ID: 1002549297

View in Genome Browser
Species Human (GRCh38)
Location 5:179975088-179975110
Sequence GTCCCGTGGGAAGACGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002549292_1002549297 -8 Left 1002549292 5:179975073-179975095 CCAAGTCTGTTCAGAGTCCCGTG 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 89
1002549291_1002549297 15 Left 1002549291 5:179975050-179975072 CCAGGCGGGGAGGCTCTGTCTTG 0: 1
1: 0
2: 0
3: 13
4: 337
Right 1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 89
1002549290_1002549297 19 Left 1002549290 5:179975046-179975068 CCAGCCAGGCGGGGAGGCTCTGT 0: 1
1: 1
2: 0
3: 18
4: 238
Right 1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002549297 Original CRISPR GTCCCGTGGGAAGACGGTGA GGG Intronic
901817273 1:11801446-11801468 GCCCCATGGGAAGGCAGTGACGG - Intronic
903377498 1:22876079-22876101 GTGCAGTGGGAAGCCGCTGAGGG + Intronic
904437340 1:30507373-30507395 GTCCGGAGGGAGGACGGTGATGG + Intergenic
906245284 1:44269040-44269062 GTCCCATTGGAAGAAGTTGAGGG - Intronic
907605604 1:55814375-55814397 GTCCCATAGGAAGATGCTGAGGG - Intergenic
914454876 1:147826636-147826658 GAAGCGTGGGAAGAGGGTGAGGG - Intergenic
915275519 1:154785422-154785444 GGCCCTTGGGAAGGAGGTGAAGG - Intronic
917628775 1:176872822-176872844 GTGGCTTGGGAAGAAGGTGAGGG - Intronic
919916749 1:202144037-202144059 GTCCCGCGGGTAGAGGGTCACGG - Intronic
921067512 1:211633124-211633146 GTCCCGGAGGAAGACAGTGAGGG + Intergenic
922707100 1:227795531-227795553 CTCCCGTGGGAAGAAGGGGGTGG - Intergenic
1073140452 10:101243663-101243685 GTCCATTGGGTAGACGGTTAGGG - Intergenic
1073380558 10:103074908-103074930 GTCCTGTTTTAAGACGGTGATGG + Intronic
1076364975 10:129915896-129915918 GGCCCCTGGGGAGACGGGGAGGG + Intronic
1081806225 11:45892247-45892269 GTCCTCTGGGAAGACGGTGCTGG - Intronic
1082843085 11:57705140-57705162 ATTCTGTGGGAAGAAGGTGAAGG - Exonic
1083738571 11:64695426-64695448 GTCAAGTGGGAAGAAGGCGAAGG + Intronic
1086919773 11:92573232-92573254 GTGCCGTGGGATGACCCTGAAGG + Intronic
1088196136 11:107276053-107276075 GTCCCATGGGGACATGGTGATGG - Intergenic
1091551587 12:1539159-1539181 GTCCCGTGGGGAGAGCGGGAGGG + Intronic
1096216714 12:49801762-49801784 GGCACGTGAGAAGACAGTGATGG + Intronic
1100339119 12:93661132-93661154 GTCCCCTGGGACAAAGGTGAAGG - Intergenic
1102665239 12:114566368-114566390 TTCCCCTGGGAAGATGCTGAGGG + Intergenic
1119898675 14:78242371-78242393 GACCTGTGGGAAGAGGGGGAGGG - Intronic
1122784069 14:104155851-104155873 GCCCTGTGGGAAGAGGGTGGAGG + Intronic
1129590187 15:76907852-76907874 GTCCAGTGGGAAAAGAGTGAAGG - Intergenic
1131525706 15:93150861-93150883 GTCCCGGGGGAAGAGGTTAAAGG + Intergenic
1131643358 15:94315529-94315551 GTACCGGGGGAAGCCAGTGATGG + Exonic
1131912613 15:97224467-97224489 GTCCCGTGGGTAGGCGGCTAAGG - Intergenic
1134252610 16:12585064-12585086 GTATTGTGGGAAGTCGGTGAAGG - Intergenic
1135589576 16:23695385-23695407 GTCCCCTGGAAAGTGGGTGATGG + Exonic
1136504442 16:30693926-30693948 GTCCTGTGGGGAGAGGGAGAAGG + Intergenic
1141801078 16:86309708-86309730 GTCACTTGGGTAGAAGGTGAGGG - Intergenic
1143104154 17:4520038-4520060 GTCCCAAGGGAAGACACTGAGGG + Intronic
1144658082 17:17050814-17050836 GTCCTGTGGGGAGCCGGTGAGGG + Intronic
1145932720 17:28697600-28697622 TTCCTGTGGGAAGAAGGTAAAGG - Exonic
1147715722 17:42506833-42506855 GGCACGTGGGCAGACGCTGATGG - Intronic
1150223584 17:63510670-63510692 ATCCTCTGGGAAGAGGGTGAGGG - Intronic
1152234454 17:79131383-79131405 GTTCAGCTGGAAGACGGTGAAGG - Intronic
1152984685 18:311097-311119 GGGCCCTGGGAAGACTGTGAAGG - Intergenic
1159534013 18:69692109-69692131 TCACCGTGGAAAGACGGTGATGG + Intronic
1163519214 19:17781843-17781865 GGCCCGTGGGAAGTCTGTGTTGG + Intronic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1166810113 19:45509333-45509355 GTCCCGGAGGAAGAGGGCGAAGG - Intronic
1166826564 19:45613514-45613536 GTCCCTTGGGGAGATGGGGATGG - Intronic
926109412 2:10172449-10172471 GAGCTGAGGGAAGACGGTGAAGG + Intronic
926700177 2:15798242-15798264 TTCCCGTGGGCAGGTGGTGACGG - Intergenic
927430834 2:23025018-23025040 GTCCCATGGGAAGACATGGACGG - Intergenic
932431098 2:71674042-71674064 GTCCTGTGGGAAGACTGGGAAGG - Intronic
934780832 2:96968658-96968680 GGCCCCTGGGAGGAGGGTGATGG - Intronic
936043375 2:109167039-109167061 GTCCCGTGGGAATACCATGGAGG + Intronic
936071117 2:109371954-109371976 GTCCCTTGAGAAAACGGGGAAGG - Intronic
940784593 2:157968055-157968077 GTCCCGTGGGAAGGCAGCTAAGG + Intronic
940830250 2:158457715-158457737 GGGGCGTGGGAAGACGGGGAGGG - Intronic
941069943 2:160944589-160944611 GTCCAGTGTGGAGACAGTGAGGG - Intergenic
942894863 2:181040259-181040281 GTCCCGTGGAAGGACGAAGAAGG - Intronic
944128524 2:196320487-196320509 GGCCTGTGGAAAGACGGCGAAGG - Intronic
946417702 2:219548855-219548877 GTCCAGTGGAAAGATGATGATGG + Intronic
1169329716 20:4706682-4706704 GGGCCCTGGGAAGAAGGTGAGGG - Intergenic
1175594981 20:60223863-60223885 ACCCCCTGGGAAGGCGGTGAGGG - Intergenic
1175859604 20:62143265-62143287 GTCGGGCGAGAAGACGGTGATGG + Exonic
1175866962 20:62183889-62183911 GTCCCTTGGGAAGTCTGTGTAGG + Intronic
1179266202 21:39805715-39805737 GTCCCCTGGGAGGACTGTGCTGG + Intergenic
1181583582 22:23841199-23841221 GGCTCGTGGGGAGAAGGTGAGGG + Intergenic
1181685675 22:24526153-24526175 CACCAGTGGGAAGAGGGTGAGGG + Exonic
1182416235 22:30223160-30223182 GTCCAGTGGGAAGACGGACATGG - Intergenic
1183271527 22:36865442-36865464 GTCTCGTGGGAGGAAGCTGAGGG - Intronic
1183859474 22:40659174-40659196 GTCCCGAGGCAAGATGGTAAAGG + Intergenic
965771407 3:172185301-172185323 GTACAGTGGGAAGAAGATGAGGG - Intronic
968441335 4:626009-626031 GTCCAGTGGGAAGACGATCTCGG - Exonic
968596839 4:1490153-1490175 GTCCCGTGGGATGGCGGGTATGG + Intergenic
968953060 4:3704419-3704441 GTCCCCAGGGAAGAGGTTGAGGG - Intergenic
983254626 4:165384076-165384098 GCCCCGTGGTAAGACGGTAAGGG - Intronic
985137486 4:186801787-186801809 GTCCAGAGGGAAGTTGGTGAGGG + Intergenic
994847673 5:105010913-105010935 GTCCTGTGAGAGGACAGTGAGGG + Intergenic
998312481 5:141149190-141149212 TTGCTGTGAGAAGACGGTGAAGG + Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1011095776 6:83660279-83660301 CTCTCGTGAGAAGAGGGTGAAGG + Intronic
1017898469 6:158701421-158701443 GAGCCGTGGGAAGAGGGTCATGG + Intronic
1019572679 7:1720260-1720282 CTCCAGTGGGAAGACGAAGATGG + Intronic
1020140169 7:5607511-5607533 GTGCGCTGGGAAGGCGGTGATGG + Intergenic
1029544483 7:101203013-101203035 GTCCCCTGGGAAGAGGATGGTGG + Intergenic
1033651884 7:143350203-143350225 GTCCCCTGGGAAGAAGGAGGAGG + Intronic
1035435448 7:158856308-158856330 GTCCCGTGGGAACCCGGGGCGGG + Intergenic
1044990088 8:97788142-97788164 TTGCTGTGGGAAGATGGTGATGG + Intronic
1045663056 8:104457994-104458016 GTCCAGTGGGAAGACGAAGGTGG - Intronic
1047388376 8:124430428-124430450 GTACAGTGGGAAGACAGTGGAGG + Intergenic
1048655578 8:136531936-136531958 GTCCTGTGGCAAGACTGTTAAGG + Intergenic
1050534760 9:6622272-6622294 GGCCCGTGGAAAGAGGGAGAGGG - Intronic
1056549013 9:87636069-87636091 GTTCCGTGGGCAGACAGTGTGGG + Intronic
1056771376 9:89480558-89480580 GCCCCGTGGGAAGGCAGTCAAGG + Intronic
1059093665 9:111389315-111389337 GTCCACTGGGAAGATGGTTAAGG - Intronic
1061714983 9:132513442-132513464 GTCCTCAGGGAAGACGGGGAGGG - Intronic
1061737248 9:132670071-132670093 GTCCCGAGGGGAGCCGGGGACGG + Exonic
1062088497 9:134661419-134661441 GTCCTGTGGGCAGATGCTGACGG + Intronic
1186662888 X:11687267-11687289 ATCCCTTGGGAAGGCAGTGATGG + Intergenic
1188268396 X:28107449-28107471 GTCCCTTGGGGTGAGGGTGAGGG + Intergenic