ID: 1002549292

View in Genome Browser
Species Human (GRCh38)
Location 5:179975073-179975095
Sequence CACGGGACTCTGAACAGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 69}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002549292_1002549296 -9 Left 1002549292 5:179975073-179975095 CCAAGTCTGTTCAGAGTCCCGTG 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1002549296 5:179975087-179975109 AGTCCCGTGGGAAGACGGTGAGG 0: 1
1: 0
2: 0
3: 4
4: 112
1002549292_1002549297 -8 Left 1002549292 5:179975073-179975095 CCAAGTCTGTTCAGAGTCCCGTG 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 89
1002549292_1002549300 17 Left 1002549292 5:179975073-179975095 CCAAGTCTGTTCAGAGTCCCGTG 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1002549300 5:179975113-179975135 CAGAACCGCTTAGCAACATGAGG 0: 1
1: 0
2: 0
3: 5
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002549292 Original CRISPR CACGGGACTCTGAACAGACT TGG (reversed) Intronic
900184621 1:1327236-1327258 CACAGGTTTCTGAACAGCCTGGG + Exonic
900982488 1:6054225-6054247 CAAGGGACTCTGAGGAGTCTCGG + Intronic
901013444 1:6213786-6213808 GTCAGGACTCTGCACAGACTTGG - Intronic
907737738 1:57131417-57131439 CACAGGACTCTCAAAAGACTGGG - Intronic
913474797 1:119227039-119227061 CACAGGGCTTTGCACAGACTAGG + Intergenic
916653578 1:166852687-166852709 CACGGGGCTCTGAACAGCCCCGG + Exonic
918951825 1:191150317-191150339 CAAGGGACTCTGAGCAGAGGTGG + Intergenic
920763724 1:208811133-208811155 CACAGGACTAGGAACAGATTGGG - Intergenic
921584547 1:216931628-216931650 CCTGGGACTCTGAACACCCTTGG + Intronic
1062947014 10:1469046-1469068 GAGGGCAATCTGAACAGACTGGG - Intronic
1071507563 10:86241846-86241868 CCCGGGGCTCTGACCAGGCTGGG - Intronic
1074770538 10:116730843-116730865 CAAGGGCCTCTGTACAGCCTAGG + Intronic
1074813131 10:117125256-117125278 CACTGGTCTCTGAACAGAGACGG + Intronic
1076787833 10:132759824-132759846 CAGGGGACTCTGAACAGGGCCGG - Intronic
1079104320 11:17560765-17560787 CACGGGACTCTGTACCCACCTGG + Exonic
1082997537 11:59265660-59265682 CAGGGGACTCTGAAGGGACAAGG - Intergenic
1085766451 11:79287370-79287392 CACTGGACCCTGAGGAGACTAGG - Intronic
1091053187 11:132393471-132393493 CACTGCACTCTGAACCTACTAGG - Intergenic
1114619761 14:24088350-24088372 CAGGAGACTGTGGACAGACTTGG + Intronic
1117319079 14:54603494-54603516 CACTGGACTCAGAACAGAACTGG - Intronic
1119210614 14:72828864-72828886 CACTGGACTGGGAAGAGACTGGG + Intronic
1125716618 15:41823193-41823215 CACCAGACTGTGCACAGACTGGG - Exonic
1130958640 15:88645066-88645088 CACGGAACCCTGCTCAGACTGGG + Intronic
1134267799 16:12706782-12706804 CACAGGAGGCTGAGCAGACTGGG + Intronic
1139727596 16:68913949-68913971 CAAGGGACTCTGAACTGGGTGGG + Intronic
1142264182 16:89056036-89056058 CATGTGACTCTGCACACACTTGG - Intergenic
1156001703 18:32392096-32392118 TAAGGTATTCTGAACAGACTTGG + Intronic
1157966523 18:52214967-52214989 CACGGGACTATGCACATAGTAGG - Intergenic
1160836041 19:1124835-1124857 CAGGGGTCTCCGAACTGACTGGG + Intronic
1167606215 19:50482263-50482285 GACGGGACGCTGACCAGCCTGGG - Exonic
930949195 2:57116740-57116762 CAGGGGACTATGAAGAGATTAGG + Intergenic
936144022 2:109967211-109967233 CATGGGTCTGTGCACAGACTGGG - Intergenic
936180704 2:110265172-110265194 CATGGGTCTGTGCACAGACTGGG - Intergenic
936200665 2:110404258-110404280 CATGGGTCTGTGCACAGACTGGG + Intronic
936379073 2:111968350-111968372 CAGGGGACTCTGTACAGAGATGG - Intronic
939038322 2:137159221-137159243 CAGGGGTCTCAGAACAGCCTAGG + Intronic
943598106 2:189881295-189881317 CGGGTGACTCTGAACAGAATGGG - Intronic
946099083 2:217303282-217303304 AACTGGACTCGGAACAAACTGGG + Intronic
946306657 2:218860166-218860188 CCCGGGACCCAGGACAGACTGGG + Intronic
947356580 2:229302148-229302170 CAAGTGACTCTGAAGAGTCTCGG - Intergenic
948046583 2:234950806-234950828 CTCGGGAGTCTGAACATACCCGG + Intergenic
1170035633 20:11986577-11986599 CAGGGAACTGGGAACAGACTGGG - Intergenic
1171494688 20:25547584-25547606 CAGGGGCCTCTGAAGAGAATTGG + Intronic
1172700419 20:36850182-36850204 CATGGGACTCTGTACTGCCTGGG + Intronic
1173648485 20:44648441-44648463 CACGGGACACTGACCATACAGGG + Intronic
1177833343 21:26164476-26164498 CAAGGAACTGTGAACAGACTTGG - Intronic
1182699958 22:32228667-32228689 CAGGGGACCCTGAGCAGCCTGGG - Intronic
950495757 3:13333379-13333401 CACTGGCCTCTGATCAGACCAGG + Intronic
952234025 3:31460636-31460658 TATGGCAGTCTGAACAGACTAGG - Intergenic
955445004 3:59000524-59000546 CAGGGGACTATGAAGAGATTTGG + Intronic
958863462 3:99471929-99471951 CAAGGGACTCCATACAGACTCGG + Intergenic
960662460 3:120075897-120075919 CACCAGACTCTGAACAGCCAAGG + Intronic
961404551 3:126668883-126668905 CACTGGCCTCTGATCAGACCAGG - Intergenic
962994418 3:140611379-140611401 CTGGGGAGTCTGAACAGACATGG - Intergenic
965532892 3:169792579-169792601 AACTGGACTCTGACCAGACTAGG - Intergenic
970559176 4:17266250-17266272 CAAGGGGCTCTGATCTGACTGGG - Intergenic
971982617 4:33772745-33772767 CATGGGACTGTGAACAGCCAAGG + Intergenic
1001329229 5:170750633-170750655 CACAGGACTCAGAACAGAGCAGG - Intergenic
1002549292 5:179975073-179975095 CACGGGACTCTGAACAGACTTGG - Intronic
1006808829 6:36806742-36806764 CACTGGAGTCTGAGCAGAATAGG - Intronic
1011348788 6:86400077-86400099 CACAGGTCTCTGAAAAGTCTTGG + Intergenic
1015655972 6:135519526-135519548 CACAGCACTCTGCACAGAGTAGG + Intergenic
1019368421 7:647291-647313 GACGGGACAGTGGACAGACTGGG - Intronic
1022094107 7:27128115-27128137 CACTGAACTCTGAGCACACTTGG - Intronic
1025190273 7:56890982-56891004 GAGGGGACACTGAACAGACCTGG + Intergenic
1025681666 7:63685938-63685960 GAGGGGACACTGAACAGACCTGG - Intergenic
1029876473 7:103758059-103758081 CAGGGAACTCTTAACAGAATTGG - Intronic
1036669124 8:10768513-10768535 CACGGGTCACTGCACAGGCTTGG + Intronic
1036868108 8:12417742-12417764 CACAGGACTCTAAACAGAAAGGG + Intergenic
1040464625 8:47682985-47683007 CAAGGGACTGTGATCAGGCTTGG + Intronic
1060785599 9:126449636-126449658 CATGGGACTCAGAACATACTGGG - Intronic
1062645704 9:137547124-137547146 GAAAGGGCTCTGAACAGACTTGG + Intronic
1188140896 X:26549387-26549409 CATGGCACTCTGTACAGACTTGG - Intergenic
1188264118 X:28049422-28049444 CACTGGATTCTGAACAGAAAAGG - Intergenic
1190254792 X:48754323-48754345 GACTGGACTGTGGACAGACTTGG - Intergenic
1190936373 X:55002217-55002239 CAGGGCACTCTGAGCAGACCTGG - Intronic