ID: 1002541484

View in Genome Browser
Species Human (GRCh38)
Location 5:179908828-179908850
Sequence TGGACTGGCGCTGCCCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002541484_1002541489 0 Left 1002541484 5:179908828-179908850 CCTGCAGGGGCAGCGCCAGTCCA No data
Right 1002541489 5:179908851-179908873 CACACAGCCTTCTGCATGAGGGG No data
1002541484_1002541488 -1 Left 1002541484 5:179908828-179908850 CCTGCAGGGGCAGCGCCAGTCCA No data
Right 1002541488 5:179908850-179908872 ACACACAGCCTTCTGCATGAGGG No data
1002541484_1002541487 -2 Left 1002541484 5:179908828-179908850 CCTGCAGGGGCAGCGCCAGTCCA No data
Right 1002541487 5:179908849-179908871 CACACACAGCCTTCTGCATGAGG No data
1002541484_1002541494 26 Left 1002541484 5:179908828-179908850 CCTGCAGGGGCAGCGCCAGTCCA No data
Right 1002541494 5:179908877-179908899 GTCAACTCCACCTGGGACAACGG No data
1002541484_1002541492 18 Left 1002541484 5:179908828-179908850 CCTGCAGGGGCAGCGCCAGTCCA No data
Right 1002541492 5:179908869-179908891 AGGGGGCTGTCAACTCCACCTGG No data
1002541484_1002541493 19 Left 1002541484 5:179908828-179908850 CCTGCAGGGGCAGCGCCAGTCCA No data
Right 1002541493 5:179908870-179908892 GGGGGCTGTCAACTCCACCTGGG No data
1002541484_1002541495 27 Left 1002541484 5:179908828-179908850 CCTGCAGGGGCAGCGCCAGTCCA No data
Right 1002541495 5:179908878-179908900 TCAACTCCACCTGGGACAACGGG No data
1002541484_1002541490 1 Left 1002541484 5:179908828-179908850 CCTGCAGGGGCAGCGCCAGTCCA No data
Right 1002541490 5:179908852-179908874 ACACAGCCTTCTGCATGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002541484 Original CRISPR TGGACTGGCGCTGCCCCTGC AGG (reversed) Intergenic
No off target data available for this crispr