ID: 1002543361

View in Genome Browser
Species Human (GRCh38)
Location 5:179921264-179921286
Sequence TAGGGTAGAAAGAAGGGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 437}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002543361_1002543366 -8 Left 1002543361 5:179921264-179921286 CCCTTGCCCTTCTTTCTACCCTA 0: 1
1: 0
2: 3
3: 50
4: 437
Right 1002543366 5:179921279-179921301 CTACCCTACTCCTATTGCCAGGG No data
1002543361_1002543365 -9 Left 1002543361 5:179921264-179921286 CCCTTGCCCTTCTTTCTACCCTA 0: 1
1: 0
2: 3
3: 50
4: 437
Right 1002543365 5:179921278-179921300 TCTACCCTACTCCTATTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002543361 Original CRISPR TAGGGTAGAAAGAAGGGCAA GGG (reversed) Intronic
901469546 1:9446744-9446766 CAAGGTAGGAAGAAGGGGAAGGG - Intergenic
901748483 1:11390514-11390536 GAGAGGAGAAAGAAGGGCAGAGG + Intergenic
902145221 1:14392943-14392965 TAGAGCAGAAAGAAAGCCAAAGG - Intergenic
902185372 1:14720982-14721004 CAGGGTACAAACAAGGGCAGGGG - Intronic
902564943 1:17305310-17305332 TAGGGAAGAGAGAAGGCCGAGGG - Intergenic
902748059 1:18486423-18486445 TGGGGTAGGAAGAAGGACAGGGG + Intergenic
903755434 1:25657327-25657349 CTGGGGAGAAGGAAGGGCAAGGG + Intronic
904785966 1:32983261-32983283 AAGGGCAGAGAGAAGGGCAAGGG + Intergenic
905055520 1:35090264-35090286 TAGGGTGGCAGGAAGGGAAAGGG + Intronic
905290565 1:36919133-36919155 TGGGGTAGAAAAATGGGTAAGGG + Intronic
905520950 1:38599210-38599232 TAGAGAAGAAAGCAGGGTAAAGG - Intergenic
905749009 1:40445448-40445470 TATGGTAGAAGGAAGGGACAGGG + Intergenic
906495230 1:46301012-46301034 TAGGGGAGGGAGAAGGGGAAAGG + Intronic
906711546 1:47934022-47934044 GAGGGTAGAAAGAAGGGGTTGGG + Intronic
907809250 1:57852076-57852098 CAGGGGAGAAAGAAGAGGAAGGG - Intronic
908440135 1:64145282-64145304 TATGGAACAAAGAAGGGGAAGGG + Intronic
908661640 1:66443581-66443603 AAGGGTAGAAAGTGGGGCAAGGG - Intergenic
908706802 1:66966176-66966198 TGGGGTGGGGAGAAGGGCAAGGG - Intronic
910310575 1:85819809-85819831 AAGGGTAGGATGAGGGGCAAGGG - Intronic
911372967 1:97016220-97016242 TAAGCTTGAAAGAAGGGCACAGG - Intergenic
911671643 1:100614764-100614786 CAGGGCAGCAAGAAGGACAAGGG + Intergenic
911960480 1:104296008-104296030 AAGGGAAGAATGAAGGGAAAGGG + Intergenic
911998338 1:104796541-104796563 TAGAGTAGAAATAAGTGAAATGG - Intergenic
912443728 1:109717517-109717539 GAGAGTAGAAAGAAGGAAAAAGG - Exonic
912624799 1:111198061-111198083 GAGGGTGGAGAGGAGGGCAAAGG + Intronic
914811949 1:151035455-151035477 TGGGGTAGGAAAAAGGGGAAAGG - Exonic
914987076 1:152470063-152470085 TAAGGAAGAAAGAAGACCAAGGG - Intergenic
915594203 1:156887253-156887275 GAGGGAAGAAAGAAGGGAGAGGG - Intergenic
915943284 1:160132483-160132505 TAGGGCAGAAACAAAGGGAATGG + Intronic
916061340 1:161100651-161100673 CAGGGTAGAAAAAAATGCAAAGG + Exonic
916126533 1:161576473-161576495 CAGGGGAGAAGGAAGGGTAAAGG - Intergenic
916136452 1:161658313-161658335 CAGGGGAGAAGGAAGGGTAAAGG - Intronic
916180125 1:162076213-162076235 GAGGGTAGACAGCAGGACAAGGG - Intronic
916650822 1:166832745-166832767 AAGGGAAGAATGAAGGGAAAGGG + Intergenic
917216500 1:172683782-172683804 GAGGGTAGAAAGTAGGAGAAGGG - Intergenic
918163824 1:181925479-181925501 GAGTGGTGAAAGAAGGGCAAAGG - Intergenic
920125855 1:203693234-203693256 TAGGGCAGAAAGAATTGGAATGG + Intronic
921114938 1:212081151-212081173 TAGGAAAGGGAGAAGGGCAAGGG + Intronic
921285727 1:213607588-213607610 TATGGGAGAAAGAAGGCCAGAGG + Intergenic
921588846 1:216980038-216980060 TTGGGTAGAAAGAAAAGAAAGGG - Intronic
922446353 1:225701103-225701125 TAAGGTAGGAAGAAGGGGACAGG + Intergenic
922550596 1:226491430-226491452 TAGGCAAGAAAGATGGGGAAAGG + Intergenic
922579026 1:226683288-226683310 TAGGGGAGAAAGGAGAGAAAAGG - Intronic
923051323 1:230393097-230393119 AAGGGGAAAAAGAAGGGGAAGGG + Intronic
923805340 1:237251491-237251513 TAAGGTAGAAAGAAAGTCAGGGG - Intronic
923897303 1:238285803-238285825 GAGGGTAGAAAGGAGGATAAAGG - Intergenic
923930538 1:238690269-238690291 TAGGGGAAAAAGAAGGTTAAGGG - Intergenic
924011757 1:239672639-239672661 TAGGGGAGAAAGAATGGGAAAGG + Intronic
924064007 1:240205759-240205781 TTGAGTAGAAAGAAGGGCATTGG - Intronic
924368290 1:243319884-243319906 TAGGGAGGAAAGAAGAGCAAAGG - Intronic
1063369586 10:5512449-5512471 TAGGGAGGAAATAAGGGAAACGG - Intergenic
1063799706 10:9560503-9560525 GAGGGTAGAGATCAGGGCAAAGG + Intergenic
1064322390 10:14317796-14317818 TTGGGAAAAAAGAAGGCCAAAGG + Intronic
1064450090 10:15434392-15434414 GAGGGAAGAAAGGAGGGAAATGG - Intergenic
1064715670 10:18174225-18174247 GAGGGGAGAAGGAAGGGGAAGGG - Intronic
1064921151 10:20519932-20519954 AAGGGTAGAAAGGAGGGGAAGGG - Intergenic
1066413163 10:35193345-35193367 AAGGAAAGAAAGAAGGGAAATGG - Intronic
1067720306 10:48723127-48723149 GAGGGTGGAAAGGAGGGAAAAGG - Intronic
1068470587 10:57457261-57457283 GAGGCTAGAAAGCATGGCAAAGG - Intergenic
1068650839 10:59520619-59520641 GAGAGGAGAAAAAAGGGCAAGGG + Intergenic
1068846425 10:61680868-61680890 CAGGGAAGAAAGAAGGGGAAGGG + Intronic
1069364434 10:67682381-67682403 TTATGTAAAAAGAAGGGCAATGG + Intronic
1070441162 10:76444757-76444779 TAGGCCAGGAAGAAGGACAATGG + Intronic
1071422543 10:85515191-85515213 TAGGATTGCAAGAAGTGCAAAGG + Intergenic
1071727372 10:88213049-88213071 CAGGGTAGAATGCAGGGCGATGG - Intergenic
1071738704 10:88331923-88331945 GAGGGGAGAAAGATGGGAAAGGG + Intronic
1071954630 10:90744302-90744324 TAGGGTAGAAAGATGAGTAAGGG - Intronic
1073477706 10:103765236-103765258 GAGGGTGGAACGCAGGGCAAAGG - Intronic
1073628582 10:105124435-105124457 CAGGGAAGAAGGAAGGGCATTGG + Intronic
1074048894 10:109865085-109865107 TAGGGAAGAAGGAAAGGAAAGGG + Exonic
1074255956 10:111802874-111802896 TAAGATAAAAAGAATGGCAAAGG + Intergenic
1074335336 10:112568806-112568828 AAGGGTAGAAAGGTGGTCAAAGG - Intronic
1074617931 10:115088998-115089020 TAGGATAAAAATAAGGGGAATGG - Intergenic
1075507061 10:123033085-123033107 TGGGCTAGAAAGGAGGACAAAGG - Intronic
1076453722 10:130575078-130575100 GAGGGAAGAAAGGAGGGGAAGGG - Intergenic
1077675411 11:4190216-4190238 TAGGGTAGAAATATGAGGAAGGG + Intergenic
1077706397 11:4490303-4490325 TAGGCTATAAAGAGTGGCAAAGG - Intergenic
1078149503 11:8746700-8746722 TAGGGCAGAAAGAAAGACCAGGG + Intronic
1078664867 11:13316029-13316051 TAAGGTAGAGAAAAGGGCAAAGG - Intronic
1078866158 11:15299281-15299303 TAGATTAGAAATAGGGGCAATGG + Intergenic
1080425894 11:32154025-32154047 CAGGGCAGGAAGAAGGTCAATGG + Intergenic
1080474508 11:32577090-32577112 CAAGGTAGGAAGAAGGGGAAAGG + Intergenic
1083176393 11:60952474-60952496 ACGGGTAGAAAGAAGTGGAAAGG + Intronic
1083668285 11:64286798-64286820 TAGAGAAGCCAGAAGGGCAAGGG - Exonic
1083826896 11:65209044-65209066 TTGGGTAGAAAGATGGGGCAGGG - Intronic
1084148064 11:67275477-67275499 TTGGGCAGGAAGAAGGGGAAGGG - Intronic
1084330933 11:68429832-68429854 TAGAAAAGAAAGGAGGGCAAAGG - Intronic
1084705373 11:70813280-70813302 TAGTGCAGAGAGAAGGGCAAGGG + Intronic
1086054755 11:82633519-82633541 TGGTGTAGAAAGAAAGGCACTGG - Intergenic
1086156998 11:83678516-83678538 GAGGGTAGGAAATAGGGCAAGGG - Intronic
1086171759 11:83844237-83844259 TAGGGTAAAAAAAAGGGCCTGGG + Intronic
1086959794 11:92970058-92970080 TAGGTTAGAGTGAAGGGAAAGGG - Intronic
1087479680 11:98683496-98683518 TAGGGCAGAAAGAAATGGAACGG - Intergenic
1088713596 11:112529398-112529420 TAGAGAAAAAAGAAGGGGAAAGG + Intergenic
1088741414 11:112770427-112770449 AAGGGCAGGAAGAACGGCAATGG - Intergenic
1088802901 11:113322756-113322778 TAGGTGAGATAGCAGGGCAAGGG + Intronic
1089710293 11:120309714-120309736 TATAGTATAAAGAAGGGCGAGGG + Intronic
1089970139 11:122686681-122686703 TAGGGTAGGAAGAAGAGACAGGG - Intronic
1090410887 11:126508897-126508919 GAGAGAAGAGAGAAGGGCAAGGG - Intronic
1090440732 11:126723292-126723314 TGGAGTAGAATGAAAGGCAAAGG + Intronic
1091192653 11:133707596-133707618 AAGGGAAGAAAAAAGGGGAAGGG + Intergenic
1091545077 12:1496178-1496200 GAGGGTAGAAAGAAGGAAAAAGG - Intergenic
1091796576 12:3300731-3300753 CAGGGGAGAAAACAGGGCAAGGG + Intergenic
1092318176 12:7441083-7441105 TAGGGTAGTGAGTAGGGGAAAGG + Intronic
1092607125 12:10132795-10132817 CAGGGCAGAAAGACGGGGAAAGG - Intergenic
1092846426 12:12589454-12589476 CTGGGTAGAAGGAAGGACAAAGG + Intergenic
1093249954 12:16790326-16790348 TGGGGTAGAAAGCAGGGCAATGG - Intergenic
1093577470 12:20750220-20750242 TAGGGTAGAAGGAGTGGCAGTGG + Intronic
1093604624 12:21074649-21074671 AAAGGTAAAAAGAAGTGCAAAGG + Intronic
1093816737 12:23558151-23558173 TGGGAAGGAAAGAAGGGCAATGG - Intronic
1094039510 12:26108271-26108293 ACTGGCAGAAAGAAGGGCAAGGG + Intergenic
1094636036 12:32227663-32227685 TGGGGTAGCCAGGAGGGCAAAGG + Intronic
1095490245 12:42725884-42725906 TGAGGAGGAAAGAAGGGCAAGGG + Intergenic
1095523817 12:43101072-43101094 GTGGGCAGAAAGAAGTGCAAAGG + Intergenic
1095824735 12:46519369-46519391 TAGAGAAGAAAGAAGAGAAAGGG - Intergenic
1095870244 12:47018714-47018736 TATGGTAGAAAGGAGGCCACAGG + Intergenic
1096784867 12:54011014-54011036 TAGAGTAGGAAGAGTGGCAAAGG + Intronic
1096880788 12:54668168-54668190 GCGGGAAGAAAGAAGGGAAATGG - Intergenic
1097250964 12:57632166-57632188 GAGGGAAGAAGGGAGGGCAAGGG + Intronic
1097995487 12:65883171-65883193 TAGGGGTGAAAGAAGAGGAAAGG + Intronic
1098099830 12:67003188-67003210 TTGGGTAGAAAGAAGGGCGTTGG - Intergenic
1099682885 12:85850186-85850208 GAGGGGAGAGAGAGGGGCAAGGG - Intergenic
1100390972 12:94146629-94146651 GAGGGGAGGAAGAAGGGGAAAGG - Intergenic
1100817490 12:98399935-98399957 TAGGGAGAAAAGAAGGGCAGGGG + Intergenic
1101450455 12:104772820-104772842 AAGGGCAAAAAGAAGGGGAATGG - Intergenic
1102615770 12:114152750-114152772 AAGGGAAGACAGAAGGGCTAGGG + Intergenic
1102704378 12:114868519-114868541 TAGGGCAGACAGAAGGGAAGAGG + Intergenic
1103020789 12:117532391-117532413 GAGGGAAGCAAGAAGGTCAAAGG - Intronic
1103277243 12:119722793-119722815 GAGGGAAGAAAGAAGGACAAAGG - Intronic
1103624010 12:122205100-122205122 GAGGGGAGAAAGAAGGGAGACGG - Intronic
1103986391 12:124770227-124770249 CAGGATAGAAAGAAGAGCAGGGG - Intergenic
1104612545 12:130241284-130241306 TAGGGCAGAAGGAAAAGCAAAGG + Intergenic
1105477527 13:20740953-20740975 TAGCATAGAAAGAAGGAAAAAGG - Intronic
1106220080 13:27739468-27739490 TATGGAAGAAAGAAGGAGAATGG - Intergenic
1106364849 13:29068666-29068688 TAGTGTAGTACGAAGGGCAAAGG + Intronic
1107725940 13:43299336-43299358 TAAGGTAGAAACTAGGGAAAGGG - Intronic
1107938935 13:45367423-45367445 TAAGGTAGAAAGAGGAGAAATGG + Intergenic
1108072411 13:46641808-46641830 TAGGGTAGAAAAACAGTCAATGG - Intronic
1108567717 13:51717524-51717546 TATGGTAGATAGAAGGCTAAAGG + Intronic
1108743331 13:53362171-53362193 GAGGGTAGCAAGAACGGAAAAGG - Intergenic
1108808311 13:54187057-54187079 TAGGGAAGAATAAAGGGAAAAGG + Intergenic
1109015457 13:57006595-57006617 TAGGGAAGAAAGAATTGAAATGG - Intergenic
1109092310 13:58063918-58063940 TGAGGAAGAAAGAAGGGCAGGGG + Intergenic
1109176851 13:59167670-59167692 AAGGGAAGAATGAAGGGAAAGGG - Intergenic
1109520794 13:63507748-63507770 AAAGGTGGAAAGAAGGGCTAGGG + Intergenic
1109966445 13:69704275-69704297 TAAGGTAAAAAGAAGGGTCAAGG - Intronic
1110087805 13:71404416-71404438 GAAGGTAGAAATAAGGGCAAGGG - Intergenic
1110356225 13:74570964-74570986 AAGGGGAGAAAGAAGAGCAAGGG + Intergenic
1111351804 13:87041201-87041223 TAGGGAAAAATGAAGGGAAAGGG - Intergenic
1111472424 13:88700428-88700450 CAGGGCAGAAAGAAGTGAAATGG - Intergenic
1111552769 13:89837332-89837354 TGGAGTAGACAGAAGAGCAAAGG + Intergenic
1111919693 13:94397152-94397174 TAGAGAGGAAAGAAGGGCATTGG + Intronic
1112222832 13:97508603-97508625 GGGGGAAGAGAGAAGGGCAAGGG - Intergenic
1112406072 13:99121588-99121610 TAGGGTAGAAATTAATGCAATGG + Intergenic
1112989708 13:105497273-105497295 TAAGGTAGAAAAAATGACAATGG + Intergenic
1114553645 14:23549004-23549026 TATGGTACAAAGAAGGTAAATGG - Intronic
1115062250 14:29207125-29207147 TAGGGTAGTAACAATGGAAATGG + Intergenic
1115123985 14:29971189-29971211 TAGGGGAGCCAGAAGGGCGATGG + Intronic
1116609692 14:47052221-47052243 TAGAAAAGAAAGAAGGGCACAGG + Intronic
1116877589 14:50128288-50128310 TAGGAAAGAAAGAAGGGAAAGGG + Intronic
1116898584 14:50340507-50340529 AAGGGTAGAGAGAAAGGAAAGGG + Intronic
1118825779 14:69379719-69379741 TAGGGAAGCTATAAGGGCAAGGG - Intergenic
1119529644 14:75350780-75350802 TAGGGGAGAGAGAAGGGCAAAGG + Intergenic
1119719929 14:76883734-76883756 TCAGGAAGAAAGAAGGGCAGGGG + Intergenic
1121991967 14:98567045-98567067 GAGAGAAGAAAGAAGGGAAATGG - Intergenic
1123955475 15:25330067-25330089 ATGGGTAGAAAGGAGTGCAATGG + Intergenic
1123971230 15:25509735-25509757 GAGGGGAGAGAGAAGGGCCAGGG + Intergenic
1124038640 15:26080158-26080180 TAGGGTTGAAAGAACAACAAAGG + Intergenic
1124227846 15:27911036-27911058 TAAGGTAGAAAGATGAGCAAAGG + Intronic
1124556510 15:30730958-30730980 CAAGGCAGAAAGAAGGGGAAAGG + Intronic
1124992224 15:34686584-34686606 TTGGATGGAAAGAAAGGCAAGGG - Intergenic
1125485121 15:40106154-40106176 TATGGTAGGAAGAAGGGAAGGGG - Intronic
1126729374 15:51666495-51666517 TAGTGCAAAAAGAAGGGAAAGGG + Intergenic
1127232341 15:57010482-57010504 AAGAGTAGAAAAAAGGGAAAAGG + Intronic
1128542117 15:68543502-68543524 CAGGGTAGAAAGATGGGGATTGG - Intergenic
1128885151 15:71279867-71279889 TGGGGTAGCAGGAAGAGCAATGG + Intronic
1130301883 15:82686318-82686340 TAGGATTGAAAGAAGGGAGAAGG + Intronic
1130314523 15:82783813-82783835 TAGGGGAGAAATGAAGGCAAAGG + Intronic
1130800333 15:87255932-87255954 CAGGGTAGAAAGAGGGGAAAAGG + Intergenic
1130916268 15:88307480-88307502 GAGGGTGGAAAGAGGGGCAGAGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1134394173 16:13847836-13847858 TAGAGTAGAAAGTAGGGCGTTGG - Intergenic
1135088122 16:19490910-19490932 GAAGGGAGAAAGAAGGGGAAGGG - Intronic
1135902670 16:26477960-26477982 TGTGGAAGAAAGAAGGGCACAGG + Intergenic
1135928857 16:26719492-26719514 AAGGGTTGAGAGAAGGGGAAAGG - Intergenic
1136124914 16:28171900-28171922 TAGAGGAGAAAGAAAGGAAAAGG - Intronic
1136640645 16:31562277-31562299 TAGGGTTGGAAGGAGTGCAAAGG + Intergenic
1138731777 16:59203274-59203296 TAGTGACCAAAGAAGGGCAATGG + Intergenic
1139483696 16:67244805-67244827 TAGGGCAGAAATAAGAGGAAGGG - Intronic
1141354083 16:83327028-83327050 TAGGGTTGTAAGAATGGCAGAGG + Intronic
1141354192 16:83328197-83328219 TAGGGTTGTAAGAATGGCAGAGG + Intronic
1141921483 16:87138560-87138582 CAGAGGAGACAGAAGGGCAAAGG + Intronic
1143577818 17:7804934-7804956 TAGGGATGAAAAAAGGACAAGGG - Intronic
1144110483 17:12026626-12026648 TAGAGTAGTAAGAGGAGCAAAGG - Intronic
1144283538 17:13750447-13750469 TAGGGGATGAAGAAGGGCAGAGG - Intergenic
1144448489 17:15354536-15354558 TTGGGTAGAAGCAAGGGGAATGG - Intergenic
1144542635 17:16159593-16159615 TATGGTAGAAAGGAGATCAAGGG + Intronic
1145881505 17:28356150-28356172 TAGGGAAGAAACAAGGGCAGGGG - Intronic
1146097666 17:29947419-29947441 GAGGGTGGAAGGAGGGGCAAGGG + Intronic
1146446293 17:32935610-32935632 GAGGGCAGAAAGAAGCCCAAAGG - Intronic
1146482187 17:33213705-33213727 CTGGGTGGAAAGAAGGGGAAAGG - Intronic
1147363587 17:39946142-39946164 GAGGGTGCAAAGAGGGGCAAGGG + Intergenic
1147980303 17:44269947-44269969 TAGGGCAGGCAGAGGGGCAAGGG - Intergenic
1148089871 17:45016994-45017016 GAGTGTAGAAGGCAGGGCAATGG + Intergenic
1148211993 17:45814097-45814119 AAGGGAAGAAGGAAGGGCAGGGG + Intronic
1153504340 18:5780293-5780315 TTGGGATCAAAGAAGGGCAAGGG + Intergenic
1153577066 18:6532881-6532903 TAGGGAAGAAAGAAGGAAAGAGG - Intronic
1155174962 18:23293746-23293768 GAGAACAGAAAGAAGGGCAAAGG + Intronic
1156553969 18:38046603-38046625 TTGAGAAGCAAGAAGGGCAAAGG + Intergenic
1157791747 18:50538123-50538145 TAGGATAGAAATAAGACCAATGG - Intergenic
1157879114 18:51303299-51303321 TAGTGTTGGAAGAAGGACAAGGG + Intergenic
1158078187 18:53556441-53556463 CATGGTAGAGAGAAGGGCAGAGG - Intergenic
1158230486 18:55249112-55249134 TAGTCTTCAAAGAAGGGCAATGG + Intronic
1158331898 18:56371563-56371585 TAGGGTAGAAAAATGGCAAATGG + Intergenic
1158669404 18:59461445-59461467 AAGGGTAGAGAGAAGGGTAGAGG - Intronic
1159094218 18:63884106-63884128 TAAGGTACAAAGAAAGACAATGG + Intronic
1159351698 18:67283658-67283680 TGGGGGAGAAAGGAGAGCAATGG + Intergenic
1159510772 18:69396123-69396145 TAGTGTAGAAATAATGTCAAGGG - Intergenic
1159678366 18:71314867-71314889 TAGGGTGGGAGGAGGGGCAAAGG + Intergenic
1161841293 19:6682235-6682257 TAGTGCAGAAAGAAGGGCATTGG + Intronic
1162228249 19:9242844-9242866 GAGGGAAGAAAGAAGAGGAAAGG - Intergenic
1162254258 19:9475510-9475532 TAGGTTAGACAGAAGTGCAGTGG - Intronic
1162612652 19:11768048-11768070 TTGGGAAGAAAGAAGGGACAGGG - Intronic
1163258759 19:16173789-16173811 CAGGGTATACAGAAGGGCTATGG + Intergenic
1164419769 19:28078705-28078727 TAGGGGAAAAAGCAGGCCAAAGG - Intergenic
1166052761 19:40270187-40270209 TAGGGGAAAATGAAGGGTAAGGG - Intronic
1167810724 19:51827926-51827948 TAGGAGAGACAGAAGGGAAAAGG - Intergenic
925085529 2:1104924-1104946 TAGGTAGGAAAGAAGGGAAATGG + Intronic
925369957 2:3337051-3337073 AAGGGTAAAAAGAAGGGAAGGGG + Intronic
926457386 2:13083689-13083711 TAAGGAAGAAAGTAGGCCAAGGG - Intergenic
927621776 2:24668637-24668659 AAAGCTAGAAAGAAGGGCATAGG + Intronic
928654179 2:33432540-33432562 GAGGGGAGAGAGCAGGGCAATGG - Intergenic
928656626 2:33458685-33458707 TAGGGTAGAAACAAGTGAGAAGG + Intronic
930302206 2:49630628-49630650 AAGGGCAGAGAGAAGGGGAAGGG + Intergenic
930609256 2:53523116-53523138 TAAGGTGTCAAGAAGGGCAAGGG + Intergenic
931059933 2:58516213-58516235 GAGGATAGAGAGAAGAGCAAAGG - Intergenic
931924464 2:67056368-67056390 TAGGGTAAAAAGAAAGTAAATGG - Intergenic
933260172 2:80123645-80123667 TAGGAAGGAAAGCAGGGCAAGGG - Intronic
934153118 2:89168677-89168699 TAGGGTAGAAACAAAAGAAATGG + Intergenic
934214122 2:90013254-90013276 TAGGGTAGAAACAAAAGAAATGG - Intergenic
935051125 2:99525937-99525959 ATGGATAGAAGGAAGGGCAAGGG + Intergenic
935103562 2:100019366-100019388 TAGGCTAGAAAGAAGATAAATGG + Intronic
935175180 2:100642807-100642829 TAGGGGAAATAGCAGGGCAAAGG + Intergenic
935563381 2:104581578-104581600 TTAGGAAGAAAGAAGAGCAATGG - Intergenic
937062791 2:118992744-118992766 GAGGAAAGAAAGAAGGGAAAGGG - Intronic
937748649 2:125447040-125447062 TTGGGTAGAAGAAAGGGCAGTGG - Intergenic
938398392 2:130967309-130967331 CGGGGCAGAAAGAAGGGCCATGG - Intronic
938785302 2:134623179-134623201 GAGGGGAGAAAAAAGGGAAAAGG + Intronic
939900197 2:147842283-147842305 CAAGGAGGAAAGAAGGGCAATGG + Intergenic
940508020 2:154580275-154580297 TATGGGAGAGAGAAGGGGAAGGG + Intergenic
940811542 2:158248235-158248257 TGGGGAGGAAAGAAGGGAAATGG + Intronic
942336703 2:174895414-174895436 TGGGGTAGGAGGAAGGGAAATGG + Intronic
942764029 2:179432707-179432729 TAGGAAAGGAAGAAGGGCAGTGG - Intergenic
943442654 2:187945060-187945082 GGGGGAAGCAAGAAGGGCAAAGG - Intergenic
944192429 2:197017887-197017909 TAGGGCAGCAAGGAGGGGAAGGG - Intronic
944301232 2:198127062-198127084 CATGGGAGAGAGAAGGGCAAAGG - Intronic
944825032 2:203474157-203474179 CAGGGTAGAAAGAGGGCAAAGGG + Intronic
945212116 2:207394500-207394522 GAGGTTAGAAAGGAGGGCAAGGG + Intergenic
945375632 2:209076887-209076909 TAGGTTTGAAAGAAGGAAAAGGG - Intergenic
945672045 2:212813999-212814021 TAGGGTTCAAAGAAAGGAAAAGG - Intergenic
946647203 2:221850565-221850587 CAGGGTAGAACGAAGAGCAATGG + Intergenic
947562033 2:231163263-231163285 TCTGGTACAAAGAAGGGAAATGG + Intronic
948020990 2:234733042-234733064 TAGGGAAGAAAGATGGTCCATGG - Intergenic
948609181 2:239155933-239155955 TGGGGTAGCAAGAAGGGCAGGGG - Intronic
948781082 2:240322353-240322375 CAGTGTCAAAAGAAGGGCAAAGG + Intergenic
949066207 2:241992028-241992050 TTGGGTAGAAAAAAAGGAAATGG + Intergenic
1169268988 20:4184983-4185005 TAGGCTAGAAGGAAGAGGAAAGG + Intronic
1170003809 20:11644969-11644991 CATGGTGGAAAGAGGGGCAAGGG - Intergenic
1170315735 20:15039451-15039473 AATGGGAGAAAGGAGGGCAAAGG + Intronic
1170392215 20:15888059-15888081 TAGGGAAGAAAGACAGGAAAAGG - Intronic
1172597166 20:36157480-36157502 CATGGTAGAAAGAAGGGCTCTGG - Intronic
1172832015 20:37844013-37844035 TAGGGTAGAAAAGATGGAAACGG - Intronic
1174301980 20:49589125-49589147 TATGGGAGAAAGTAGGACAAGGG + Intergenic
1174422975 20:50412309-50412331 TGGGCCAGAAAGTAGGGCAAAGG + Intergenic
1174586461 20:51612373-51612395 TGGAGTAGAAAGGAGGCCAAAGG - Intronic
1175127542 20:56763672-56763694 TAGGGAAGAAGGAAGGAAAAGGG + Intergenic
1175563067 20:59949088-59949110 GAAGTTAGAAAGAAGAGCAAAGG - Intergenic
1175587778 20:60159020-60159042 AAGGGGAGAAAGAACGGGAAAGG + Intergenic
1176754146 21:10713265-10713287 TAGAGTAGAAAGGAGTGGAATGG - Intergenic
1177013895 21:15760280-15760302 TAGGATAAAGAGAAGGGCAAAGG - Intronic
1177827484 21:26100637-26100659 TAGAGGAGAAAGTTGGGCAAAGG + Intronic
1178524670 21:33317304-33317326 TATTGTAGAAAGAAGAACAAGGG - Intergenic
1178770958 21:35503647-35503669 CAGGGTAGAAGGAAGGGCAGGGG + Intronic
1178837911 21:36113867-36113889 AAGGGAAGAATGAAGGGAAAGGG + Intergenic
1178860441 21:36284567-36284589 TGGGGTAGAAAGAAGGAACAGGG - Intronic
1179654441 21:42836746-42836768 TGGGGCAGAAAGAAGGGAACGGG - Intergenic
1180625187 22:17189598-17189620 TGGGATAGAAAAAAGGGCACAGG + Intronic
1180944893 22:19687521-19687543 GGGGGCAGAAAGAAGTGCAAGGG - Intergenic
1181625155 22:24118160-24118182 CAGGGGAGGGAGAAGGGCAATGG + Intronic
1181976862 22:26736556-26736578 CAGGGAAGAAATAAGGGGAAGGG - Intergenic
1182400765 22:30075516-30075538 TTTTGTAGAAAGAAAGGCAAAGG - Intergenic
1182910588 22:33981004-33981026 GAGTGGAGGAAGAAGGGCAATGG - Intergenic
1184330006 22:43821362-43821384 AAGGGCAGAAGGAAGGGCACCGG + Intergenic
1185105968 22:48870055-48870077 CAGGGCAGAGAGAAGGGGAATGG - Intergenic
1203296610 22_KI270736v1_random:48181-48203 CAGAGTGGAATGAAGGGCAATGG + Intergenic
951307802 3:21086898-21086920 CAGGGTAGAAAGCAGATCAAGGG + Intergenic
952625666 3:35399759-35399781 TAGGGAAGAAGATAGGGCAATGG + Intergenic
953329764 3:42043259-42043281 AAGGGAAGAAAGAACGGGAACGG - Intronic
953493693 3:43369374-43369396 AAAGGTAGAAAGAATGGCCAGGG + Intronic
954797758 3:53170148-53170170 TGTGGGAGAAAGAAGGGCTAAGG + Intronic
955019840 3:55109260-55109282 TTGGGTAGAACAAAGGGAAAAGG + Intergenic
955074902 3:55604451-55604473 TAGGGTAGAGAGAATTGTAAAGG - Intronic
955246916 3:57233704-57233726 TATAGTATAAAGAAGGGGAAAGG - Intronic
955629716 3:60960162-60960184 TAGGGTGGGAAGAAGGGAAGAGG - Intronic
956004158 3:64761180-64761202 TGGGGTAGAGAGGAGGGAAATGG - Intergenic
956066491 3:65402256-65402278 TAATGGAGAAAGAAAGGCAAAGG + Intronic
956658902 3:71581339-71581361 TAGGAAAGAAAGAGGGGAAAAGG + Intronic
957416910 3:79917361-79917383 AAGGGAAGAAAGAAGGAAAAAGG + Intergenic
957520387 3:81311519-81311541 GAGGGAAGGAAGAAGGGAAAGGG + Intergenic
957639692 3:82836137-82836159 TAGGCTCGAAATAAGGGAAAAGG - Intergenic
957767586 3:84646437-84646459 GAGGGTAGAAGGAAGGGAAGTGG - Intergenic
958558297 3:95708062-95708084 TAGGGGAGAAATTAGGGCAAGGG + Intergenic
959822876 3:110757156-110757178 TAGGCCAGAAAGAAGGGAGAAGG - Intergenic
959925421 3:111915846-111915868 TAGGGAAGAAAGTAGGGGCAGGG + Intronic
960248151 3:115422374-115422396 CAGGATGGACAGAAGGGCAAAGG + Intergenic
960980769 3:123223278-123223300 TGGGGTAAAAAGCAGGGGAATGG - Intronic
961996749 3:131253535-131253557 TAGGGAAGGAAGAAGAGGAAAGG - Intronic
962267990 3:133957074-133957096 TAGAGCAGAAAGAAGGGCAATGG - Intronic
962454191 3:135549954-135549976 AAGACTAGAAAGAAGGGCAGAGG + Intergenic
964424065 3:156533629-156533651 TAAAGTAGAATGAAGGGCAAGGG + Intronic
965118540 3:164521596-164521618 GAGGGAAGAGAGAAGGGCTATGG - Intergenic
965190571 3:165522666-165522688 TAGGGGATAAAGAAGTGGAATGG + Intergenic
965534495 3:169811185-169811207 TAGGGAAGAAAGAAGCCCAGTGG - Intronic
966471302 3:180292187-180292209 GAAGGAAGAAAGTAGGGCAAAGG + Intergenic
966821064 3:183924897-183924919 TATGGGAGAGAGAAGGGCAAAGG + Intronic
967501043 3:190197735-190197757 AAGGGGAGAAAGAAGGGGAAAGG + Intergenic
967712355 3:192723917-192723939 TAGGGGAGAAAGGAGGGAAGAGG + Intronic
967876411 3:194271089-194271111 CAGGGAAGAAGGCAGGGCAAGGG - Intergenic
968685262 4:1953695-1953717 TAGGATGGAAAGAAGGAAAAGGG - Intronic
969123167 4:4924465-4924487 TAGGGTAGGCAGAGGGGCATGGG + Intergenic
971007857 4:22395608-22395630 TAGGGGAGAAGAAAGGGCAAGGG - Intronic
971141482 4:23929647-23929669 TGGGGAAGAAAGATTGGCAATGG + Intergenic
971666902 4:29498946-29498968 TAAGGAAGAAAGATGAGCAAGGG - Intergenic
971813844 4:31462056-31462078 TAGGCTATAAAGATGGGAAAAGG + Intergenic
971872024 4:32253466-32253488 TAGGATAGAAAGTAGCCCAAAGG + Intergenic
972148778 4:36063587-36063609 TAGGGTAGCAGGAAGAGGAAAGG - Intronic
972865051 4:43221744-43221766 AAGGGAAGAATGAAGGGAAATGG - Intergenic
974666318 4:64967330-64967352 TAAAGCAGAAAGAAGGGAAAAGG + Intergenic
974909323 4:68097437-68097459 AAGGGAGGAAAGAAGGTCAAAGG - Intronic
975731771 4:77344350-77344372 TAGGCAAGAAAGAAGGGGTAAGG + Intronic
977032359 4:91901477-91901499 TAGAGCAGAAGGAAAGGCAACGG - Intergenic
977459610 4:97308951-97308973 CAGGGGAGAGAGAAGGGGAAGGG - Intronic
977869223 4:102070269-102070291 TAGGGAAGAATGAAGGGAAAGGG - Intronic
978190293 4:105903394-105903416 CAGGGGAGATGGAAGGGCAAGGG + Intronic
978957346 4:114630773-114630795 TAGGGTAGAAAGAAGAATTAAGG + Intronic
979675755 4:123408878-123408900 TAGGTTAGTAGGAAGGGAAAGGG + Intergenic
979737164 4:124101466-124101488 GAAGGTAGAAAGAAGGTCAAGGG - Intergenic
981027161 4:140088310-140088332 TAGGGGAGAGAGGAGGGAAAGGG - Intronic
981572323 4:146165807-146165829 AAGGGTAGAAAGAAAGGACATGG - Intergenic
981759752 4:148181302-148181324 TAGTTTAGAAAGAAGGGAAGAGG + Intronic
982366192 4:154581895-154581917 GAGAAAAGAAAGAAGGGCAAAGG - Intergenic
982488446 4:155998321-155998343 GAGGGTGGAAAGAAGGGTGAAGG - Intergenic
982540115 4:156658306-156658328 TAGGGTAGTAGAAATGGCAAGGG - Intergenic
982751875 4:159171889-159171911 AACGGTAGTATGAAGGGCAATGG - Intronic
983191612 4:164760301-164760323 AAGGGTAGAAAGAAAAGCAAAGG + Intergenic
983435296 4:167707593-167707615 TAGGGTAGAATTGGGGGCAAGGG - Intergenic
983534253 4:168840423-168840445 TTGTGTATAAAGAAGGGCCAAGG - Intronic
984966533 4:185144707-185144729 CAGGGTAGAGAGAAGGGAAGAGG - Intronic
986890438 5:12298276-12298298 TATGGCATAAAGGAGGGCAATGG - Intergenic
988974812 5:36504548-36504570 TTGGTTGGAAAGAAGGGAAATGG + Intergenic
990114285 5:52369302-52369324 TAAGGCAGAAGGAGGGGCAAAGG + Intergenic
990539434 5:56757430-56757452 GAGGGAAGAAAGTAGGCCAATGG - Intergenic
990725360 5:58747486-58747508 GATGGTAGAAAGAAGTGAAAGGG - Intronic
992268744 5:75044306-75044328 TGGGGCAGAAAGAAGAGGAATGG - Intergenic
994117281 5:96074711-96074733 TGGGGAAGAAAGAAGGACAAAGG + Intergenic
994332904 5:98527954-98527976 TAGGGTACAAAGAAAGTCAGGGG + Intergenic
996695761 5:126393112-126393134 AAGGGGAGAAAAAAGGGAAAAGG - Intronic
997474161 5:134133145-134133167 TGGGGGAGACAGAGGGGCAAAGG + Intronic
997664849 5:135622004-135622026 CATGATAGAAAAAAGGGCAAAGG + Intergenic
998320756 5:141227877-141227899 TAAGGTAGAAAAAAGTGAAATGG + Intergenic
998350400 5:141496637-141496659 TGGGGTCAAAGGAAGGGCAAGGG - Intronic
998448444 5:142216321-142216343 GAGGGTAGAATGAAGGGAACAGG + Intergenic
999373087 5:151068096-151068118 TTGGGGAGAAAGAAAGGCAGTGG + Intronic
999793388 5:154964736-154964758 TGGGGGAGATAGAAGGGAAATGG + Intronic
1000443565 5:161292507-161292529 TAGTGTAGAAAGAAGCACAATGG + Exonic
1001335833 5:170795803-170795825 AAGGGAAGAAATAAGGGCAATGG + Intronic
1001965066 5:175904219-175904241 TAGGGTAGAGAGGAGGCCAGGGG + Intergenic
1002251889 5:177934969-177934991 TAGGGTAGAGAGGAGGCCAGGGG - Intergenic
1002308636 5:178299637-178299659 CAGGGTAGAAAGAAATGAAATGG - Intronic
1002543361 5:179921264-179921286 TAGGGTAGAAAGAAGGGCAAGGG - Intronic
1003528974 6:6921818-6921840 TTGGGAAGAGTGAAGGGCAAGGG - Intergenic
1004526603 6:16414792-16414814 TTGAGTAGAAAGAAGGACAAAGG - Intronic
1005132051 6:22520535-22520557 AAGGGTAGAAAGAAGGAAAGAGG + Intergenic
1006205583 6:32338843-32338865 TAGGGAATAAACAAGGGGAAAGG + Intronic
1007542368 6:42659764-42659786 TAAAGTGGAAAGCAGGGCAATGG + Exonic
1007924920 6:45643025-45643047 GAGGGCAGAGAGAAGGGGAAAGG - Intronic
1008951499 6:57164819-57164841 TAAGGCAGAAAGAATGGTAAGGG + Intronic
1009890701 6:69677514-69677536 AACAGAAGAAAGAAGGGCAAGGG + Intronic
1009950299 6:70387548-70387570 TCGGCTAGAAAGAAGGGAGAAGG + Intergenic
1010527309 6:76918348-76918370 TGAGGAAGAAAGAAGAGCAATGG - Intergenic
1011030479 6:82917494-82917516 TAGGGAAGGAAAGAGGGCAAAGG + Intronic
1011031470 6:82928642-82928664 CAGAGTAGAAAGAAGCACAAGGG + Intronic
1011839448 6:91478358-91478380 TAGGGAAGGAAGAAAGGTAAAGG - Intergenic
1013457277 6:110342008-110342030 AAGGTGAGAAAGAAGGGCCAAGG + Intronic
1014949974 6:127542827-127542849 TACTGTAGAAAGGAGGGTAATGG - Intronic
1015238935 6:131002351-131002373 GAGAGAAGAAAGAAGGGGAATGG + Intronic
1015364192 6:132378437-132378459 TAGGATAGAAAGAATGAAAATGG - Intronic
1015778217 6:136836370-136836392 TAAGGTAGAAAGCAGGGGAAGGG + Intronic
1016913392 6:149221681-149221703 TAGTCTAGGAAGAAGGGCAAGGG + Intronic
1017930012 6:158943835-158943857 GAGGGAAGAAAGAAAGGGAAGGG - Intergenic
1018060291 6:160084712-160084734 TACAGTAGAAAGAAGGGCTCCGG - Intronic
1018584861 6:165346413-165346435 TCGGGGAGAAAGGAGGGAAAAGG - Intronic
1018735645 6:166685485-166685507 TAGGGCAGAAAGAAAGTCAGAGG - Intronic
1018805257 6:167254367-167254389 TAGGAAAGAAGGAAGGGGAATGG + Intergenic
1020093153 7:5352643-5352665 GCTCGTAGAAAGAAGGGCAAGGG - Intronic
1021070844 7:16238013-16238035 GATGGTAGATAGAAGGGAAAGGG + Intronic
1021441116 7:20677764-20677786 CTAGGTAGAAAGAGGGGCAAAGG - Intronic
1021828590 7:24579563-24579585 TGGGGTAGAAGAAAGGGGAATGG - Intronic
1021950511 7:25769569-25769591 GAGGGAGGAAAGAAGGGGAAGGG + Intergenic
1022028160 7:26467740-26467762 GTGGGTAGAGAGAAGAGCAATGG - Intergenic
1022553884 7:31272090-31272112 TAGTTTAGAAAGAAGAGCTAGGG - Intergenic
1022891968 7:34710325-34710347 TAGGGAAGAAAGCAGAGGAAAGG + Intronic
1023549236 7:41351381-41351403 TAGGGTAGAAAAAGGCACAAAGG + Intergenic
1023954674 7:44874853-44874875 TAAGGTATAAAGAAGGGAAAAGG - Intergenic
1024516480 7:50263337-50263359 TAGGATAGAAATAAGTGAAAAGG - Intergenic
1025764351 7:64428809-64428831 TAGGCTTAAAAAAAGGGCAATGG - Intergenic
1025789002 7:64670304-64670326 AAGGTTAGAAAGAAGGTCACAGG + Intronic
1026502339 7:70953319-70953341 GAGGGAGGAAAGAAGGTCAAAGG + Intergenic
1027499256 7:78927524-78927546 AAGGGTAGAGATAAGGGTAAGGG + Intronic
1028342053 7:89733962-89733984 TAGAGAAGAATGAAGGGAAAGGG - Intergenic
1028474399 7:91237914-91237936 TAGAAAAGAAAGAAGGGGAAAGG - Intergenic
1028606546 7:92662121-92662143 CAGGGTAGGAACAAGAGCAAGGG + Intronic
1028631439 7:92938786-92938808 TAGGGTAGAAAGAGCACCAAAGG + Intergenic
1029099686 7:98118652-98118674 TAGGGCAGAGGGAAGGGTAAAGG - Intronic
1030380258 7:108803247-108803269 AAGGGAAGAAAGAAGGGGAAGGG - Intergenic
1030874536 7:114796488-114796510 TTGGGTAGCCAAAAGGGCAAAGG + Intergenic
1031014327 7:116556823-116556845 TGGGGTCAAAAGATGGGCAATGG - Intronic
1031438405 7:121762172-121762194 TAGGGCTGAGAGAAGGGCAATGG + Intergenic
1031703229 7:124951033-124951055 TCTGGTAGAAAGTAGGTCAAAGG + Intergenic
1032982995 7:137306377-137306399 GAGGGTAGAAAGAAGGATAAAGG + Intronic
1033217176 7:139501509-139501531 TGGGGGAGGGAGAAGGGCAAGGG + Intergenic
1033828655 7:145224932-145224954 GCGGGTAGAGAGAAGTGCAATGG - Intergenic
1034149570 7:148903677-148903699 CAAGGCAGAAAGAAGGGGAAGGG + Intergenic
1034588508 7:152118096-152118118 TAGGGTAGAGAGAAGAGGAAGGG - Intronic
1036573645 8:10003931-10003953 TAGGGAAGATAGAAGGGTAGTGG + Intergenic
1036621131 8:10425082-10425104 TAGGTGCGAAAGAAGGGGAAAGG - Intronic
1037607143 8:20447600-20447622 AAGGGAAGAAAGCAAGGCAATGG - Intergenic
1037754062 8:21700207-21700229 TGGGATGGAGAGAAGGGCAAGGG + Intronic
1037872826 8:22515109-22515131 AAGGGTAGTAAGAGGGGAAATGG - Intronic
1038885172 8:31655436-31655458 TAGGGTAGGGAGGAGGGGAAAGG + Intronic
1040548957 8:48423692-48423714 TAGGGAAGAAAGAGGGGTGAAGG + Intergenic
1040836537 8:51737532-51737554 CAGGGTAGAAAGAGGAGAAAGGG - Intronic
1041560136 8:59208377-59208399 TATGGGAGAAATAACGGCAATGG - Intergenic
1041605625 8:59779602-59779624 TAGGGAAGAATGAAGGGAAAGGG + Intergenic
1042590683 8:70395183-70395205 TAGAGGAGAAAGATGTGCAAAGG + Intronic
1043007628 8:74839780-74839802 AATGGAAGAAAGAAGGGCACAGG - Intronic
1043978650 8:86612787-86612809 TAGGATAGAAAAAAAGGCCAAGG + Intronic
1044906207 8:97006458-97006480 TAGTATACAAAGAAGTGCAAGGG + Intronic
1045453234 8:102349549-102349571 GAGGGGAGAGAGAAGAGCAAAGG + Intronic
1045603015 8:103739379-103739401 TAGGGTAGAGGGAAGGGGGAGGG + Intronic
1045646530 8:104305093-104305115 AAGGGAAGAATGAAGGGAAAGGG - Intergenic
1046095627 8:109556690-109556712 TAGGATAGAAAGAAAGAAAATGG + Intronic
1046182607 8:110672021-110672043 TAAGGTAGAAAGACAGGGAAAGG - Intergenic
1047716403 8:127599481-127599503 AAGGGTAGAAATTAAGGCAAGGG + Intergenic
1048087635 8:131201454-131201476 TAGCCAAGAAAAAAGGGCAAGGG + Intergenic
1049840569 8:144768578-144768600 TGAGGGAGAAAGAAGGGGAAAGG - Intergenic
1050636640 9:7619529-7619551 AAGGGAAGAATGAAGGGAAAGGG + Intergenic
1051612626 9:18976214-18976236 TAGAGTAGAAAGAACTGCATGGG + Intronic
1055141639 9:72883210-72883232 TGGGGGAGAAAGAAGGGGAAAGG - Intergenic
1055837677 9:80463689-80463711 AAGTGAAGAAAGAATGGCAAGGG - Intergenic
1057258948 9:93573507-93573529 TTGGGGAGAAAGAAGGGCACTGG - Intergenic
1057821525 9:98334961-98334983 CAGGGAAGAAAAAAGGACAAGGG - Intronic
1059690830 9:116684747-116684769 TAGGGTATGAAGATGGGAAAAGG - Intronic
1061537365 9:131258434-131258456 AAGGGCAGAAAGAAGGGGCACGG + Exonic
1185724043 X:2405114-2405136 TAGGGTAGAAAGGAGGAGATAGG + Intronic
1186210071 X:7241407-7241429 TAGGGTAGACCAAAGGGAAATGG - Intronic
1187418206 X:19111940-19111962 TAGGGGAGAAGGAAGGGCTCTGG + Intronic
1187496991 X:19803831-19803853 CAGGTTAGAAAGAAGGGCCAGGG - Intronic
1188225626 X:27593225-27593247 AAGGGTGGGAGGAAGGGCAAAGG - Intronic
1188569176 X:31561366-31561388 GAGGGTAGAAAGAACAGGAAGGG + Intronic
1188686635 X:33077461-33077483 TAGGCTATAAAGATGGGAAAAGG + Intronic
1189197128 X:39162170-39162192 TAGGGCAGAAAGGATGGGAAAGG - Intergenic
1190845058 X:54183386-54183408 TTGGGTAGAGAGAAGGGGAGGGG + Intergenic
1192234204 X:69285725-69285747 TAAGGAAGAAAGGAGGGGAAAGG + Intergenic
1192400754 X:70832689-70832711 TAGGAGAGAAAGAATGGAAAGGG + Intronic
1192698327 X:73442523-73442545 TAGGGTAAAAAGAATGAGAAAGG - Intergenic
1194010904 X:88559752-88559774 AAGGGAAGAATGAAGGGAAAAGG - Intergenic
1194089516 X:89567567-89567589 TAGGGAAGAATGAAAGGAAAGGG - Intergenic
1194726269 X:97401213-97401235 GAGGTTAACAAGAAGGGCAAAGG - Intronic
1194819515 X:98488692-98488714 TAGGGTGGAAGGGAGCGCAATGG + Intergenic
1195039401 X:101000492-101000514 TGTGGTAGAAAGTAGGGCTAAGG - Intergenic
1195114193 X:101679946-101679968 TAAGGGAGAGAGAGGGGCAAGGG + Intergenic
1195283435 X:103359134-103359156 TATGGTAGTATGAAGGGCAGGGG - Intergenic
1196034798 X:111132463-111132485 AAGGGTGGAAAGAAGGACAAGGG + Intronic
1198121783 X:133600656-133600678 GAGTGTTGAAAGAAGGGTAATGG + Intronic
1198394617 X:136208946-136208968 GAGGGTAGAAAGAAGGGGGTGGG + Intronic
1198632917 X:138661697-138661719 TAGGTTAGAAATAAGGGTATAGG + Intronic
1199410196 X:147512620-147512642 AAGGGTAGAAGGAAGGGAAGGGG + Intergenic
1201110971 Y:10799232-10799254 TAGGGTGGAATGAAGTGGAATGG - Intergenic
1201352281 Y:13057030-13057052 TATGGTATAAAGAAGGGGACCGG + Intergenic
1201458884 Y:14201146-14201168 AAGGGAGGAAAGAAAGGCAAAGG + Intergenic