ID: 1002549913

View in Genome Browser
Species Human (GRCh38)
Location 5:179980309-179980331
Sequence ATTCTCTTATATGTAGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002549913_1002549915 -4 Left 1002549913 5:179980309-179980331 CCATGTCCTACATATAAGAGAAT 0: 1
1: 0
2: 1
3: 19
4: 189
Right 1002549915 5:179980328-179980350 GAATGATAAAATAGAAAAAATGG 0: 1
1: 2
2: 11
3: 188
4: 1956
1002549913_1002549917 23 Left 1002549913 5:179980309-179980331 CCATGTCCTACATATAAGAGAAT 0: 1
1: 0
2: 1
3: 19
4: 189
Right 1002549917 5:179980355-179980377 TGTATCAAGATTCAGCATTCTGG 0: 1
1: 0
2: 0
3: 10
4: 128
1002549913_1002549916 -1 Left 1002549913 5:179980309-179980331 CCATGTCCTACATATAAGAGAAT 0: 1
1: 0
2: 1
3: 19
4: 189
Right 1002549916 5:179980331-179980353 TGATAAAATAGAAAAAATGGTGG 0: 1
1: 0
2: 5
3: 105
4: 1066

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002549913 Original CRISPR ATTCTCTTATATGTAGGACA TGG (reversed) Intronic
901557216 1:10041160-10041182 ATTTTCTTATCTGTAAAACAGGG - Intronic
903067063 1:20705668-20705690 ATTATCTCATGTGTAGGAAAAGG - Intronic
903744657 1:25578469-25578491 ATTACCTTATGTGTAGGAAAAGG + Intergenic
904462263 1:30687058-30687080 ATTCCCATATTTGGAGGACATGG - Intergenic
908418148 1:63933282-63933304 ATTTCCTTATATGTAAAACAGGG + Intronic
912326816 1:108772938-108772960 AATCTCCTATATGTAGAGCATGG - Intronic
916896921 1:169173170-169173192 ATGTTCTTATTTGTAAGACAAGG + Intronic
917167623 1:172130309-172130331 ATTATCTTGTATAGAGGACATGG + Intronic
917543807 1:175941312-175941334 TTACTCTTATATTTAGGACCAGG + Intergenic
918879242 1:190093939-190093961 ATTATTTAATATTTAGGACATGG - Intergenic
921398806 1:214697416-214697438 TTTGTATTTTATGTAGGACAGGG + Intergenic
923152676 1:231247635-231247657 AGTCTCTTTTATGAAGAACAAGG - Intronic
923367766 1:233279709-233279731 ATTATTATATATGTAGTACAGGG - Intronic
1063771606 10:9209445-9209467 TTTATTTTCTATGTAGGACACGG - Intergenic
1065392545 10:25198423-25198445 ATTCTCTTATATGTTTTAGAGGG + Intronic
1066432737 10:35368478-35368500 ATTCTCATGTATGTGGTACATGG + Intronic
1066654981 10:37688749-37688771 TTTCCCTTATAGGTAGGACGGGG - Intergenic
1070818813 10:79342836-79342858 ATTCCTTTATTTGTAAGACAGGG + Intergenic
1071030931 10:81180403-81180425 ATTCTCTAATATGTTAGACCAGG - Intergenic
1071163774 10:82781401-82781423 TTTCTGTTACATGTAGCACAGGG - Intronic
1071811102 10:89182080-89182102 ATTATCTTATGAGTAGGAAAAGG + Intergenic
1072428805 10:95353275-95353297 ATTCCCATGTATGTAGGCCAGGG - Intronic
1073024089 10:100473634-100473656 ATTCTATTATGGGTTGGACATGG + Intronic
1075528821 10:123209586-123209608 ATTATCTTAAATGCAGAACAGGG - Intergenic
1075581501 10:123622060-123622082 ATGTTTTTATATGTGGGACATGG - Intergenic
1077615949 11:3673898-3673920 ATTCTCTTTTATGCACAACATGG + Intronic
1078389339 11:10922904-10922926 ATTCTCTTGTATGTGAGCCATGG + Intergenic
1079021736 11:16914772-16914794 ATTTTCTCATATGTAAAACAGGG - Intronic
1081091703 11:38877496-38877518 ATTCTCTTAAATCTCGGAAATGG + Intergenic
1082639072 11:55633125-55633147 ATTATCTAAGATGTAGAACATGG + Intergenic
1083240969 11:61388280-61388302 ATGTTCTTATATATAGTACAGGG + Intergenic
1085247337 11:75113447-75113469 GTTATCTTATGTGTAGGAAAAGG - Intronic
1086729868 11:90235655-90235677 GTTGTCTTATGTGTAGGAAAAGG + Intergenic
1086823901 11:91471289-91471311 ATTATCTTATTTGTAGGAAAAGG - Intergenic
1091801084 12:3324872-3324894 ATTTTCTTATCTGCAAGACAGGG - Intergenic
1092365909 12:7876878-7876900 ACTCTCTTATATATGGGATATGG - Intronic
1093180683 12:15963995-15964017 ATTCTCTTATATAAAGTCCAGGG + Intronic
1094528430 12:31249428-31249450 GTTCTGCTATATGTAGGTCAGGG - Intergenic
1097063912 12:56306192-56306214 ATTCCTTTAAATATAGGACAGGG - Intronic
1097806268 12:63968178-63968200 TTCCTCTTATATTTATGACAAGG + Intronic
1098560309 12:71865308-71865330 ATTCTCTTAACTGGAGGGCAGGG + Intronic
1098724394 12:73944584-73944606 ATTCTCTTTTCTTTAAGACAGGG + Intergenic
1099157967 12:79203332-79203354 ATTCTCTCATACTTACGACATGG + Intronic
1100353793 12:93809762-93809784 ATTTTCATATATGTAGAAAAGGG - Intronic
1100659094 12:96677705-96677727 ATTCTCTTAAATGTGTGATAGGG + Intronic
1104072611 12:125359182-125359204 ATTATCTTATGTGCAGGAAAAGG - Intronic
1106174451 13:27317938-27317960 AGTCTTTTGAATGTAGGACATGG + Intergenic
1108266514 13:48714191-48714213 ATTATCTTATGTGTAGGAAAAGG + Intergenic
1109779070 13:67083898-67083920 ATTCCTGTAAATGTAGGACACGG + Intronic
1109845573 13:67985907-67985929 AATATCTTATGTGTAGGAAAAGG - Intergenic
1110897403 13:80772229-80772251 ATTTTCTTACATGTAGAATAGGG + Intergenic
1111753290 13:92361045-92361067 ATTCTCTTAGTTGTAGCAGATGG + Intronic
1114908544 14:27162779-27162801 TTTCTCCTAAATGTCGGACATGG - Intergenic
1115932780 14:38516103-38516125 ATTCTTTTATTTGTCTGACAGGG - Intergenic
1116687581 14:48060083-48060105 ATTCTCTTTTATGTAAGATGTGG + Intergenic
1117232638 14:53736959-53736981 TTTCTCTTTTATGTTGGAAAGGG + Intergenic
1118436310 14:65773849-65773871 ATTCCCTTACAGCTAGGACATGG + Intergenic
1118520139 14:66574155-66574177 ATTCTCTTGTATCTACTACAGGG + Intronic
1123389455 15:19854909-19854931 ATTCTCTGCTATGGAGGGCATGG + Intergenic
1124385973 15:29208268-29208290 ATCTACTTATAGGTAGGACAGGG - Intronic
1126398845 15:48248403-48248425 ATTCGCTTAAATGCAGCACAGGG - Intronic
1127146670 15:56032118-56032140 GTTATCTTATGTGTAGGAAAAGG - Intergenic
1129589314 15:76900940-76900962 ATTTTCTTAAATGTTGGAAAAGG - Intronic
1131139277 15:89963962-89963984 ATTCTTTGATCTGTAGGCCAAGG - Intergenic
1132124449 15:99210181-99210203 ATTCTCATATATTTAGGAAAAGG + Intronic
1135337590 16:21616430-21616452 ATTCTAGTTTATCTAGGACAGGG - Intronic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1138934807 16:61706139-61706161 TTTCTTTTCTCTGTAGGACAGGG - Intronic
1141101955 16:81203968-81203990 ATTATCTTATATGTAAGAAAAGG - Intergenic
1147619553 17:41856288-41856310 ATTTTTTTAAATGTAGGCCATGG - Intronic
1149612984 17:57971279-57971301 CTTCTCTTTTGGGTAGGACAGGG + Intergenic
1151046393 17:70924589-70924611 ATTCTCTTTTCTGAAGGAAAAGG - Intergenic
1153435501 18:5063915-5063937 ATTATCGTATGTGTAGGAAAAGG - Intergenic
1156093271 18:33497527-33497549 CTTCTCTTATATGTAGTGGAAGG - Intergenic
1156663857 18:39381892-39381914 ATTCTGATATATGTGGCACAAGG - Intergenic
1160187525 18:76687088-76687110 TTACTCTTATTTGTAGGCCAAGG - Intergenic
1163476500 19:17529157-17529179 ATTCTCTTATATGTAAAATGGGG + Intronic
926835421 2:17013886-17013908 ATTCTCTTATATGTAAAATGGGG + Intergenic
926943265 2:18160467-18160489 ATTCTCTTCTCAGTAGGAAATGG + Intronic
926955352 2:18289045-18289067 ATTCTCTTGGATTTAGGAGAGGG + Intronic
927258235 2:21059594-21059616 AAACACTTAGATGTAGGACAGGG + Intergenic
928725786 2:34171969-34171991 ATCCTCTGATATGTAGGCGAAGG + Intergenic
929045389 2:37784111-37784133 ATTCTCTCATCTGTAAAACAGGG + Intergenic
929586522 2:43119014-43119036 ATTCTCTTTTATTTAGGGCAGGG + Intergenic
930609811 2:53529332-53529354 ACTTTCTTTTATGTAAGACAAGG - Intergenic
932629143 2:73323352-73323374 ATTCTGTTATGTGTAAGGCAGGG - Intergenic
933468900 2:82694698-82694720 ATTCCTTTATATGAAGGTCAAGG + Intergenic
933514061 2:83278479-83278501 ATTCTCTTACCTGTAGGAACAGG + Intergenic
935383911 2:102481286-102481308 ATTTTCTTATATCTTTGACAAGG + Intronic
935761595 2:106325605-106325627 ATTTTCATATTTGTAGGAAAAGG + Intergenic
937698257 2:124833791-124833813 ACTGTCTTATGTGTAGGAAAAGG + Intronic
937703080 2:124886262-124886284 ATTCTCTAATATGTGGTTCAAGG + Intronic
938531525 2:132192424-132192446 ATTCTCTGCTATGGAGGGCATGG - Intronic
941221393 2:162786379-162786401 GTTCTCTTATCTGTAGGATAGGG - Intronic
941829775 2:169942524-169942546 CTTTTCTTATATGGAGGCCAGGG - Exonic
943166768 2:184338472-184338494 ATTCTCTTATATAAAGAAGAAGG - Intergenic
943410362 2:187539345-187539367 GTTATTTTATATGTAGGACAAGG + Intronic
1169957234 20:11117739-11117761 TTTCTCCTATATGTTGGCCAAGG + Intergenic
1170134743 20:13060343-13060365 ATTAACTTATGTGTAGGAGAAGG + Intronic
1170949402 20:20922642-20922664 ATTCTGTTGTATGCAGGGCAAGG - Intergenic
1174625303 20:51909339-51909361 ATTCTATAAGATGTTGGACAAGG - Intergenic
1174719383 20:52795753-52795775 GTTTTCTTACATGTAAGACAGGG - Intergenic
1174875586 20:54223294-54223316 ACTCAGTTATATGTAGGACTCGG - Intronic
1177205358 21:18003960-18003982 ATTATTTTATGTGTAGGAAAAGG + Intronic
1177611204 21:23450890-23450912 ATTATGTTATGTGTAGGAAAAGG + Intergenic
1177739469 21:25136435-25136457 CTTCTCTGATATGTAGCACCAGG - Intergenic
1180429510 22:15233465-15233487 ATTCTCTGCTATGGAGGGCATGG + Intergenic
1180512118 22:16101799-16101821 ATTCTCTGCTATGAAGGGCATGG + Intergenic
1181591872 22:23890278-23890300 AGTCTCTCATATGTACAACAGGG - Intronic
1184932745 22:47693235-47693257 ATTCTCTCCTCTGTTGGACAGGG - Intergenic
951358352 3:21696010-21696032 CTTCTCTTATTTGTAAAACAGGG - Intronic
952462291 3:33540608-33540630 TTTATCATATATGTAGAACATGG + Intronic
954963648 3:54590615-54590637 ATTATTTTATTTGTAAGACACGG + Intronic
955989852 3:64614918-64614940 ATTCTCTTATTTCAAAGACAAGG + Intronic
955992062 3:64638564-64638586 ATCATCTTATCTGTAGGGCATGG + Intronic
958474367 3:94562417-94562439 ATTCCCTAATATGTGGAACAAGG - Intergenic
958986915 3:100791271-100791293 ATTCTCTTTAAAGTAGGAAAAGG + Intronic
960009416 3:112817151-112817173 ATTCCCTTATGTTTAAGACAGGG - Intronic
960657066 3:120016529-120016551 CATCTCTTATATTTATGACATGG - Intronic
961475404 3:127142867-127142889 ATTTCCTTATCTGTAGGACAGGG - Intergenic
962130510 3:132669049-132669071 ATTCTCTTACCTGTTGGACATGG + Intronic
963040005 3:141063264-141063286 TGTCTCTTATATGTAGCATATGG + Intronic
964699183 3:159544642-159544664 ATTCTCTTTTATGTAGTCCCTGG + Intronic
965864251 3:173184719-173184741 CTTCTCTTCTATGAAGGACCTGG + Intergenic
966428952 3:179810989-179811011 ATTCTCTCATCTGTAGGAAAAGG + Intronic
971501466 4:27322860-27322882 ATGCTCTTATCTGTAGGATATGG + Intergenic
971674530 4:29608687-29608709 ATTTTCTTAAATGCATGACATGG + Intergenic
972464419 4:39340693-39340715 ATTCTCTTGTATGAAGGAAAGGG + Intronic
974679049 4:65137291-65137313 ATTCTCTGATATCTAGGTGAAGG + Intergenic
977027207 4:91834469-91834491 ATTCTTGTGTATCTAGGACAAGG - Intergenic
979300558 4:119081654-119081676 ATTCACTTTTATATTGGACATGG - Intergenic
979964459 4:127061336-127061358 ATTATCTTATATGCAGGAAAAGG - Intergenic
983024857 4:162723382-162723404 ATTCTCTTATATTTAGAAGATGG + Intergenic
983549795 4:169005850-169005872 GTTCTTTTAAATGTAGGAAATGG - Intronic
983571973 4:169219056-169219078 ATTCTCTGTTATGTAAGAAAGGG - Intronic
984301241 4:177920944-177920966 ACTCTCTTATAGGTAGCATATGG + Intronic
986925859 5:12749655-12749677 AATTTCTTTTATGAAGGACATGG + Intergenic
987036145 5:14020605-14020627 ATTTTATTATATGTATTACATGG - Intergenic
988143169 5:27268572-27268594 ATTCTATTATATGTATAAGATGG - Intergenic
989690130 5:44132161-44132183 ATTCTTTTATATCTTGGACTTGG - Intergenic
990695738 5:58414981-58415003 ATTCTCTTCTCAGTAGAACATGG - Intergenic
990986323 5:61643973-61643995 ATTCACTGATATGGAGGTCAAGG + Intronic
996045107 5:118863097-118863119 ATTCTGTTATATATAGGCAATGG + Intronic
996366429 5:122706123-122706145 ATTATCTTAGATCCAGGACAAGG + Intergenic
996415279 5:123203897-123203919 ATGCTCTTAACTGTAGGAGATGG - Intergenic
996428355 5:123340332-123340354 ATTCTCTTTTATCTAGTAGAAGG + Intergenic
996648615 5:125846025-125846047 TTTTTTTTATATATAGGACAAGG - Intergenic
999046319 5:148473509-148473531 ATTCTAAAATATGTAGGACTGGG - Intronic
999720932 5:154398734-154398756 ATTCTCTCATTTGTGGAACAGGG - Intronic
1000104910 5:158050228-158050250 ATTCACTTATGTGTAGGGTAGGG - Intergenic
1000991009 5:167911910-167911932 ATTCTGTTATATGTATGTAATGG + Intronic
1001500642 5:172230553-172230575 ATTCTCTCATATGTAAAATATGG - Intronic
1002549913 5:179980309-179980331 ATTCTCTTATATGTAGGACATGG - Intronic
1003680019 6:8243718-8243740 GTTATCTTATGTGTAGGAAAAGG - Intergenic
1005157730 6:22826458-22826480 ATTCTCATATAGGTAGGCCGTGG - Intergenic
1006212378 6:32407518-32407540 GTTATCTTATGTGTAGGAAAAGG - Intergenic
1007660324 6:43480861-43480883 ATTTTCTCATCTGTAAGACAGGG - Intronic
1008422417 6:51317204-51317226 ATTATCTAATCTGTAGAACAGGG - Intergenic
1008567162 6:52780693-52780715 TTTCTCTTATAAGTTTGACAAGG - Intergenic
1008713720 6:54262525-54262547 CTTCTCATATCTTTAGGACATGG + Intronic
1009213631 6:60893181-60893203 GTCCACTTATATGTAGGAAACGG + Intergenic
1010363439 6:75021966-75021988 ATGCTGTTATATGTAATACAAGG + Intergenic
1011515991 6:88154048-88154070 TTTCTTTCATATGTAGGAAAAGG - Intronic
1011558476 6:88592201-88592223 TTTCTCTTTTCTGTAGGAGAGGG + Intergenic
1013583274 6:111556817-111556839 CAGCTCTTATATGTAGCACAGGG - Exonic
1013914832 6:115323731-115323753 TTGCTATTACATGTAGGACAAGG - Intergenic
1013980555 6:116122368-116122390 TTTCTCTTTTATGTCTGACAGGG - Intronic
1014457048 6:121647996-121648018 ATTCCCTTATCTGTAAAACAGGG - Intergenic
1014882851 6:126744861-126744883 GTTCTCTTATCTGTAAAACAGGG + Intergenic
1015401525 6:132793644-132793666 GTTATCTTATGTGTAGGAAAAGG - Intronic
1017751041 6:157490929-157490951 ATTCTCTTATATGCAAAATAGGG - Intronic
1021609217 7:22441684-22441706 ATTATTTTATGTGTAGGAAAAGG - Intronic
1021772115 7:24014804-24014826 ATAATCTTATATGTAGTAAATGG + Intergenic
1021923476 7:25511304-25511326 ATTTTCTTATATGTAAAACATGG + Intergenic
1022813634 7:33893301-33893323 GTTTTCTTATATGTAAGATAGGG + Intergenic
1023309770 7:38873064-38873086 TTTCACTTATAAGTAAGACAGGG - Intronic
1024472508 7:49777518-49777540 TTTCTCTTATCTGTAAGATAAGG + Intronic
1030105732 7:105985403-105985425 ATTCTCTTCTCTGTAAGGCAGGG - Intronic
1031092955 7:117384277-117384299 TTGCTCTTATATGTGTGACAGGG - Intronic
1033169877 7:139074164-139074186 TTTCTTTTATGTGTAGGACCTGG - Intronic
1033826987 7:145203749-145203771 ATTTTCTCATATGAAGGGCAGGG + Intergenic
1037539625 8:19858338-19858360 TTTCTCTTGGATGCAGGACAAGG - Intergenic
1039002477 8:32996459-32996481 GTTCTCTTCTATGTATGAAAAGG - Intergenic
1039114947 8:34082554-34082576 ATTATTTTATTTATAGGACATGG - Intergenic
1041647586 8:60269276-60269298 ATTTTCATAAATGTAGGAAAAGG - Intronic
1044006157 8:86939394-86939416 ATTCTGTTACATGTAGAACTTGG - Intronic
1044582464 8:93835794-93835816 ATTATCTTATGTGTAGGACAAGG - Intergenic
1045682211 8:104674464-104674486 ATTTTGTTTTATGTAGGACATGG + Intronic
1045872590 8:106943214-106943236 CTTCTCTTATTTCTAGGAAATGG + Intergenic
1046996463 8:120529592-120529614 GCTCCCTTATATGCAGGACAAGG - Intronic
1049965169 9:773008-773030 ATTTTCTTATATTTAAGATAGGG - Intergenic
1050507903 9:6366519-6366541 TTTCTGTTTTTTGTAGGACAGGG - Intergenic
1053874248 9:42526640-42526662 ATTCTCTCATATCTTGGAGATGG + Intergenic
1053898371 9:42767943-42767965 ATTCTCTCATATCTTGGAGATGG - Intergenic
1054268085 9:62940114-62940136 ATTCTCTCATATCTTGGAGATGG - Intergenic
1056837667 9:89970352-89970374 ATTATTTTATGTGTAGGAAAAGG - Intergenic
1057097264 9:92323192-92323214 ATTCTCAAATATTTTGGACAAGG - Intronic
1057900314 9:98943536-98943558 ATTTCCTTATATGATGGACAAGG - Intronic
1058532362 9:105919178-105919200 ATTTTGTTATCTGTAAGACATGG + Intergenic
1059056789 9:110991402-110991424 GTTCTCTTATGTGTAGGAAAAGG - Intronic
1061620074 9:131806262-131806284 ATTCTCAGATTTGCAGGACACGG + Intergenic
1062166069 9:135107914-135107936 AATCTCTTATATTTAAAACATGG + Intronic
1185949377 X:4414559-4414581 ATTCTCTTACATCTATGAGATGG + Intergenic
1186668121 X:11739549-11739571 ATTCTCACATATGTGGGAAATGG + Intergenic
1187977445 X:24717479-24717501 ATGCTCTTACAAGTAGGACACGG - Exonic
1192256787 X:69468177-69468199 ATTCTCTTACATGTAGGCAAGGG - Intergenic
1192829040 X:74730889-74730911 ATTTTCTTATATGTAAAATAGGG + Intergenic
1192855180 X:75001342-75001364 AATGTTCTATATGTAGGACATGG - Intergenic
1195446761 X:104960911-104960933 AATCTCTTATATTTATGACTTGG + Intronic
1195565436 X:106334172-106334194 ATCCTCTGAGATGTAGGACTAGG + Intergenic