ID: 1002549290

View in Genome Browser
Species Human (GRCh38)
Location 5:179975046-179975068
Sequence ACAGAGCCTCCCCGCCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 238}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002549290_1002549296 18 Left 1002549290 5:179975046-179975068 CCAGCCAGGCGGGGAGGCTCTGT 0: 1
1: 1
2: 0
3: 18
4: 238
Right 1002549296 5:179975087-179975109 AGTCCCGTGGGAAGACGGTGAGG 0: 1
1: 0
2: 0
3: 4
4: 112
1002549290_1002549295 13 Left 1002549290 5:179975046-179975068 CCAGCCAGGCGGGGAGGCTCTGT 0: 1
1: 1
2: 0
3: 18
4: 238
Right 1002549295 5:179975082-179975104 TTCAGAGTCCCGTGGGAAGACGG 0: 1
1: 0
2: 0
3: 9
4: 177
1002549290_1002549293 5 Left 1002549290 5:179975046-179975068 CCAGCCAGGCGGGGAGGCTCTGT 0: 1
1: 1
2: 0
3: 18
4: 238
Right 1002549293 5:179975074-179975096 CAAGTCTGTTCAGAGTCCCGTGG 0: 1
1: 0
2: 0
3: 10
4: 84
1002549290_1002549297 19 Left 1002549290 5:179975046-179975068 CCAGCCAGGCGGGGAGGCTCTGT 0: 1
1: 1
2: 0
3: 18
4: 238
Right 1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 89
1002549290_1002549294 6 Left 1002549290 5:179975046-179975068 CCAGCCAGGCGGGGAGGCTCTGT 0: 1
1: 1
2: 0
3: 18
4: 238
Right 1002549294 5:179975075-179975097 AAGTCTGTTCAGAGTCCCGTGGG 0: 1
1: 0
2: 1
3: 2
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002549290 Original CRISPR ACAGAGCCTCCCCGCCTGGC TGG (reversed) Intronic
900371992 1:2336305-2336327 AGAGAGCCCCCCCGCCAGCCAGG - Intronic
900423814 1:2567247-2567269 ACAGACCCTCACCCCCAGGCTGG + Intergenic
900578626 1:3396572-3396594 ACAGTGCCGCCCGGCCTGGACGG + Exonic
900608898 1:3536189-3536211 GCAAAGCCTCCCCAGCTGGCCGG + Intronic
900931894 1:5743054-5743076 ACAGAGCCAGCCCGGCTGGGTGG - Intergenic
901531497 1:9856290-9856312 AATGAGCCTCCACGCCTGGCAGG + Intronic
902621106 1:17651608-17651630 GCAGAGGCTCCCCACCTGGATGG - Intronic
903228973 1:21910332-21910354 ACAGGGCCTCAGGGCCTGGCAGG - Intronic
903246531 1:22019976-22019998 CATGAGCCACCCCGCCTGGCTGG + Intergenic
904377027 1:30088131-30088153 ACAGAGGCCCCAAGCCTGGCTGG - Intergenic
905108449 1:35577542-35577564 ACAGTGCCTCCCAGCCTGGGCGG + Intronic
915108136 1:153546929-153546951 ACAGAGCACCCCTTCCTGGCTGG + Intronic
919947477 1:202330294-202330316 GTAGAGCCTCCCGGCCTGGCTGG + Intergenic
920802220 1:209200041-209200063 GCACAGGCTCCCCACCTGGCTGG + Intergenic
922157639 1:223052585-223052607 ACACTTCCTCCCCACCTGGCAGG + Intergenic
922722560 1:227906274-227906296 ACAGTGCCTCCCTGCCTTCCTGG + Intergenic
923305371 1:232683303-232683325 CAAGAGGCTCCCCGCCTGGTAGG + Intergenic
924683403 1:246261000-246261022 ACAGAGTCTCGCCTTCTGGCTGG + Intronic
1067025704 10:42841989-42842011 ACAGAGCCTCGCTTCCAGGCTGG + Intergenic
1068119951 10:52775013-52775035 AGTGAGCCACCACGCCTGGCTGG - Intergenic
1069385658 10:67881389-67881411 AGTGAGCCACCGCGCCTGGCTGG + Intergenic
1069789921 10:71013015-71013037 GAAGAGCCTCAGCGCCTGGCAGG + Intergenic
1069853966 10:71428869-71428891 CCTGAGCCACCACGCCTGGCTGG + Intronic
1070912023 10:80127133-80127155 TCAGGTCCTCCCAGCCTGGCTGG - Intergenic
1071903979 10:90152599-90152621 TCAGAGCCTCCCAGCCTTCCTGG + Intergenic
1076219297 10:128720022-128720044 GCAGGGCCTCCTTGCCTGGCAGG + Intergenic
1076444007 10:130499715-130499737 GCTGAGCCTCACTGCCTGGCTGG + Intergenic
1076683823 10:132187833-132187855 ACAAAGCCTCCCCGCTCGGGCGG + Intronic
1076785869 10:132749676-132749698 TCAGAGCCGCCCTGCCTGCCCGG + Intronic
1076826625 10:132972726-132972748 AGAGACCCTACCAGCCTGGCAGG - Intergenic
1076912941 10:133401377-133401399 ACATAGTCTCCCTGCTTGGCTGG + Intronic
1076912945 10:133401415-133401437 ACATAGTCTCCCTGCTTGGCTGG + Intronic
1077096974 11:803174-803196 GCAGAGCCTCCCAGCCTCTCTGG - Exonic
1077196103 11:1280981-1281003 ACAGAGACTCTCCGCCAGGCTGG - Intronic
1077201559 11:1309914-1309936 ACAGGGCCTAGCCACCTGGCGGG + Intergenic
1080444390 11:32324754-32324776 AGTGAGCCACCGCGCCTGGCCGG - Intergenic
1081578046 11:44332004-44332026 AGTGAGCCACCACGCCTGGCTGG + Intergenic
1083895519 11:65618005-65618027 TCAGAGCCTTCTCCCCTGGCTGG + Exonic
1084598885 11:70133218-70133240 ACAGAGCCCCGCAACCTGGCTGG - Intronic
1085592488 11:77777308-77777330 CCTGAGCCACCTCGCCTGGCGGG - Intronic
1087236059 11:95719914-95719936 AGTGAGCCACCGCGCCTGGCCGG - Intergenic
1089456716 11:118630001-118630023 ACAGAGCCTCGGCACCTGGGAGG - Intronic
1090081839 11:123618759-123618781 GCAGACCCTCACTGCCTGGCAGG + Exonic
1090385727 11:126356539-126356561 ACAGAGCCTCCCCCCAGGACTGG - Intronic
1091300401 11:134503701-134503723 CCAGAGCCTGCCTGCCTGCCAGG + Intergenic
1096491625 12:52015743-52015765 ACACAGGCCCCCTGCCTGGCAGG - Exonic
1096523975 12:52199816-52199838 ACAGAACATCCCTGCATGGCAGG - Intergenic
1098474617 12:70885810-70885832 GCTGAGCCACCACGCCTGGCTGG + Intronic
1102300138 12:111765849-111765871 GCTGAGCCTGCTCGCCTGGCTGG - Intronic
1104517037 12:129437272-129437294 ACAGAGCCTCCCCACCATCCTGG + Intronic
1104842174 12:131830447-131830469 ACGGAGGCTCCACGCCAGGCCGG - Intronic
1106164336 13:27229597-27229619 ACAGAGCCACCACACCTGGCTGG - Intergenic
1110648666 13:77918469-77918491 AGAGAGGCTTCCCGCCTGACAGG - Exonic
1114618822 14:24082632-24082654 ACAGCTCCTCCAGGCCTGGCCGG + Exonic
1114653208 14:24299786-24299808 ACACACCCACCCCGCCCGGCTGG + Exonic
1115398408 14:32934149-32934171 GTAGAGCCTCCCTTCCTGGCCGG - Intergenic
1115582261 14:34772747-34772769 CCTGAGCCACCACGCCTGGCCGG - Intronic
1115783751 14:36801124-36801146 ACAGAGCCCTTCCACCTGGCTGG + Intronic
1118249457 14:64145206-64145228 TAAGAGCCACCACGCCTGGCCGG + Intronic
1118919787 14:70139531-70139553 ACTGTTCCTCCTCGCCTGGCTGG - Intronic
1119774121 14:77237987-77238009 ACCAAGCCTCCATGCCTGGCAGG - Intronic
1120729190 14:87983056-87983078 AATGAGCCACCACGCCTGGCCGG - Intronic
1121125094 14:91400663-91400685 TCAGGACCTCACCGCCTGGCAGG + Intronic
1121434397 14:93909659-93909681 ACAGAGACTCCCAGGCAGGCAGG + Intergenic
1121678970 14:95776975-95776997 ACAGATCCTGCCTGCCAGGCCGG + Intergenic
1122901817 14:104785203-104785225 ACCCACCCTCCCCGCCTGCCAGG + Intronic
1122960925 14:105093374-105093396 ACAGCCCCTCACCGCCTGCCGGG + Intergenic
1123426315 15:20173321-20173343 ACAGAGCCTCGCTTCCAGGCTGG + Intergenic
1123535548 15:21179848-21179870 ACAGAGCCTCGCTTCCAGGCTGG + Intergenic
1124511426 15:30329551-30329573 CCAGAGCCTCCACACCTGCCTGG + Intergenic
1124731488 15:32201210-32201232 CCAGAGCCTCCACACCTGCCTGG - Intergenic
1126824030 15:52531150-52531172 AATGAGCCACCACGCCTGGCCGG + Intergenic
1128841417 15:70854061-70854083 GCCGAGCCTCCCCGCCGGACTGG + Exonic
1129253272 15:74320184-74320206 GCAGAGCTTCCGGGCCTGGCTGG + Intronic
1133241595 16:4417152-4417174 CCTGAGCCACCGCGCCTGGCCGG - Intronic
1133282218 16:4673285-4673307 ACAGACCCTCCCCCTCTGCCAGG + Intronic
1133306480 16:4812770-4812792 AGTGAGCCACCACGCCTGGCCGG + Intronic
1136857922 16:33676169-33676191 ACAGAGCCTCGCTTCCAGGCTGG - Intergenic
1139241612 16:65397928-65397950 AGTGAGCCACCGCGCCTGGCTGG - Intergenic
1139323101 16:66131180-66131202 CCACAGCCTCTCTGCCTGGCTGG - Intergenic
1141821147 16:86446834-86446856 ACAAAGCCTCCCCTCCTTGAAGG - Intergenic
1203119498 16_KI270728v1_random:1524648-1524670 ACAGAGCCTCGCTTCCAGGCTGG - Intergenic
1143149799 17:4800846-4800868 ATACATCCTCCACGCCTGGCAGG + Intergenic
1143757296 17:9076223-9076245 GCAGACCCTCCCCACCTGGGTGG - Intronic
1144703431 17:17352778-17352800 GCCGAGCTTCCCTGCCTGGCTGG - Intergenic
1146328934 17:31911296-31911318 GCTGAGCCTCCAAGCCTGGCTGG + Intergenic
1147320104 17:39640802-39640824 GCAGAGCCTCCCCGGCTGGGGGG + Intronic
1147951391 17:44109891-44109913 GCACAGCCTCCCCACCAGGCCGG - Intronic
1148200371 17:45746322-45746344 GCAGAGCCTCCGGGCCAGGCAGG - Intergenic
1148397933 17:47324849-47324871 AAAGAGCCTACCCTACTGGCTGG + Intronic
1148908322 17:50925850-50925872 TCAGAGACTCTCTGCCTGGCAGG - Intergenic
1149475761 17:56959932-56959954 CGTGAGCCTCCGCGCCTGGCTGG - Intronic
1151026626 17:70684820-70684842 TGTGAGCCACCCCGCCTGGCTGG - Intergenic
1152534638 17:80943442-80943464 ACAGGGCCTCCCCGCAAAGCCGG + Intronic
1152678284 17:81652892-81652914 GCTGAGCCACCGCGCCTGGCCGG + Intronic
1152750161 17:82058930-82058952 CCTGAGCCTCCTGGCCTGGCTGG - Intronic
1153480557 18:5543279-5543301 ACAAAGCATCCCCGCTGGGCAGG - Intronic
1155162875 18:23209717-23209739 ACAGAGACTCCCCAGGTGGCTGG + Intronic
1156469167 18:37366819-37366841 CCAGAGCCTCCCTGTCTGGGTGG + Intronic
1157155626 18:45262655-45262677 TCAGAGCCTCCCACCCTGGATGG + Intronic
1157611980 18:48962815-48962837 ACTGAGCCCGACCGCCTGGCAGG - Intergenic
1157860621 18:51137420-51137442 ACCCAGCCTCCCCTCCTGGCGGG - Intergenic
1158581784 18:58690473-58690495 CCAGAGCCTCCTCCCCTGGATGG + Intronic
1159880316 18:73852829-73852851 AGTGAGCCACCGCGCCTGGCCGG + Intergenic
1160236428 18:77089534-77089556 ACAGAGCCTCCGCCTCAGGCAGG + Intronic
1160549497 18:79684487-79684509 ACGGACCCACCCTGCCTGGCTGG - Intronic
1160940901 19:1620015-1620037 ACCCAGCATCCCTGCCTGGCGGG - Intronic
1160985431 19:1836418-1836440 ACTGAGTCTCCCCGTCTGGGTGG - Intronic
1161325746 19:3663145-3663167 AGTGAGCCTCCGCGCCCGGCCGG + Intronic
1161591372 19:5130726-5130748 ACAGAGCAGCCTCCCCTGGCTGG + Intronic
1161595268 19:5148044-5148066 CAAGAGCCTCCCCGCCTGTCCGG + Intronic
1161659885 19:5539561-5539583 ACAGAGCCCCTCCCCCTGCCTGG + Intergenic
1161668300 19:5590240-5590262 ACAGATGCTCCCCACCCGGCTGG + Intronic
1162507418 19:11094502-11094524 ACAGAGTCTCCCGCCCAGGCTGG + Intronic
1163286433 19:16351355-16351377 AACGAGCCTCCGCCCCTGGCTGG + Intergenic
1163390227 19:17026434-17026456 ACACAGCCTCCGCGCTGGGCTGG - Intronic
1163709008 19:18834218-18834240 ACCGAGTCTCCCCGACAGGCTGG - Intronic
1164223873 19:23224672-23224694 CCTGAGCCACCCTGCCTGGCTGG - Intronic
1164963795 19:32461377-32461399 TCAGAGCCTTCCAGCTTGGCTGG + Intronic
1166901262 19:46065586-46065608 CCTGAGCCACCGCGCCTGGCTGG + Intronic
1167265116 19:48479239-48479261 ACGGAGCTGCCCCGCCTGGGTGG + Exonic
1167299690 19:48671610-48671632 TCAGAGACACCCAGCCTGGCAGG + Intronic
925158161 2:1662747-1662769 ACAGAGCCAACCCGGCGGGCCGG + Intronic
925180975 2:1816812-1816834 ACAGGGCCTCACTGCCCGGCTGG + Intronic
925189081 2:1868597-1868619 AAAGAGCCTTCCTCCCTGGCTGG - Intronic
925295586 2:2774319-2774341 CCAGTGCATCCCAGCCTGGCAGG + Intergenic
925298649 2:2794745-2794767 ACAGAGCCTCCTCGAGTGACAGG + Intergenic
926242576 2:11099925-11099947 ACGGAGCCTTCCCGCCAGGCAGG - Intergenic
926289697 2:11518815-11518837 AGTGAGCCACCTCGCCTGGCGGG - Intergenic
927275476 2:21258795-21258817 CCAGAGCGTCCCTGCTTGGCTGG - Intergenic
928266530 2:29816792-29816814 ACAGCTCCTCCCAGCCTGACGGG + Intronic
933566107 2:83952563-83952585 AGTGAGCCACCGCGCCTGGCCGG - Intergenic
934084656 2:88500085-88500107 AGTGGGCCTCCCTGCCTGGCTGG + Intergenic
937097974 2:119248050-119248072 CCAGCGCTTCCCCGACTGGCTGG + Exonic
938069257 2:128299915-128299937 CCAGAGCCACCCTGCCTTGCTGG - Intronic
938267500 2:129939034-129939056 ACAGGTCCTCCCAGCCTGGCTGG + Intergenic
939979731 2:148765754-148765776 AGTGAGCCACCACGCCTGGCCGG - Intronic
940909712 2:159199897-159199919 ACAGAGCTTCACCTTCTGGCAGG + Intronic
944361990 2:198868269-198868291 CATGAGCCTCCACGCCTGGCCGG + Intergenic
945569972 2:211454857-211454879 TCAGTGCCTCCCCGCCAGGACGG + Intronic
945929540 2:215841475-215841497 ACAGACCCTGCCGGGCTGGCAGG - Intergenic
948166613 2:235867479-235867501 CCAGAGCCTTCCCGCCTAACAGG - Intronic
949032804 2:241804974-241804996 ACAGAGCCTCCCTGCCTGGCAGG + Intergenic
1171184749 20:23117354-23117376 ACAGAGCATCCACCCCTGGCTGG - Intergenic
1172308799 20:33900924-33900946 ACAGAGCTTCCCCGCCTTCTGGG - Intergenic
1173325244 20:42027018-42027040 ACAGAGTTTCCTCCCCTGGCAGG + Intergenic
1174220678 20:48952391-48952413 AGTGAGCCACCCTGCCTGGCTGG + Intronic
1174236657 20:49099216-49099238 ACAAAGCCTTCCCGCCTTCCAGG - Intergenic
1174395124 20:50242635-50242657 ACTGAGGCTCCCAGCCGGGCAGG - Intergenic
1175029075 20:55934119-55934141 CATGAGCCACCCCGCCTGGCTGG + Intergenic
1175318529 20:58069364-58069386 TCAGAGCCTCCTCGCTGGGCTGG - Intergenic
1175763594 20:61577989-61578011 ACACAGCCTCCCCACCATGCAGG + Intronic
1177148403 21:17430665-17430687 AGCGAGCCACCACGCCTGGCTGG - Intergenic
1178605571 21:34033855-34033877 ACAGAGCCTCCCAGGCCGGATGG + Intergenic
1179108435 21:38424367-38424389 ACAGAGCCCCACAGACTGGCTGG - Intronic
1180943928 22:19679429-19679451 ACAAAGCCACCACCCCTGGCTGG + Intergenic
1181022345 22:20110069-20110091 ACAGGGGCTCACCGCCAGGCTGG - Exonic
1181121612 22:20671028-20671050 ACAACGCCGCCCGGCCTGGCCGG + Intergenic
1182426873 22:30278255-30278277 ACAGAGCCCCCCCACCCTGCTGG - Intergenic
1182518621 22:30872793-30872815 ACAGCCACTCCTCGCCTGGCAGG + Intronic
1182887346 22:33786600-33786622 TCAGAGCCTCCCCTCCTGAGGGG + Intronic
1183056059 22:35306680-35306702 ACAGAGACTTCCTGTCTGGCAGG - Intronic
1183932064 22:41240925-41240947 ACAGGCTGTCCCCGCCTGGCAGG + Exonic
1184840850 22:47051623-47051645 ACAGAGCTCCACAGCCTGGCAGG - Intronic
1185305460 22:50112933-50112955 ACAGAGCAGCCCCTCCTGGCGGG - Intronic
1185325340 22:50222783-50222805 CCAGGGTCTCCCAGCCTGGCAGG - Intronic
949216893 3:1581836-1581858 CCAGAGCCTCCCCACGTGTCTGG - Intergenic
950021365 3:9789945-9789967 TCAGATCCTCACCGACTGGCAGG - Exonic
953341693 3:42139969-42139991 ATACAGCCTCCCAGGCTGGCAGG + Intronic
953598228 3:44338060-44338082 GCAGAGCCTCGCCCCCTGCCAGG + Intergenic
954336496 3:49921437-49921459 CCTGAGCCACCACGCCTGGCTGG + Intronic
954637016 3:52076476-52076498 GAAGAGCCTCCCAGGCTGGCAGG + Intronic
955387723 3:58492393-58492415 ACCGCGCATCCCCGCCGGGCGGG - Intronic
959661391 3:108872537-108872559 GCGGAGCCACCACGCCTGGCTGG + Intergenic
960992865 3:123323147-123323169 ACAGAGGCTCCTGTCCTGGCTGG - Intronic
965392376 3:168120395-168120417 AGTGAGCCACCGCGCCTGGCCGG + Intergenic
966781788 3:183590480-183590502 AGTGAGCCACCGCGCCTGGCCGG + Intergenic
966887755 3:184386273-184386295 ACAGCGCCCCCCCGGCTGGTGGG + Intronic
967610475 3:191499916-191499938 ACAGCGCCTGCCTGCCTGCCCGG + Intergenic
968729681 4:2263771-2263793 CCAGAGCCTCCTGGCCTGGCTGG + Intergenic
976039541 4:80866409-80866431 ACAGAGACTCCCTGCCTGCCTGG - Intronic
976192199 4:82498566-82498588 AGTGAGCCACCGCGCCTGGCTGG + Intronic
982013526 4:151129649-151129671 AGTGAGCCTCAGCGCCTGGCCGG + Intronic
984462799 4:180058462-180058484 ACTGAGCCTTCTCGCCCGGCCGG + Intergenic
985550639 5:531777-531799 CCAGAGCCACCCCCACTGGCAGG - Intergenic
985777517 5:1852513-1852535 CCAGAGGCTCCCGGCCTGGGTGG + Intergenic
987043814 5:14087636-14087658 TGTGAGCCACCCCGCCTGGCTGG - Intergenic
991727053 5:69546016-69546038 AGTGAGCCACCGCGCCTGGCCGG + Intronic
991867904 5:71081858-71081880 AGTGAGCCACCGCGCCTGGCCGG - Intergenic
993178658 5:84520249-84520271 GCAGAGCTTCTCTGCCTGGCAGG + Intergenic
995194284 5:109346288-109346310 ACTGGGCCTCCCCTCCTGGTTGG + Intronic
996405668 5:123099978-123100000 ACAGCGCCTCCCCACCGAGCAGG + Intronic
999330905 5:150672651-150672673 ACAGCGCCTCCGCACCTGGTAGG + Intronic
1001294423 5:170489112-170489134 GGTCAGCCTCCCCGCCTGGCTGG - Intronic
1001515599 5:172353372-172353394 TCAGAGCCTCCCAGGCAGGCAGG - Intronic
1001785748 5:174411574-174411596 CCAGTCCCTCCCTGCCTGGCTGG - Intergenic
1002549290 5:179975046-179975068 ACAGAGCCTCCCCGCCTGGCTGG - Intronic
1002845586 6:941698-941720 AGAGAGCAGCCCCTCCTGGCTGG - Intergenic
1003049054 6:2764269-2764291 GCTGAGCCACCACGCCTGGCTGG - Intergenic
1004311438 6:14549391-14549413 CCAGAGCCACCACACCTGGCAGG + Intergenic
1005459714 6:26056539-26056561 TCAGAGCCTGCCAGCCAGGCGGG - Intergenic
1007458466 6:41998958-41998980 TGTGAGCCACCCCGCCTGGCTGG + Intronic
1009728354 6:67563206-67563228 AATGAGCCACCGCGCCTGGCTGG + Intergenic
1011589881 6:88962348-88962370 CGAGAGCCACCCCGCTTGGCCGG - Intronic
1012313193 6:97754225-97754247 AGTGAGCCACCGCGCCTGGCCGG - Intergenic
1015685239 6:135851653-135851675 ACAGCACCTCCCAGCCTAGCAGG + Intergenic
1018393024 6:163355146-163355168 ATGGAGGCTCCCAGCCTGGCCGG + Intergenic
1018973442 6:168545509-168545531 ACAGAGCCACCCCGTCTGTGAGG + Intronic
1019042458 6:169118455-169118477 ACAGTGGCTCCCCTCCCGGCTGG + Intergenic
1019159851 6:170062592-170062614 ACAGAGCCAGCCAGCCTGGAGGG + Intergenic
1019179318 6:170176826-170176848 GCACAGCCGCCCAGCCTGGCCGG + Intergenic
1019421405 7:952951-952973 TCTGGGCCTCCCAGCCTGGCAGG - Intronic
1019437743 7:1030696-1030718 AGAGAGAGTCCCCGCCTGCCTGG - Intronic
1020109913 7:5442140-5442162 AGAGCGCCTCCCAGCCTGCCAGG + Intronic
1020400294 7:7769475-7769497 AGAGAGCCTCCCCCACTGACAGG + Intronic
1020461491 7:8434047-8434069 CCAGAGCGTCCCCGGGTGGCCGG + Exonic
1025783503 7:64622808-64622830 CCTGAGCCACCGCGCCTGGCTGG - Intergenic
1027427171 7:78072937-78072959 TGTGAGCCACCCCGCCTGGCTGG + Intronic
1029490748 7:100868678-100868700 TGAGAGGCTCCCCGCCTGGGTGG - Exonic
1029611861 7:101630800-101630822 GGAGAGCCCCCCCGCCTGCCCGG + Intergenic
1031041625 7:116844311-116844333 AGTGAGCCACCTCGCCTGGCTGG - Intronic
1031407712 7:121406205-121406227 ACTGAGCCACCGTGCCTGGCCGG - Intergenic
1033194472 7:139315774-139315796 CCTGAGCCTCCATGCCTGGCCGG - Intergenic
1034388007 7:150756423-150756445 ACAGAGGCTCCCAGCATGACCGG - Intergenic
1035061839 7:156075142-156075164 AGAGAGCGCCCCCGCATGGCCGG - Intergenic
1035292079 7:157845656-157845678 ACAGAACCTCCCCGCGGGGCAGG + Intronic
1035296393 7:157869212-157869234 GCAGAGCCTCCCAGCATGGGAGG + Intronic
1035352969 7:158259346-158259368 ACAGAGCCACCCTTCCGGGCAGG + Intronic
1038436405 8:27539770-27539792 CCTGAGCCTCCCCACCAGGCGGG - Intronic
1038472541 8:27837651-27837673 CCAGAGTCTCACCGCCTGGAAGG + Intronic
1039396298 8:37227980-37228002 AGTGAGCCACCGCGCCTGGCTGG - Intergenic
1042238233 8:66637059-66637081 GCTGAGCCACCACGCCTGGCTGG - Intronic
1045432675 8:102127954-102127976 AGTGAGCCACCCCTCCTGGCCGG + Intergenic
1045482863 8:102606634-102606656 CCTGAGCCACCACGCCTGGCTGG + Intergenic
1045495397 8:102703805-102703827 CCTGAGCCACCACGCCTGGCTGG + Intergenic
1045626312 8:104056121-104056143 AATGAGCCACCACGCCTGGCCGG - Intronic
1048432508 8:134383361-134383383 CCAGAGCCTGCCCTTCTGGCTGG - Intergenic
1048983165 8:139714208-139714230 ACAGAGCCTCTCAGCAGGGCCGG - Intergenic
1049012393 8:139895929-139895951 GCAGAGCTTCTCAGCCTGGCCGG - Intronic
1049029398 8:140023214-140023236 ACAGAGGGTCCCCAGCTGGCAGG + Intronic
1049285855 8:141774857-141774879 ACAGTGCCACCCAGGCTGGCTGG - Intergenic
1049434378 8:142579675-142579697 CCAGAGCCTCCCGGGCTGGGCGG + Intergenic
1049814484 8:144591796-144591818 GCACAGCCTCCCTGCCTGGAAGG + Intronic
1054454626 9:65423568-65423590 ACTGAGCAGCCCCACCTGGCTGG + Intergenic
1056560648 9:87726440-87726462 ACTGAGCTTCCCTGTCTGGCCGG - Intronic
1058776865 9:108293152-108293174 ACAGAGCCTCACAGGCTGGAAGG - Intergenic
1061537955 9:131261094-131261116 CCAGAGCTTCACCACCTGGCTGG - Exonic
1062282775 9:135759386-135759408 CCGGAGCCTCCCTGCCTGCCGGG - Intronic
1062401678 9:136375504-136375526 ACAGGGACCCCCCACCTGGCTGG - Intergenic
1190230181 X:48575835-48575857 ACAGAGCCTGGCCGCCTGGGAGG + Intronic
1190961504 X:55254168-55254190 AGTGAGCCACCGCGCCTGGCTGG - Intronic
1192847939 X:74925167-74925189 TCAGAGCCTCCGCGGCTGCCCGG + Exonic
1196160378 X:112476136-112476158 ACAGAGGCTCCCAGCATGTCTGG - Intergenic
1196778240 X:119360424-119360446 ACAGACCCTCCACCCCTGGGAGG + Intergenic
1197789975 X:130244494-130244516 TGTGAGCCACCCCGCCTGGCCGG - Intronic
1197981005 X:132217933-132217955 ACAGAGCCTCCCCGGCGGCCGGG - Exonic
1200158299 X:153990057-153990079 GCAGAGCCTCCCCACCCGGCTGG + Intergenic
1201010696 Y:9546782-9546804 ACAGAGCATCTCCGCCTTGTGGG - Intergenic