
1060840760 9:126791617-126791639 GGAATGATACCTATGGAGTCTGG - Intergenic
1062584741 9:137244173-137244195 GGGATGAACCCCATGTAGAAGGG + Exonic
1186741242 X:12520634-12520656 GGGATGAAACTCAAAGAGTAAGG - Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1190992883 X:55570318-55570340 GGGATGAAGCCAATTGATTATGG - Intergenic
1197909790 X:131468983-131469005 AGGAATAAACAGATGGAGTAAGG - Intergenic
1198915567 X:141667657-141667679 GGGATCAAAGCAATGGAGTGAGG - Intronic