ID: 1002540411

View in Genome Browser
Species Human (GRCh38)
Location 5:179902833-179902855
Sequence GGCTCTGAAGCCAGAGATCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 1, 2: 0, 3: 41, 4: 357}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002540396_1002540411 29 Left 1002540396 5:179902781-179902803 CCACAGGAAGCCCCTCCTCTGGC 0: 1
1: 1
2: 3
3: 55
4: 393
Right 1002540411 5:179902833-179902855 GGCTCTGAAGCCAGAGATCGGGG 0: 1
1: 1
2: 0
3: 41
4: 357
1002540407_1002540411 -9 Left 1002540407 5:179902819-179902841 CCAGGGTCCACTCAGGCTCTGAA 0: 1
1: 0
2: 1
3: 17
4: 214
Right 1002540411 5:179902833-179902855 GGCTCTGAAGCCAGAGATCGGGG 0: 1
1: 1
2: 0
3: 41
4: 357
1002540398_1002540411 18 Left 1002540398 5:179902792-179902814 CCCTCCTCTGGCAAACTCTTGCT 0: 1
1: 0
2: 0
3: 25
4: 268
Right 1002540411 5:179902833-179902855 GGCTCTGAAGCCAGAGATCGGGG 0: 1
1: 1
2: 0
3: 41
4: 357
1002540404_1002540411 -6 Left 1002540404 5:179902816-179902838 CCCCCAGGGTCCACTCAGGCTCT 0: 1
1: 0
2: 3
3: 28
4: 227
Right 1002540411 5:179902833-179902855 GGCTCTGAAGCCAGAGATCGGGG 0: 1
1: 1
2: 0
3: 41
4: 357
1002540394_1002540411 30 Left 1002540394 5:179902780-179902802 CCCACAGGAAGCCCCTCCTCTGG 0: 1
1: 0
2: 0
3: 31
4: 267
Right 1002540411 5:179902833-179902855 GGCTCTGAAGCCAGAGATCGGGG 0: 1
1: 1
2: 0
3: 41
4: 357
1002540406_1002540411 -8 Left 1002540406 5:179902818-179902840 CCCAGGGTCCACTCAGGCTCTGA 0: 1
1: 0
2: 0
3: 19
4: 172
Right 1002540411 5:179902833-179902855 GGCTCTGAAGCCAGAGATCGGGG 0: 1
1: 1
2: 0
3: 41
4: 357
1002540405_1002540411 -7 Left 1002540405 5:179902817-179902839 CCCCAGGGTCCACTCAGGCTCTG 0: 1
1: 0
2: 5
3: 31
4: 307
Right 1002540411 5:179902833-179902855 GGCTCTGAAGCCAGAGATCGGGG 0: 1
1: 1
2: 0
3: 41
4: 357
1002540400_1002540411 14 Left 1002540400 5:179902796-179902818 CCTCTGGCAAACTCTTGCTGCCC 0: 1
1: 0
2: 1
3: 16
4: 182
Right 1002540411 5:179902833-179902855 GGCTCTGAAGCCAGAGATCGGGG 0: 1
1: 1
2: 0
3: 41
4: 357
1002540397_1002540411 19 Left 1002540397 5:179902791-179902813 CCCCTCCTCTGGCAAACTCTTGC 0: 1
1: 0
2: 0
3: 16
4: 276
Right 1002540411 5:179902833-179902855 GGCTCTGAAGCCAGAGATCGGGG 0: 1
1: 1
2: 0
3: 41
4: 357
1002540399_1002540411 17 Left 1002540399 5:179902793-179902815 CCTCCTCTGGCAAACTCTTGCTG 0: 1
1: 1
2: 1
3: 19
4: 189
Right 1002540411 5:179902833-179902855 GGCTCTGAAGCCAGAGATCGGGG 0: 1
1: 1
2: 0
3: 41
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002540411 Original CRISPR GGCTCTGAAGCCAGAGATCG GGG Intronic
900322242 1:2090545-2090567 GGCTCTGACCCCAGGGACCGGGG - Intronic
900509152 1:3050202-3050224 GTCTCTGAAGCCACACAGCGGGG - Intergenic
901659550 1:10789927-10789949 GGCTCTGAGGCCACAGCTTGGGG - Intronic
902520968 1:17016208-17016230 GGCGCTGAAGCCTAAGATTGTGG - Intergenic
902649906 1:17830208-17830230 AGCTCTGAAGCCAGACTTCATGG + Intergenic
902895243 1:19475300-19475322 GACTCTGGAGCCAGAGAGCCTGG - Intronic
903013065 1:20343938-20343960 GGGGCTGAAGCCAGAGATGAAGG - Intronic
903132323 1:21288455-21288477 GTCTCTGAAGCCAGCGACCCGGG - Intronic
903668726 1:25023078-25023100 GGCTCTGTAGCCTGAGAACCTGG + Intergenic
903911888 1:26733385-26733407 GGCTCTAGAGCCAGAGTTCCTGG + Intronic
905388265 1:37619343-37619365 GACTCTGAAGCCTGAGCTCTGGG - Intronic
906109236 1:43312286-43312308 GGCTCTGGGGCCAGAGGTCAGGG - Exonic
906202674 1:43970208-43970230 GGCGCTGCAGCGAGAGACCGGGG + Exonic
906441025 1:45844877-45844899 GGCTCAGAAGCCCAAGATCAAGG + Intronic
906600947 1:47128888-47128910 AGCTCTGAAGTCAGAGATTTTGG - Intergenic
906636965 1:47416347-47416369 GGCAGGGAAGCCAGAGAACGCGG - Exonic
906754771 1:48300454-48300476 AGCAGTGAAGCCAGAGATCCAGG - Intronic
907124332 1:52035883-52035905 GGCTCTGAAGCCAGAGTGCTTGG + Intronic
907516878 1:54998422-54998444 GGATGTGAAGCCAGAGGCCGTGG - Intergenic
908486694 1:64601369-64601391 GCCTCAGAAGCCACAGATGGAGG - Intronic
909253553 1:73389390-73389412 GGCTCAGAAGTCAAAGATCAAGG + Intergenic
910724939 1:90328365-90328387 GGCTCTGAAGAGAGAGATTCAGG + Intergenic
912673019 1:111648967-111648989 GCAGCTGAAGCCAGAGATCGAGG - Intronic
915511813 1:156390771-156390793 GGCTCTGAAGACACAGACAGAGG + Intergenic
917869872 1:179231626-179231648 GGCTCTGAAGCCAGACTGCTTGG + Intergenic
918872457 1:189993018-189993040 GGCTCTGAAAGCAGACATGGCGG + Intergenic
919456539 1:197827131-197827153 GGCTTTGAAGGCAGAGAAAGGGG - Intergenic
919566040 1:199190076-199190098 GGCACTGAATCAAGAGAACGAGG - Intergenic
920846568 1:209598212-209598234 GGCTCTGAAGACAGAGCAGGTGG - Intronic
921738259 1:218653448-218653470 GGGGCTGAAGCCAGGGAGCGAGG + Intergenic
1063476303 10:6331566-6331588 GGCTGGGAAGCCCAAGATCGAGG - Intergenic
1063724559 10:8622739-8622761 GACTCTGAAGCGAGAAATTGAGG + Intergenic
1064317196 10:14269506-14269528 GGCTCTGAAGGCAGAGGAAGGGG - Intronic
1064361730 10:14671653-14671675 GGCCCTGAAACCAGAGACAGGGG + Intronic
1064573989 10:16725721-16725743 GGCTGGGAAGCCTGAGATCAAGG - Intronic
1065328801 10:24572486-24572508 GGCTCTGAAGTCAGGGAGAGTGG + Intergenic
1065349446 10:24782521-24782543 GAGGCTGAAGCCAGATATCGTGG + Intergenic
1065359173 10:24873111-24873133 GGCTCTGAGGCCAGGCATGGTGG - Intronic
1066656956 10:37705292-37705314 GCCTCTGAAGCAGGAGATGGTGG - Intergenic
1067377914 10:45744823-45744845 GGCTCTGTAGGCAGTGATCGTGG + Exonic
1067844542 10:49709446-49709468 GGCTCTGAAGCCAGAGGTTCAGG - Exonic
1067885614 10:50085499-50085521 GGCTCTGTAGGCAGTGATCGTGG + Exonic
1067989482 10:51194752-51194774 GGCTGAGAAGTCAAAGATCGAGG + Intronic
1069063702 10:63920484-63920506 GGCTCTGAAGCCAGATGGCCTGG - Intergenic
1070794267 10:79207801-79207823 GGCTCCAAAGCCAGAGCTGGTGG + Intronic
1071298536 10:84239963-84239985 TTCTCTGAAGCCAGAGCTCTTGG - Intronic
1071344456 10:84679235-84679257 GGCTCTGAAGCTAGACAACCTGG - Intergenic
1071730217 10:88240682-88240704 AGCTCTGATGCCAGAGACAGAGG - Intergenic
1072444582 10:95487574-95487596 GGCTTTGGAGCCAGTGATGGTGG + Intronic
1072971726 10:100023191-100023213 GGCTCTGGAGCCAGGCATGGTGG + Intergenic
1074661981 10:115670065-115670087 GACTCTGGAGCCAGAGAACTGGG + Intronic
1074850952 10:117439242-117439264 GGCTGTGAAGCTAGAGAGAGGGG + Intergenic
1075016175 10:118911409-118911431 GGTACTGAAGCCAGAGCTAGTGG - Intergenic
1075131176 10:119741229-119741251 GGGCCTGAAGCCAGAGAGCCAGG - Intronic
1075960741 10:126566097-126566119 GGCTCTGAAGCCAGAAAGCCTGG + Intronic
1076419566 10:130321265-130321287 GGCACTGAGGCAAGAGACCGAGG + Intergenic
1076836519 10:133023772-133023794 GGCTCAGCAGCCAGAGACCCAGG - Intergenic
1078911722 11:15739050-15739072 GGGTATGAAGCCAGAGATCCAGG + Intergenic
1079322165 11:19460276-19460298 GGCTTTGAAGTCAGAGATCTGGG + Intronic
1079409480 11:20174023-20174045 GGCTCTGAAGGCAGAAGTGGTGG + Intergenic
1080070163 11:28073483-28073505 GGCTCTGAAGCCAGACAGCTGGG + Intronic
1081961248 11:47139210-47139232 GGCTCTGAAGACAGAGTTGGAGG + Intronic
1083349362 11:62016316-62016338 GGCGCTGAGGCAAGAGACCGAGG + Intergenic
1083689542 11:64398783-64398805 GGCTGGAAAGCCTGAGATCGAGG - Intergenic
1084330003 11:68424651-68424673 AGGGCTGAAGCCCGAGATCGAGG + Intronic
1084856169 11:71988384-71988406 TGCACTGAAGCTAGAGATCTAGG + Intronic
1085414728 11:76312460-76312482 GGCTCTGAAGCAGGAGTTTGAGG + Intergenic
1087154033 11:94883841-94883863 GGGGCTGAAGCTAGAGAGCGAGG + Intergenic
1087782716 11:102318337-102318359 GGCTTTGGAGTCAGACATCGGGG - Intronic
1087989566 11:104731775-104731797 AGCTCTGAAGCCAGAGTGCCTGG - Intergenic
1088913441 11:114209430-114209452 GGCTCTGAATCCAGGCACCGGGG - Intronic
1089469213 11:118707363-118707385 GGCTGAGAAGCCTCAGATCGAGG - Intergenic
1090806138 11:130203479-130203501 GGCGCTGAAGCAAGAGATTGGGG - Intronic
1091799059 12:3313398-3313420 GGCTCTGCAGCCAGAATTCCTGG - Intergenic
1092509083 12:9134803-9134825 GGCTCTGCAGCCAGGGGTGGAGG + Intergenic
1092940198 12:13401024-13401046 GGCTTTGAAGACAGAGAAAGGGG + Intergenic
1093151863 12:15631174-15631196 GACTCTGGAGCCAGACATCCTGG - Intronic
1093684223 12:22038249-22038271 GGCTTTGAAGACAGAGAAAGGGG - Intergenic
1093924309 12:24893448-24893470 GGCTTTGAAGTCAGACATCCTGG - Intronic
1094023559 12:25939868-25939890 GGCTTTGAAGCCAGACTTCCTGG + Intergenic
1094324828 12:29225959-29225981 GGCTCTGGAGATAGAGATCCTGG + Intronic
1096456696 12:51793297-51793319 GGCTCTCAAGCCAGGAATCTGGG - Intronic
1096521111 12:52185288-52185310 GGCACTTAAGCCAGAGAAAGAGG - Intronic
1097147957 12:56954592-56954614 GGATCTGAAGCCAAAGATCCAGG + Intronic
1098414525 12:70217785-70217807 GGCTCAGAAGTCACAGATCAAGG - Intergenic
1099149742 12:79095636-79095658 GGCTCTAAAGGCAGAGATCTGGG + Intronic
1099329875 12:81270543-81270565 GACTATGAAGGCAGGGATCGTGG + Intronic
1100911056 12:99364002-99364024 GGCTCTGAAGCCAGCTTTGGAGG + Intronic
1101059081 12:100952201-100952223 GGCTCTCAAGCCAGACAGCTGGG + Intronic
1101446384 12:104739548-104739570 GGCTCTGCAGCCAGACAGCCTGG - Intronic
1101495935 12:105254135-105254157 GGGGCTGAAGCCAGAAATCTGGG + Intronic
1101589443 12:106112779-106112801 GGCACTGAAGCCAGGGAGCATGG + Intronic
1101860708 12:108480203-108480225 GGCCCTGAAGCCAGAGGACTGGG - Intergenic
1102028391 12:109726466-109726488 GGCTCTGCAGCCAGTGATCTGGG - Intronic
1102589253 12:113945318-113945340 GTCTCTGAAGCCAGAGGAGGGGG - Intronic
1103140569 12:118544564-118544586 GGTTCTGCAGCCAGAGAAAGGGG - Intergenic
1103157878 12:118702388-118702410 GGCTTTGAAGACAGAGGACGTGG + Intergenic
1103613664 12:122138982-122139004 TGCACTGAAGCCACAGACCGTGG + Intronic
1104967710 12:132516531-132516553 GGCACTGAAGACAGAAAACGTGG - Intronic
1105462271 13:20603437-20603459 GGCTCTGAAGCCAGATGCCTTGG + Intronic
1107586178 13:41850541-41850563 GGCTCTGAAGCCTGAGTTCATGG - Intronic
1108511099 13:51156508-51156530 GGCTCTGAAGACAGATTTCCTGG - Intergenic
1110442544 13:75541452-75541474 GGCTGTGAACCCAGAGATGTTGG - Intronic
1111490255 13:88962968-88962990 GACTCAGAAGTCAGAGATCAAGG + Intergenic
1112687781 13:101851388-101851410 AGGTCAGAAGCCCGAGATCGAGG - Intronic
1113496343 13:110732794-110732816 GGCCCTGAAGCCAGAGGACCTGG + Intergenic
1113894953 13:113758804-113758826 CCCTCTGAACCCAGAGATCAAGG + Intergenic
1115320031 14:32069807-32069829 GGTTCTGAAACCTGAGATAGTGG - Intergenic
1116177013 14:41484105-41484127 GGCTGAGAAGTCAGAGATGGAGG + Intergenic
1116797366 14:49406428-49406450 GGCTGGGAAGCCCGAGATTGAGG - Intergenic
1118717621 14:68571469-68571491 GGCTCTGAAGACAGAGAAAGGGG - Intronic
1118792988 14:69112872-69112894 GGCTCTGAAGCCATACTTCTTGG - Intronic
1119345824 14:73923415-73923437 GGCACTGAAGACAGGGAACGTGG - Exonic
1119395237 14:74321458-74321480 GGCTCTGGAGCCAGACATCCCGG - Intronic
1120186405 14:81397941-81397963 GGCTCTGGAGCCAGAGTGCTTGG - Intronic
1121322807 14:93002441-93002463 GGCTCTGGAGCCAGAGGCCCTGG - Intronic
1121359434 14:93243046-93243068 TGATCTGATGCCAGACATCGCGG - Exonic
1121734275 14:96206871-96206893 GGCTGGGAAGCCCGAGATCAAGG + Intronic
1122119083 14:99542328-99542350 GGCTCTTAAGCCAGTGCTCTTGG + Intronic
1122149660 14:99718100-99718122 GTCTCGCCAGCCAGAGATCGTGG + Exonic
1127877641 15:63124392-63124414 GGCGCTGAGGCAAGAGACCGAGG - Intronic
1127974510 15:63987276-63987298 GGCTCTGCAGCCAGAAGTTGAGG + Intronic
1128243261 15:66115911-66115933 GGCTCAGAAGTCTGAGATCCAGG - Intronic
1128542327 15:68544723-68544745 GGCTATGAAGGCAGAGACCTGGG - Intergenic
1129497531 15:75999582-75999604 GGCTGGGAAGCCAAAGATCAAGG - Intronic
1130103366 15:80910988-80911010 GGCTCTGGAGCCAGACTTCCTGG + Intronic
1130137420 15:81193134-81193156 GGCTCTGAAGCCAAAATTCCTGG - Intronic
1131152847 15:90057775-90057797 GGCCCTGAACCCAGAGATTCTGG + Intronic
1132089364 15:98935405-98935427 GTCTCTGAGGCCAGAAATGGAGG + Exonic
1133339536 16:5027620-5027642 GGCCCTGGAGCCAGAGCCCGGGG + Intronic
1134172405 16:11978324-11978346 GGCCCTGAGGCCAGACATCCTGG + Intronic
1134900964 16:17937538-17937560 GGCTCTGAAGCCAGACTTTCTGG - Intergenic
1135110727 16:19688828-19688850 GGCTCTGTAGGCAGAGCTGGTGG + Intronic
1135266352 16:21029605-21029627 GACTCTGGAGCCAGAGAGCCTGG - Intronic
1135404929 16:22190899-22190921 GGCTCTGAAGTCAGGGGGCGGGG - Exonic
1135463844 16:22668588-22668610 GGCTCTGGAGCCAGACTTCCTGG - Intergenic
1135808769 16:25568665-25568687 TCCTCTGAACCCAGAGATTGAGG - Intergenic
1135834942 16:25816744-25816766 GGCTACGAAGTCAGAGGTCGAGG + Intronic
1135888424 16:26334980-26335002 GGCTCTGAAGACCAAGACCGAGG + Intergenic
1136585988 16:31185127-31185149 GGCTATGAACCCAGAGGTCGTGG + Exonic
1136747352 16:32602646-32602668 AGCTGTGAAGCCAGTGATGGAGG - Intergenic
1137510772 16:49098097-49098119 AGCTCTGAAGCCACAGCTCTTGG + Intergenic
1137688995 16:50407324-50407346 GGCTCTGAAGCCAGACTTCCTGG - Intergenic
1138085072 16:54126110-54126132 GGCTCTGGAGCCAGAGTGCCTGG - Intergenic
1138289205 16:55832623-55832645 GACTCTGGAGCCAGAGTGCGTGG - Intronic
1139606694 16:68023677-68023699 GGGTCTGAAGTCATAGATCTGGG + Intronic
1141424361 16:83935672-83935694 GCCACTGAAGCAAGAGAGCGGGG + Intronic
1141606292 16:85155486-85155508 GGCTTGGCAGCCAGAGATCTAGG + Intergenic
1203049487 16_KI270728v1_random:861852-861874 AGCTGTGAAGCCAGTGATGGAGG - Intergenic
1142587357 17:981810-981832 GGCGCTGAGGCAAGAGACCGAGG + Intergenic
1142693252 17:1619717-1619739 GGCTCTGAAGTCAGGGAAAGAGG + Intronic
1143015308 17:3888413-3888435 GGCTCTGAAGCCAGGCAGCCAGG + Intronic
1143128992 17:4664250-4664272 GGCCCAGAAGCCTGAGATCTTGG + Intergenic
1143464401 17:7126283-7126305 GGCGCTGAGGCAAGAGACCGAGG + Intergenic
1144750942 17:17647561-17647583 GGCTCTGAAGCCAGTGGCCTGGG + Intergenic
1145991830 17:29083823-29083845 GGCTCTGAAGCTAGAGAGGGAGG - Intronic
1146281398 17:31547246-31547268 GGCTGGGAAGCCCAAGATCGAGG + Intergenic
1146286928 17:31580448-31580470 GGCTCTGAAGGCAAAGCTGGAGG - Intergenic
1146655746 17:34633881-34633903 GACTCTGAAGCCAGACAGCCTGG + Intronic
1146730988 17:35193854-35193876 GGCTCTCAAGGCAGAGAGTGAGG + Exonic
1146807688 17:35878397-35878419 GACTCTGAGGCTAGAGATGGAGG + Intronic
1146820086 17:35977874-35977896 GGTTCTGAGGCCAGAGAGAGAGG - Intronic
1147246512 17:39124639-39124661 GGCTCTGAAGGCAAAGACCTGGG + Intronic
1147420945 17:40321942-40321964 AGCTCTGCAGCCAGGGATGGGGG - Intronic
1148382125 17:47207452-47207474 GGCTCTGAAGGCAATGATCTGGG + Intronic
1148483079 17:47972937-47972959 GGCTCTGAAGCCACAAATCTGGG + Intronic
1148850296 17:50551370-50551392 GGCTCCAAAGCCAGACATGGCGG - Intronic
1150009653 17:61492036-61492058 GCCTCTTAAGCCAGAAATCCTGG + Intergenic
1150742824 17:67793216-67793238 GGCTCTGAAGCCAGATTTCCTGG - Intergenic
1150900531 17:69271417-69271439 GGCTCTGAAGCCAGTCAGCCTGG + Intronic
1151660545 17:75516023-75516045 GGCTCCGAAGCCAGGTTTCGAGG - Intergenic
1152597041 17:81242825-81242847 GGCTGCGAAGCCCGAGATCCAGG + Intergenic
1153519840 18:5941253-5941275 GGCTCTGAAGTCCAAGATCAAGG - Intergenic
1153658434 18:7305653-7305675 GCCTCTGAAGGCAGTGATTGAGG + Intergenic
1153940714 18:9974172-9974194 GGCTTTGAGGACAGAGACCGAGG - Intergenic
1155130676 18:22931777-22931799 GGCTCTGAAGTCAGACATCTGGG - Intronic
1156001171 18:32385752-32385774 GGCTCTGAAGCCACATATCCTGG + Intronic
1157568197 18:48694327-48694349 GGCTCTGGAGACAGAGAGCAGGG + Intronic
1157650403 18:49323673-49323695 GGCTGGGAAGTCAGAGATCCAGG - Intronic
1157717900 18:49901765-49901787 GGCTCTGGAGCCAGACAGCTGGG + Intronic
1158213098 18:55071819-55071841 GGCTCTGCATCCAGAGCTGGGGG - Intergenic
1159122247 18:64184678-64184700 GGCTGAGAAGTCAGAGATCAAGG + Intergenic
1160262555 18:77308455-77308477 GGCTCTGAAGTCAGACTTCCTGG + Intergenic
1161369596 19:3903314-3903336 GGCTCTGAAGCCCCAGATCCCGG + Intronic
1162121845 19:8475195-8475217 GGCTCTGGAGCCAGACAGCCTGG - Intronic
1162290402 19:9775783-9775805 GGTGCTGAAGCAAGAGACCGAGG + Intronic
1162397813 19:10427634-10427656 GTCTCTGAAGCCAGACAGCTGGG + Intronic
1162743808 19:12788177-12788199 TGCTCTGAAGCCAGACAGCTTGG + Intronic
1162847082 19:13401245-13401267 GGCTCTGCAGCCAGATTTCCTGG + Intronic
1163689592 19:18731364-18731386 GGCAATAAAGGCAGAGATCGGGG - Intronic
1164762080 19:30735773-30735795 AGCTCAGAAGCCAGAGAAGGAGG - Intergenic
1165352121 19:35281323-35281345 GGCACTGAAGGCAGAGATCAGGG - Intronic
1165357887 19:35315154-35315176 GCCTCCGAAGCCAGTGGTCGGGG - Intergenic
1165671294 19:37681490-37681512 GGCGCCGAGGCAAGAGATCGAGG - Intronic
1165722474 19:38089411-38089433 GGCTCTGAAGTCAGACACCCTGG - Intronic
1165846515 19:38821363-38821385 GGCTCTGAGGCCAGCGAGCAAGG - Intronic
1165996346 19:39846513-39846535 GGCTGGGAAGGCAGAGAGCGAGG - Intergenic
1166364413 19:42271255-42271277 GACTCTGGAGCCAGAGAGCCTGG + Intronic
1166645847 19:44531111-44531133 GGCTCTGGAGCCAGAGTGCATGG + Intergenic
1166885297 19:45956906-45956928 GACTCTGAAGCCAGACACCTGGG - Intronic
1167265762 19:48482526-48482548 CCCTCAGAAGCCAGAGACCGGGG + Intergenic
925055925 2:857346-857368 GGCTGTGAAGCCCAAGATCGAGG + Intergenic
925153212 2:1631404-1631426 GGCTCTGGGGCCAGAAGTCGGGG - Intergenic
926977697 2:18531749-18531771 GGCTCTAGAGCCAGAGACCTGGG - Intergenic
927928198 2:27027325-27027347 GGCTCTGAGCCCAGAGCTGGTGG - Intergenic
928245959 2:29627104-29627126 GGCTCTGAAGCCAGGGCTGACGG + Intronic
928300032 2:30116868-30116890 GGCCCTGAAGCCAGAGTCCTGGG + Intergenic
928307149 2:30179559-30179581 GGCTGGGAAGCCTGAGATCAGGG + Intergenic
928318473 2:30264379-30264401 GGCTTTGAAGACAGAGAAAGAGG + Intronic
929533121 2:42764510-42764532 GTCCCTGAAGCCAGAGCTGGTGG - Intergenic
930032475 2:47066927-47066949 GGCTGAGAAGTCAAAGATCGAGG + Intronic
932236089 2:70122158-70122180 GTGTCTGATGCCAGAGAACGTGG - Intergenic
933526676 2:83449582-83449604 GGCTTTGGAGCCAGTGATCCTGG - Intergenic
933783648 2:85820268-85820290 GGCTGTGAAGTCCGAGATCAAGG + Intergenic
934649685 2:96083775-96083797 GGCTCTGAGGCTAGAGAGGGAGG - Intergenic
935058946 2:99591772-99591794 CGCTCTGAAGCCAGACAGCCTGG + Intronic
935310801 2:101781450-101781472 GGCTGAGAAGCCAAAGGTCGAGG + Intronic
935802657 2:106714301-106714323 GTCTCTGAAGCCAGAGCTTAAGG - Intergenic
936786420 2:116098930-116098952 GGCCATGAAGTCAGAGATGGAGG + Intergenic
937318045 2:120944465-120944487 GACTCTGAAGTCACAGATCTAGG - Intronic
938991402 2:136633554-136633576 GGCTCTGAAGCCAGATCACTGGG + Intergenic
939430910 2:142106518-142106540 GGCCCTGAAGCCAAAGATTTAGG - Intronic
941938690 2:171009804-171009826 GGTTCTGAAGCCAGACAGCTAGG - Intronic
942601100 2:177642022-177642044 GGCTCTGGAGTCAGAGACCTGGG - Intronic
943505424 2:188750399-188750421 GGCTGTGAAGCCCAAGATCAAGG - Intronic
948398281 2:237663529-237663551 GGCTGTGAAGCCCAAGATCAAGG - Intronic
948610334 2:239162505-239162527 GGCTCTGGGGGCACAGATCGGGG + Intronic
948822614 2:240557694-240557716 GCCTCTGAAGCCAGCGCTCGAGG + Intronic
1169452277 20:5722207-5722229 GACTCTGAAGCCAGAGTTCATGG + Intergenic
1171475938 20:25408819-25408841 GGCTCTGGAGCCAGAGTGCCAGG - Intronic
1171888430 20:30680702-30680724 AGCTCTGAAGTCAGAGAGGGAGG - Intergenic
1172590621 20:36115245-36115267 GTCTCTGAAGCCAGACACCTTGG - Intronic
1173451723 20:43170419-43170441 GGCTCTGAAGCCAGACTTGTTGG - Intronic
1173542890 20:43867889-43867911 GGCTCTGAAGCCAGAGTACCTGG + Intergenic
1173758983 20:45543202-45543224 GAATGTGAAGGCAGAGATCGGGG + Intronic
1173904827 20:46618789-46618811 GGCACTGAAGCGAGAGACGGAGG - Intronic
1174097586 20:48101545-48101567 GGCTTTGAAGCCAGACTCCGTGG + Intergenic
1174160552 20:48547392-48547414 GGCTGGGAAGCCCAAGATCGAGG + Intergenic
1174208472 20:48858159-48858181 GGCTCTGAAGAATGAGATCCAGG - Intergenic
1174740769 20:53012036-53012058 GGCTTTGAAACCAGATATCGTGG - Intronic
1175113349 20:56664510-56664532 GGCGCTGAGGCAAGAGATGGTGG + Intergenic
1175180683 20:57144725-57144747 GGCTGGGAAGCCCAAGATCGAGG + Intergenic
1175202342 20:57286657-57286679 GGCTCTGAAGCCAGACTACCTGG + Intergenic
1175997466 20:62817995-62818017 GGCTCTGGAGCCAGCCATGGAGG + Intronic
1178231612 21:30791373-30791395 GGCTCTGAAGGGAGAAGTCGAGG + Intergenic
1178427665 21:32491915-32491937 AGCGCTGAAGGCAGAGATCCTGG + Intronic
1178624300 21:34202531-34202553 GGCTTTCAACCCAGAAATCGTGG + Intergenic
1180748135 22:18106052-18106074 GAGTCTGAAGCCTGAGATCCAGG + Intronic
1180830869 22:18905625-18905647 GGCGCTGAGGCAAGAGACCGAGG - Intergenic
1182021806 22:27087853-27087875 GGCTCTGGAGCCAGACTTCCTGG + Intergenic
1183186706 22:36295542-36295564 GGCTCTGAAAACAGAGTTGGAGG - Exonic
1183582058 22:38731991-38732013 TGCACTGAAGCCACAGATGGAGG + Exonic
1184276058 22:43410496-43410518 GGCCCTCAGGCCAGAGATGGGGG - Intergenic
1203280957 22_KI270734v1_random:130896-130918 GGCGCTGAGGCAAGAGACCGAGG - Intergenic
949931046 3:9078674-9078696 GATTTTGAAGCCAGAGATCTGGG - Intronic
950108356 3:10402638-10402660 GGCTCTGAAGCCAGACTGCCTGG - Intronic
950156752 3:10726782-10726804 GGCTCTGCAGTCAAAGATCCAGG - Intergenic
950260409 3:11539348-11539370 GTCTCTGAAGCCAGACTTCCAGG - Intronic
951546473 3:23831013-23831035 GGCCCTGAAGCCAGATCACGTGG - Intronic
951749143 3:26014314-26014336 GGTTGTGAAGCCAGAGGTGGTGG + Intergenic
953543115 3:43840121-43840143 GGCTTTGAAGTCAGAAATCCTGG + Intergenic
954822428 3:53341962-53341984 GGCTCTGAGGCCAGAGGTGGTGG - Intronic
955983036 3:64546541-64546563 GGCTCTGAAGCCAGACAGTCTGG - Intronic
956289670 3:67648285-67648307 GACCCTGAAGCCAGAGAGAGAGG + Intronic
956653086 3:71523134-71523156 GGAGATGAAGGCAGAGATCGAGG + Intronic
956703020 3:71975500-71975522 GGCTCTGAAGCCAGACTGCCTGG + Intergenic
957037666 3:75310111-75310133 GGCTCTGAAGCCAGACTGCATGG + Intergenic
958191172 3:90186774-90186796 GGCTCTGGTGACAGAGATCTAGG - Intergenic
958666186 3:97140496-97140518 ACCTTTTAAGCCAGAGATCGAGG + Intronic
959091835 3:101911423-101911445 GGGGCTGAAGCCAGAGAGCCAGG - Intergenic
960440075 3:117676015-117676037 AGCTTTGAAGCCAGAGATGTGGG + Intergenic
961085698 3:124065660-124065682 GGCTCTGAAGCCAGACTGCATGG + Intergenic
961251862 3:125513919-125513941 GGCTGGGAAGTCAGAGATCAAGG + Intronic
961628223 3:128278368-128278390 GTCACTGAAGCCAGAGATCTGGG - Intronic
961688299 3:128650566-128650588 GGCTTTGGAGCCTGAGCTCGAGG - Exonic
962853707 3:139326366-139326388 GGCTCGGAAGTCTGAGATCAGGG - Intronic
964497070 3:157302594-157302616 GGCTGGGAAGCCCGAGATCAAGG - Intronic
966170621 3:177076033-177076055 GGCTGTGAAGCCCAAGATCAAGG + Intronic
966809153 3:183827998-183828020 GGCCTTGAAGGCAGTGATCGCGG + Intergenic
967062502 3:185884599-185884621 GGCTCTGAAGTCTGAGAGAGAGG + Intergenic
967899270 3:194431850-194431872 GTCTCTGTGGCCAGAGATTGTGG - Exonic
968292646 3:197550661-197550683 GGCCCTGAAGCCACAGAGAGAGG + Intronic
969221129 4:5759413-5759435 GGCTCTGGAGCCAGACATCTGGG + Intronic
970676848 4:18460516-18460538 GGATCTGGAGCCAGACATCCTGG - Intergenic
971431317 4:26570936-26570958 GGCTCTGAAGTCCAAGATCAAGG + Intergenic
975196085 4:71525659-71525681 GGCTCTGAAGCCACAGGTTTGGG + Intronic
977159865 4:93620325-93620347 GTCTCTGAAGCCATAGATTTTGG + Intronic
977233212 4:94476760-94476782 GACTCTGGAGCCAGCCATCGTGG + Intronic
977609876 4:99020617-99020639 GGATCTGAAGCAAGGGATGGAGG - Intronic
977742534 4:100504373-100504395 GGCGCTGAGGCAAGAGACCGAGG + Intronic
978255092 4:106683332-106683354 GGCTTTGAAGTCAGAGAAAGAGG + Intergenic
979530914 4:121768236-121768258 GGCTCTGGAGCCAGACTTCCTGG - Intergenic
982763189 4:159313292-159313314 GACTCTGAAGCCAGAATTCCTGG + Intronic
983069516 4:163252482-163252504 GGCTCTGAAGCCAGAGAACGTGG + Intergenic
985950962 5:3220972-3220994 AGTTCTGAAGCCAGAGAGCTTGG - Intergenic
986150736 5:5128026-5128048 GGCTCTGAAACCAGATGTCCCGG - Intergenic
987631493 5:20478373-20478395 TGCCCTGAAGGCAGAGATCTAGG + Intronic
989675264 5:43965910-43965932 GGGTCTGAAGCCAGGGAGCCAGG - Intergenic
991168470 5:63592184-63592206 GGCTCTGGAGTCAGACATCTAGG - Intergenic
993938165 5:94027891-94027913 GCCTCTGAAACCACAGATTGAGG - Intronic
993969894 5:94406400-94406422 GGATCTAAAGCCAGAGATACTGG - Intronic
995652767 5:114389381-114389403 GGCTCTGAAGCCAGATTGCTTGG + Intronic
995984659 5:118155255-118155277 GTCTCTGAAGTTAGAGATCTTGG + Intergenic
996321600 5:122222875-122222897 GACTCTGAAGCCTGGGATGGCGG - Intergenic
996534984 5:124568401-124568423 GGCTGAGAAGCCTGATATCGAGG - Intergenic
996848589 5:127928387-127928409 GGCTCTGAACACAGAGACAGGGG - Intergenic
997998416 5:138604963-138604985 GGCTCTGAAGCCAGTGGGCCTGG - Intergenic
999183513 5:149688079-149688101 GGCTCTGGAGCCAGAATTCTTGG + Intergenic
999200631 5:149813795-149813817 GGCTGGGAAGCCTAAGATCGAGG + Intronic
999817675 5:155193672-155193694 GGCTCTGCAGCCAGAGCACCTGG - Intergenic
1001709946 5:173770247-173770269 GGCTCTGAAGCCAGACTGCCTGG + Intergenic
1001833446 5:174809189-174809211 GGTTCTGAAGTCAGAGAGTGTGG - Intergenic
1002184591 5:177448116-177448138 GGATCTGAAGCCCGCGGTCGGGG - Intronic
1002540411 5:179902833-179902855 GGCTCTGAAGCCAGAGATCGGGG + Intronic
1004281030 6:14280166-14280188 GGCTGAGAAGCTAGAGATCAGGG + Intergenic
1006375530 6:33669830-33669852 GGCTCTGGAGCCAGATAGCCTGG - Intronic
1007272478 6:40648980-40649002 GTCTCTGGAGCCAGAGATCCAGG + Intergenic
1007374501 6:41447048-41447070 GACTCTGGAGCCAGACAGCGTGG + Intergenic
1009593415 6:65704381-65704403 GGCTCTGAAGTCAGACACAGTGG - Intronic
1009932549 6:70193478-70193500 GGGTGTGAAGCCAGAGACCTGGG - Intronic
1010135525 6:72548235-72548257 GGCTCTGAAATAAGAGGTCGTGG + Intergenic
1011060116 6:83256080-83256102 GGCTCTGGAGTCAGAGCTCCTGG + Intronic
1011062419 6:83286124-83286146 GGCTCTGGAGCCAGAGAGTCTGG + Intronic
1012627845 6:101426181-101426203 GGCTCTGGAGCCAGACCTCTGGG + Intronic
1013020125 6:106206338-106206360 GGCTGGGAAGTCAGAGATCAAGG - Intronic
1013059353 6:106617127-106617149 GGCTGGGAAGCCTGAGATCAAGG - Intronic
1013776719 6:113687131-113687153 GGCTTTGAAGCCAGAGGAAGGGG - Intergenic
1013819236 6:114135130-114135152 GGCTCTGAAGAAAGAGCTCATGG - Intronic
1014528344 6:122528454-122528476 GGCTGGGAAGTCAGAGATCAAGG + Intronic
1016474265 6:144409518-144409540 ATCTCTGAAGCTAGAGATGGTGG - Intronic
1016628665 6:146201868-146201890 GACTCTGGAGCCAGACATTGTGG - Intronic
1019059229 6:169243233-169243255 CCCTCTGAAGCCCTAGATCGTGG + Intronic
1019417803 7:935296-935318 GCCTCTGGAGCCAGAGATGCCGG - Intronic
1020535471 7:9390979-9391001 TGCTCTGAAGCTAGAGGACGGGG - Intergenic
1022093531 7:27123745-27123767 GGCTCCGAAGCCAGGGGTCAGGG - Intronic
1022407178 7:30101383-30101405 GGCTGGGAAGTCTGAGATCGTGG + Intronic
1022525575 7:31034965-31034987 GGCTCTGAACACAGAGGTGGAGG + Intergenic
1022538441 7:31113216-31113238 GGCTGTGAAAACAGAGATTGTGG + Intergenic
1022620552 7:31979596-31979618 GGCTCTGGAGCCAGACTGCGTGG - Intronic
1023583654 7:41706740-41706762 AGCTCAGAATCCAGAGAACGTGG + Intergenic
1026020057 7:66699160-66699182 GGTGCTCAAGCCAGAGCTCGGGG - Intronic
1026382865 7:69816910-69816932 GGCTTTGAAGCCAGACAGCTGGG + Intronic
1026735529 7:72946339-72946361 GCGGCTGAAGCCAGAGATCCGGG - Intronic
1026785867 7:73301269-73301291 GCGGCTGAAGCCAGAGATCCGGG - Intergenic
1027108197 7:75418669-75418691 GCGGCTGAAGCCAGAGATCCGGG + Exonic
1027540234 7:79455592-79455614 GGATCTGAAGCCAGAGCTGCAGG + Intergenic
1028175334 7:87650348-87650370 GGCTGGGAAGGCTGAGATCGGGG + Intronic
1028637105 7:93001527-93001549 GTTTCTGAAGCCAGAAATGGTGG + Intergenic
1031179647 7:118398044-118398066 GGCTCTGAAGCCGGATCTCCCGG + Intergenic
1034930173 7:155155202-155155224 GGCTGTGAAGCCCAAGATCGTGG - Intergenic
1035210035 7:157320854-157320876 GGCTCTGAGCCCAGAGTTCTGGG - Intergenic
1036741010 8:11361735-11361757 GTCTCTGAATACAGAGATCGGGG - Intergenic
1036996145 8:13659183-13659205 GGCTCTGGAGCCAGAAGTCTCGG - Intergenic
1039018056 8:33175010-33175032 GGCTCTGAAGCCACACAGCCAGG + Intergenic
1039589067 8:38731269-38731291 GGCTCTGTAGCCAGAGTGCCTGG + Intronic
1039776636 8:40743851-40743873 GGCTGTGGAGCCACAGATCACGG + Intronic
1041015160 8:53585661-53585683 GGCTCTGAAGCCAGACTGCCTGG - Intergenic
1041145407 8:54870897-54870919 GGCTCTGAAGTCAGACTTCTAGG - Intergenic
1041743933 8:61185697-61185719 GGTTCTGGAGCCAGAAATCTTGG + Intronic
1041754669 8:61300839-61300861 GTCTCTCAAGCCAGAAATCCAGG + Intronic
1044884441 8:96761593-96761615 GGCTCTGCAGTCACAGATCTGGG + Intronic
1045431879 8:102122775-102122797 GGCTCTGCAGCCAGACAGCCGGG - Intronic
1045500835 8:102743240-102743262 GGCTTTGAAGCCCAAGATGGTGG + Intergenic
1047806376 8:128365010-128365032 GGCTGTGAAGCCCAAGATCAAGG - Intergenic
1047880276 8:129185410-129185432 AGCTCTGGAGCCAGAGAGCTTGG + Intergenic
1048021873 8:130546883-130546905 GGGTATGAAGCCAGAGAGGGAGG + Intergenic
1048831596 8:138482774-138482796 GGCTCTGAAGCCAGAAAACTGGG - Intronic
1049368358 8:142251734-142251756 GGCCCTGCAGACAGAGATCGCGG - Intronic
1049368370 8:142251778-142251800 GGCCCTGAAGACAGAGAACGTGG - Intronic
1049368394 8:142251866-142251888 GGCCCTGAAGACAGAGAATGCGG - Intronic
1049368405 8:142251910-142251932 GGCCCTGCAGACAGAGAACGCGG - Intronic
1049368417 8:142251954-142251976 GGCCCTGAAGACAGAGAACATGG - Intronic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1049958604 9:716186-716208 GGCTCTGAAGCTAGACAGTGTGG + Intronic
1050772626 9:9221486-9221508 GGCTGGGAAGCCTGAGATCAAGG + Intronic
1055834883 9:80427633-80427655 GACTCTGAAGTCAGAGGTCAAGG + Intergenic
1057016389 9:91656427-91656449 GGCTCAGAAGACAGAGACTGAGG + Intronic
1058643966 9:107113363-107113385 GGCTCTGAAGTCAGATAACATGG - Intergenic
1059081583 9:111255831-111255853 GGCTGGGAAGCCTGAGATCAAGG - Intergenic
1059283309 9:113152504-113152526 GGTTCTGAAGCCAGAGAAGCAGG - Intronic
1061621989 9:131816517-131816539 GGCTCTGAATCCAGAGGCGGGGG + Intergenic
1062070964 9:134554784-134554806 GGCTCTGCAGCCAGCCATGGAGG + Intergenic
1062183986 9:135206798-135206820 GGCGCTGAGGCAAGAGACCGAGG - Intergenic
1187294605 X:17986572-17986594 GGCTTTGAAGCCAGAGCACTTGG - Intergenic
1187424163 X:19162111-19162133 GGCTCTGAAGCCAGATTGCTTGG + Intergenic
1188485127 X:30674233-30674255 GGCTCTGAGGCCAGATAGCTGGG - Intronic
1189368745 X:40411022-40411044 GGCTCTGGAGCCAGACAGCTGGG - Intergenic
1191977629 X:66891074-66891096 GGTTCTGGAGCCAGACATCCTGG - Intergenic
1194470525 X:94289626-94289648 GGCTCTGAAGTCAGACTTCCAGG + Intergenic
1194964792 X:100275371-100275393 GGCTCTGAAGCCAGACTGCTTGG + Intergenic
1195294558 X:103463163-103463185 GGCTCTGAAGCATGACATCCTGG - Intergenic
1195854320 X:109313896-109313918 GGCTCTGAAGCCCAAGATCAAGG + Intergenic
1196211934 X:113005579-113005601 GGCTCTGGAGTCAGACATCTTGG + Intergenic
1196514128 X:116549511-116549533 GGCTGTGAAGCCCAAGATTGAGG - Intergenic
1196553909 X:117064070-117064092 GGCTGTGAAGTCAAAGATCAAGG - Intergenic
1196651244 X:118170517-118170539 GACTCTGAAGCCAGACAGCTTGG - Intergenic
1196846312 X:119899267-119899289 GGCTGTGAAGCCAGACACTGTGG + Intronic
1198399766 X:136257327-136257349 GGCTCTGTAGCCAGAGTGTGAGG - Intergenic
1200684238 Y:6245464-6245486 AGCTCAGAAGCCAGAGGCCGAGG + Intergenic
1201048395 Y:9908922-9908944 AGCTCAGAAGCCAGAGGCCGAGG - Intergenic