ID: 1002553017

View in Genome Browser
Species Human (GRCh38)
Location 5:180011474-180011496
Sequence ATATATACAAAGGTTGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 263}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002553017 Original CRISPR ATATATACAAAGGTTGAGGG TGG Intronic
902863916 1:19265225-19265247 AGATATAAAATGGCTGAGGGAGG + Intergenic
903959801 1:27049721-27049743 ATATATACAGAGGCTGGAGGAGG + Intergenic
904152455 1:28453508-28453530 ATATATACATAGGTGGTGGCTGG + Intronic
904632553 1:31853566-31853588 ATATATATAAAGGATGAGAAAGG + Intergenic
905030455 1:34879547-34879569 ATATATACATATGATGAAGGAGG + Intronic
906729891 1:48071996-48072018 AAATATAAAAAGGATGAGGTGGG - Intergenic
906832029 1:49043201-49043223 AGATATAGAAAGGTGGAGAGTGG - Intronic
907074745 1:51568010-51568032 CTATTTACAAAGGTTGGGGCAGG + Intergenic
907183887 1:52594362-52594384 ATATTTTCAGAGGTTGGGGGTGG - Intergenic
907624184 1:56012102-56012124 AGATAAGCAAATGTTGAGGGAGG + Intergenic
910225440 1:84931416-84931438 ATATATAAAAAGGCTGATGAAGG + Exonic
910454233 1:87378870-87378892 AGATAAGCAAATGTTGAGGGAGG - Intergenic
915116786 1:153606417-153606439 ATATATACAGAGGCTGGAGGAGG - Intergenic
915159474 1:153907522-153907544 ATATATACAAAGTTTCAGTTTGG + Intronic
915262892 1:154691563-154691585 ATATATACCAAAGTTCAGGCCGG - Intergenic
917021218 1:170590403-170590425 ATATATACAGATTTTGAAGGTGG + Intergenic
917065738 1:171091258-171091280 ATATAGTAAAGGGTTGAGGGTGG + Intronic
917153866 1:171974098-171974120 ATAAACTCAAAGGTTGAGAGAGG + Intronic
919067176 1:192707311-192707333 ACATACACAATGGTTGTGGGGGG - Intergenic
919158258 1:193795588-193795610 ATAAATACAAAGGTTTAAGGAGG + Intergenic
921201834 1:212814113-212814135 ATATATACAGAGGTTCAGCCAGG - Intronic
924455183 1:244213723-244213745 AGACATTCAAAGTTTGAGGGAGG + Intergenic
1064176034 10:13075948-13075970 AGATATCCAAAGGCTGAGGCAGG + Intronic
1064466770 10:15590937-15590959 ATCTATACAAAGTTTGGGGTGGG + Intronic
1065224466 10:23528988-23529010 ATATAGAAAAAGCTTAAGGGAGG - Intergenic
1065332505 10:24616964-24616986 CTATATACTAAGGTTGCAGGAGG - Intronic
1065432196 10:25670944-25670966 ATACATACTAAGTTTGGGGGGGG - Intergenic
1066110041 10:32187722-32187744 ATATATACAGAGGCTGGAGGAGG + Intergenic
1067046435 10:42987912-42987934 TTATGTACAAAGGATGTGGGCGG - Intergenic
1068074832 10:52239653-52239675 ATATATACAAGTGTAGAGTGAGG + Intronic
1069159102 10:65070051-65070073 ATATCTAAAAATGCTGAGGGGGG - Intergenic
1069308271 10:67000559-67000581 ATAGATACAGAGGTTGGAGGAGG - Intronic
1071175473 10:82922096-82922118 ATATATAGAGAGGTGGCGGGTGG - Intronic
1073592554 10:104770675-104770697 ATATATACATAGGCTGGGTGTGG + Intronic
1073915929 10:108403433-108403455 TTATATACAAAGGCCGAGGAGGG + Intergenic
1074150846 10:110758495-110758517 ATATATCCAAAGTTTAAGGCAGG + Intronic
1074584507 10:114754268-114754290 ATTTATGCAAAGGGTGAAGGGGG - Intergenic
1077732120 11:4742590-4742612 ATATATATAAAAATTGAGGAAGG - Intronic
1079285180 11:19123327-19123349 GTATAAACAAAGGGTCAGGGTGG + Intronic
1079828986 11:25237103-25237125 AAATATAGAATAGTTGAGGGAGG - Intergenic
1080676725 11:34434759-34434781 ATAAATACAAATGTAGAGGAAGG + Intergenic
1082137646 11:48567862-48567884 ATATGTAGAAATGTTGAAGGGGG - Intergenic
1086734389 11:90287428-90287450 TTATATCCACAGGTAGAGGGAGG + Intergenic
1087884986 11:103469862-103469884 TTATATACAAAAGTTAAGGTTGG + Intronic
1088668420 11:112117819-112117841 ATATATATAAAGGTCGGGTGTGG - Intronic
1088840306 11:113621639-113621661 TTATTTGCAAGGGTTGAGGGGGG + Intergenic
1090668690 11:128931126-128931148 ACATACATAGAGGTTGAGGGAGG - Intergenic
1090978197 11:131693682-131693704 ATATATACATAGGATTTGGGTGG - Intronic
1091490867 12:931418-931440 ACATAAACAAAGGTTCTGGGGGG - Intronic
1095328430 12:40926863-40926885 ATAAATACAAGAGTTGAGGGTGG + Intronic
1095556404 12:43511048-43511070 CTAGATACAAAGGGTGAAGGAGG - Intronic
1097161774 12:57051294-57051316 ATATATTTGAAGGTGGAGGGGGG + Intergenic
1097299253 12:58000545-58000567 AGATAAACAAAAGCTGAGGGGGG - Intergenic
1098065985 12:66616676-66616698 AAGTATACAAAAGGTGAGGGAGG + Intronic
1098918320 12:76279747-76279769 ATCCATACAGAGGTGGAGGGAGG + Intergenic
1099309296 12:80997626-80997648 ATAAAAACAAAGGTTTAGAGGGG + Intronic
1099835422 12:87905021-87905043 ATATATACAAAGCTTACGTGAGG + Intergenic
1100479173 12:94961321-94961343 ATCTATCCAAAGCTTCAGGGAGG - Intronic
1102643637 12:114388728-114388750 AAAAAAAAAAAGGTTGAGGGAGG - Intronic
1102746969 12:115257706-115257728 AGATTTACAAAGGCTGAGTGAGG + Intergenic
1102849719 12:116229135-116229157 ATATACACAAATGGTGAGGGGGG + Intronic
1102935416 12:116892330-116892352 ATATATACAAAGAGTGAGGAAGG + Intergenic
1103013400 12:117475378-117475400 ATATATAGAAGGGTTGGGGGAGG - Intronic
1105784518 13:23735199-23735221 ATATATACAGAGGCTGGAGGAGG - Intronic
1107261980 13:38503322-38503344 ATATATACAAATGCTTGGGGAGG - Intergenic
1108618755 13:52160473-52160495 ATATATATAAAGGAGGAGGTGGG + Intergenic
1109715138 13:66212207-66212229 AAAAATACAAAGTTTGAAGGAGG + Intergenic
1109871672 13:68341311-68341333 ATATTTAAAAAGGATGAGTGAGG - Intergenic
1109970063 13:69756204-69756226 ATATCTACATATGTTGAGGTTGG + Intronic
1109973033 13:69795253-69795275 AAATATACACAGATTGATGGGGG - Intronic
1111394798 13:87651375-87651397 ATATATACAGAGAGAGAGGGAGG + Intergenic
1111765670 13:92524982-92525004 AAATAAAGAAAGGTTGAGTGGGG + Intronic
1112121010 13:96411418-96411440 ATATTTACAAAGGTTGAGATGGG + Intronic
1112983561 13:105418125-105418147 AAATATACAAAGGATGAGGAAGG - Intergenic
1113512456 13:110867047-110867069 AAATATACAAAGGATGACGAGGG - Intergenic
1114662551 14:24356788-24356810 ATATATATATAGGCTGGGGGCGG - Intergenic
1115480334 14:33854797-33854819 TTATATCCAAAGGTTGAGATGGG - Intergenic
1115519592 14:34220169-34220191 ATATATACACAGAGTGAGAGGGG - Intronic
1116664336 14:47755638-47755660 AGATATACATAGATGGAGGGTGG + Intergenic
1116918200 14:50545647-50545669 ATAGATACAAAAGTTAAGGGAGG + Intronic
1118899888 14:69977745-69977767 ACATATACACATGTTGAGTGGGG - Intronic
1119134082 14:72200879-72200901 AAATAGTCAAAGGATGAGGGGGG + Intronic
1120425433 14:84341616-84341638 ATATATGCAAAGGCTGGAGGAGG - Intergenic
1121083220 14:91125654-91125676 ACAAATACAAAGGTTAAGGTTGG + Intronic
1121760184 14:96438389-96438411 TTATATAGGAAGGTTGAGGAAGG + Intronic
1122667340 14:103340486-103340508 ATTTATAAAATGGTTGAAGGAGG + Exonic
1123169268 14:106355938-106355960 AAATATACAGAGGTTCAGAGGGG + Intergenic
1125161114 15:36644884-36644906 ATTAATACAAAGGTTGAAAGAGG + Intronic
1125917891 15:43505717-43505739 ATATCTAAAAAGGTTGAGATGGG - Intronic
1126135606 15:45387728-45387750 ATATTTACAATGTTTGAGAGAGG + Intronic
1126411800 15:48379843-48379865 ATATTGACCAAGGTTGATGGAGG + Intergenic
1129164216 15:73767155-73767177 ATAGATACAAAGGGAGAGAGAGG + Intergenic
1129610695 15:77053334-77053356 AAAAATACAAAGGCTGAGGCAGG + Intronic
1129921901 15:79326546-79326568 ATATTTACAAAGGTTGGGCAGGG - Intronic
1131855839 15:96593162-96593184 ATAAAAACAAAGGTTAATGGGGG + Intergenic
1132199228 15:99937338-99937360 TTATATACATGGGTTGAGGGGGG + Intergenic
1133396268 16:5449906-5449928 ATATGTACAAAGCTAGAGGTGGG - Intergenic
1133931930 16:10239732-10239754 ATAGAACCAAAGGTGGAGGGAGG - Intergenic
1137393019 16:48097316-48097338 ATCTATAGAAAGGGTGGGGGTGG + Intronic
1139495308 16:67312647-67312669 ATGTGTACACAGGTTTAGGGAGG - Intronic
1140573025 16:76130985-76131007 ATATTTACAAAGGGTGAGGAGGG + Intergenic
1141165492 16:81657965-81657987 AAATATGCAAAGGCAGAGGGAGG - Intronic
1142712630 17:1731611-1731633 ATATATATAAAGGCCGAGCGTGG + Intronic
1144333805 17:14250429-14250451 AGTTAAACAAAGGTTGAGTGAGG - Intergenic
1146199073 17:30839900-30839922 ATATATAAGAAGCTTGAGGCTGG + Intronic
1148014554 17:44512030-44512052 ATATATGCAGAGGCTGAAGGAGG - Intergenic
1149065261 17:52471747-52471769 AGATAAACATAGGTTGGGGGTGG + Intergenic
1151614995 17:75204214-75204236 ATCTATAGAAAGGTTGAGGAAGG - Intergenic
1151954018 17:77371830-77371852 AAATATCCAAAGCATGAGGGAGG + Intronic
1152299544 17:79487037-79487059 AGATACACAAAGGGAGAGGGAGG + Intronic
1152725467 17:81942955-81942977 ATAAATAAAAAGGCTGAGGCAGG - Intronic
1154203920 18:12320784-12320806 ATATATACAAATGTTTACTGAGG - Intronic
1156354716 18:36331267-36331289 GTATATACAAAGGCTGAGAGAGG - Intronic
1157621615 18:49020449-49020471 ATCTATAGAAGGGGTGAGGGTGG - Intergenic
1158019350 18:52823129-52823151 TTATAAACAAAAGTTTAGGGAGG - Intronic
1159182551 18:64927497-64927519 GTAGATAAAAAGGTTGAGGTTGG + Intergenic
1163868254 19:19793917-19793939 ATGTATACAAAAGTTGGAGGTGG + Exonic
1165790183 19:38486639-38486661 ATACATAGAAAGGTGGATGGAGG - Intronic
1168230646 19:55028836-55028858 AGAAAAACAAAGGTTGAGGCTGG + Intronic
926580234 2:14626738-14626760 TTATATACGAAGGTGGAGAGAGG + Intergenic
928496965 2:31842834-31842856 TTATAGACAAAGGTTGAGGGGGG + Intergenic
931026852 2:58119854-58119876 GTTTATATGAAGGTTGAGGGTGG + Intronic
931414297 2:62066294-62066316 ACCTATACTTAGGTTGAGGGAGG + Intronic
934014058 2:87859160-87859182 ATATATATAAAAGTTGAGTGGGG + Intergenic
935603978 2:104951330-104951352 ATATATACAAAAGTAGAAAGAGG + Intergenic
936196596 2:110376169-110376191 ATATAAAAAAAAGTTGAAGGAGG - Intergenic
937413342 2:121695472-121695494 ATATATATAAATGTTAAGAGGGG + Intergenic
938979058 2:136508299-136508321 TTATAGACAAAGATTGAGGCCGG - Intergenic
939622738 2:144440168-144440190 AAATGCACAAAGGTTCAGGGAGG + Intronic
941465648 2:165823299-165823321 ATACAAACAAAGTGTGAGGGGGG - Intergenic
942845911 2:180425003-180425025 AACTATCAAAAGGTTGAGGGAGG + Intergenic
943850261 2:192711522-192711544 CTAGATAAACAGGTTGAGGGTGG + Intergenic
943897199 2:193379939-193379961 AGATATACAAATGTTAATGGTGG + Intergenic
944023634 2:195137278-195137300 ATATAAGCAAAATTTGAGGGAGG + Intergenic
944573286 2:201066576-201066598 ATATATAAAATGGATGAGAGAGG - Intronic
945346255 2:208720658-208720680 ATATACACAAAGTTTGATGAAGG - Intronic
946639804 2:221772056-221772078 ATATAGATAAAGGTTGGGGCTGG + Intergenic
946891403 2:224280888-224280910 ATCTATATAAAGGTGAAGGGAGG - Intergenic
947628659 2:231637450-231637472 ATAGAAAGAAAAGTTGAGGGAGG + Intergenic
948293071 2:236841772-236841794 ATCCATACAAGGGTTGTGGGAGG + Intergenic
1169951508 20:11049431-11049453 ATATTTACAAAGGTAGGTGGAGG + Intergenic
1170254899 20:14330331-14330353 ATATATACAAAGTATCAGAGTGG - Intronic
1172211931 20:33205938-33205960 TGAAATACAAAGGGTGAGGGAGG - Intergenic
1172920740 20:38479836-38479858 ATATAGGCTAAGGTTGAGGGCGG - Intronic
1174056953 20:47804559-47804581 ATATATACAGAGGCTGGAGGGGG - Intergenic
1174887760 20:54354316-54354338 ATATTTACAGATGGTGAGGGTGG + Intergenic
1177209077 21:18047398-18047420 ATATATCCAAAGTTTGAGAGGGG - Intronic
1177476685 21:21632952-21632974 ATATATAGAAGGGTAGAGGAGGG + Intergenic
1177572054 21:22900116-22900138 ATATATACAATGGCTGAAGTAGG - Intergenic
1177957114 21:27612292-27612314 ATATAGACATATGTTGAAGGTGG + Intergenic
1178455389 21:32745294-32745316 AATTATACAGAGTTTGAGGGAGG - Intronic
1178495582 21:33083281-33083303 TTATATAAAAATGTTGAGGGGGG - Intergenic
1181678638 22:24475327-24475349 CTATGTAAAAAAGTTGAGGGGGG - Intergenic
1183894641 22:40958565-40958587 ATAAATACAAAGGTACAGGAGGG - Intronic
1184929614 22:47671480-47671502 ATATATACAAAGGGTGCGGCAGG - Intergenic
949461618 3:4300999-4301021 ATATATATATTGGTGGAGGGTGG - Intronic
951336775 3:21433063-21433085 ATATATACAAAGGCCCAGAGAGG + Intronic
954341688 3:49959144-49959166 AGATAAACAAAAGCTGAGGGAGG - Intronic
955994175 3:64661089-64661111 ATATACACCAAGGGTAAGGGAGG + Intronic
957015569 3:75060392-75060414 TTATCTACAAAAGTTGAGAGTGG + Intergenic
957495386 3:80984944-80984966 ATATATACATATGTAGAGAGTGG + Intergenic
957844106 3:85708828-85708850 ATATACACAAAGGTTGCACGTGG + Intronic
958574257 3:95927131-95927153 ATATATACAGAGGCTGGAGGAGG + Intergenic
959576725 3:107942318-107942340 ACATTTACAAAGGTTGATGTAGG - Intergenic
959676910 3:109045991-109046013 ATATTTTCTTAGGTTGAGGGTGG - Intronic
959782682 3:110255121-110255143 TTAGAAAAAAAGGTTGAGGGAGG - Intergenic
959822850 3:110757044-110757066 ATATATACAGAGGCTGGAGGAGG - Intergenic
960328759 3:116330552-116330574 AAAAATAAAAAGGTTGTGGGGGG - Intronic
962651137 3:137493079-137493101 CTATATAGAAATGTTGATGGGGG - Intergenic
962813187 3:138976111-138976133 ACATATACCAATGTTGAGAGGGG - Intergenic
963337159 3:143988388-143988410 ATATATACACAGGCTGGGCGGGG - Intronic
963426705 3:145138294-145138316 ACATTTACAAAGGATGAGTGAGG + Intergenic
964192962 3:154026931-154026953 ATAGAGATAAAGGTAGAGGGGGG + Intergenic
964874105 3:161346822-161346844 ATATGTACAAAGGTTGGAGGTGG + Intronic
965361777 3:167749818-167749840 ATATAAACAAAAGATGAGAGGGG + Intronic
968140785 3:196254639-196254661 TAATATACAGAGGTTGAGTGTGG - Intronic
970885628 4:20984700-20984722 ATATTTACAAAGGTGGACGGAGG + Intronic
970930887 4:21510365-21510387 ATCAATACAAAGGTTGGGGTGGG + Intronic
973740769 4:53917203-53917225 ATTTAGACAAAGATTGAAGGAGG - Intronic
973761502 4:54120485-54120507 ATATATACAATTGTTGGGGCTGG - Intronic
974933772 4:68389540-68389562 ATATATACAGAGGCTGGAGGAGG + Intergenic
976194950 4:82523294-82523316 GTATATACAGAGGTTGGAGGAGG + Intronic
976599739 4:86927219-86927241 ATATATCAAAAGGTGGAGGCCGG + Intronic
976633011 4:87258902-87258924 AGATAGACAGAGGGTGAGGGCGG - Intergenic
977517488 4:98039528-98039550 GTATACACAAAAGTGGAGGGTGG + Intronic
977751945 4:100620426-100620448 ATATATACAGAGGTTGGAGAGGG + Intronic
979490481 4:121321104-121321126 CTCTGTACATAGGTTGAGGGTGG + Intergenic
979817857 4:125132747-125132769 AGTTATACATAGGTTGGGGGGGG + Intergenic
980137133 4:128869100-128869122 AAATAAAAAAAGGTTTAGGGAGG + Intronic
980953991 4:139409755-139409777 TGATATACAAAATTTGAGGGAGG + Intronic
981268083 4:142811172-142811194 ATATATGCACAGGTGGAGGTAGG - Intronic
984879513 4:184398354-184398376 ATATATAAAAATGTTATGGGAGG + Intronic
986439400 5:7766181-7766203 ATAGATACAAATGTCGAGGCTGG + Intronic
986920245 5:12671594-12671616 ATATACACAAGGGTGGAGGAGGG - Intergenic
988364393 5:30277223-30277245 ATATATTAAAAGGTTGATGTAGG + Intergenic
988884163 5:35537087-35537109 ATATTTACATAGTTTGAGGGTGG + Intergenic
989282025 5:39655325-39655347 ATATATACAAAGGCTGGAGGAGG - Intergenic
990037392 5:51338340-51338362 TTATATACAAATGTAGAGGTAGG - Intergenic
992625093 5:78629593-78629615 AAATCCACAAAGGCTGAGGGAGG + Intronic
993351089 5:86851624-86851646 ATATAAACAAATGTTGAGAGAGG - Intergenic
993510870 5:88770082-88770104 AATTAAACAAAGGTTGAGAGAGG + Intronic
993737409 5:91494433-91494455 ATATATAAAAAGATATAGGGTGG - Intergenic
994665065 5:102695825-102695847 AAAAATACAAAGGCTGAGGCAGG - Intergenic
994968643 5:106707235-106707257 CTATATACATAGATTGAAGGAGG - Intergenic
995264968 5:110148594-110148616 ATATATATAAAAGGTGAGGTTGG + Intergenic
995989368 5:118217725-118217747 ATATATACAAATTTGGAGGAAGG + Intergenic
996635734 5:125687265-125687287 AGATAAACAAAAGTTGAGTGAGG + Intergenic
997443156 5:133922906-133922928 ATAAATAAAAAGGTGGGGGGTGG - Intergenic
998509653 5:142701116-142701138 ATATATACATGAGTTGATGGGGG + Intergenic
999573681 5:152949293-152949315 ATATATACATAGTCTGAGGCTGG - Intergenic
1002276233 5:178105987-178106009 ATATACACAAAGGTAAAGGGAGG - Intergenic
1002388083 5:178885776-178885798 ACATATGCAAAGGTGTAGGGTGG + Intronic
1002553017 5:180011474-180011496 ATATATACAAAGGTTGAGGGTGG + Intronic
1002978108 6:2106468-2106490 ATACATACAAATTTTGGGGGCGG + Intronic
1002989013 6:2220712-2220734 GTATATACAAATCTTGGGGGTGG - Intronic
1004008634 6:11659694-11659716 ATATATAAAATGGTAGAGGTAGG - Intergenic
1004449442 6:15731200-15731222 ACCTGAACAAAGGTTGAGGGAGG + Intergenic
1006037452 6:31224632-31224654 AAACATACTAAGGTTCAGGGAGG + Intergenic
1006056679 6:31390394-31390416 ATGGATACAAAGGGTGAGGTTGG + Intergenic
1006645313 6:35511443-35511465 ATCTGTACAATGGTGGAGGGGGG + Intronic
1007380394 6:41486644-41486666 ACATATACAAAGGCTGAGGGAGG + Intergenic
1007869004 6:45010816-45010838 ATATATTCAGAGGGTGAGGAGGG + Intronic
1009428868 6:63544312-63544334 GTATATACATAGGTAGAGAGAGG - Intronic
1009919620 6:70041383-70041405 AAATATAAAAAGGATAAGGGTGG - Intronic
1010374351 6:75149186-75149208 ATATGTACAAGGGTAGAGAGAGG - Intronic
1011330535 6:86200743-86200765 ATAAATACACATGTTGTGGGAGG + Intergenic
1012572887 6:100752706-100752728 ATATATACAGTGGTTTTGGGGGG - Intronic
1013063727 6:106662387-106662409 ATATATACAAACTTTTAGAGTGG + Intronic
1014271615 6:119342869-119342891 GTATATACAAAGGGTGAAAGGGG - Intronic
1014520137 6:122432822-122432844 ATATATAGAAAGATCGGGGGTGG + Exonic
1016063066 6:139650350-139650372 ATATATATAAAGGTAAAGAGTGG - Intergenic
1016147720 6:140696139-140696161 ATATATACAAAGATGTAGGCTGG + Intergenic
1016658745 6:146550710-146550732 ATATATAAAATGTTTGGGGGGGG + Intronic
1016782299 6:147972833-147972855 ATATATGCAGATGTTGAGGTGGG - Intergenic
1019331426 7:462582-462604 AAAAAAACAAAGATTGAGGGTGG - Intergenic
1020857238 7:13444562-13444584 TTATATAATAAGGTTGAGAGAGG - Intergenic
1021135798 7:16963923-16963945 ATATATTCAATGATTGAAGGTGG - Intergenic
1022243285 7:28533292-28533314 ATGTTTATAAAGGTTAAGGGAGG - Intronic
1022784448 7:33624332-33624354 TAATATTCAAGGGTTGAGGGTGG - Intergenic
1024302136 7:47895096-47895118 GTATATACAAAGGCTGGAGGAGG + Intronic
1025034619 7:55586118-55586140 AGAAATACAAAGATTGAGTGAGG + Intergenic
1025236059 7:57235619-57235641 ATATATACAGAGGCTGGAGGAGG + Intergenic
1026791563 7:73335778-73335800 ATAAACCCAAAGGTTCAGGGTGG - Intronic
1027776281 7:82469269-82469291 ATATATAAAAACGTGGGGGGTGG + Intergenic
1027905913 7:84181131-84181153 ACATATACAAAATTTGAGGAGGG - Intronic
1030158235 7:106479242-106479264 ATAATTACAAAGAATGAGGGAGG - Intergenic
1031048946 7:116925611-116925633 ATATATACAAAGATTGAGTCGGG + Intergenic
1031168869 7:118265663-118265685 ACAGATACAAATGTTGGGGGAGG + Intergenic
1032222407 7:130004510-130004532 TTAAATAAAAAGGTAGAGGGGGG - Intergenic
1034123326 7:148647176-148647198 AGATATACAAATGTAGAGAGAGG + Intergenic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1035004813 7:155648207-155648229 AAATATACAAAAGTGGAGGTGGG - Intronic
1035431413 7:158825681-158825703 ATATATACAAAGGTGAGGTGAGG + Intronic
1036036655 8:5027688-5027710 TTATATAAAAAGGATTAGGGAGG + Intergenic
1038223099 8:25629301-25629323 ATATATACAAAAGAGGAGTGGGG + Intergenic
1039203513 8:35123402-35123424 ATATTAGCAAAGGTTGAGAGGGG + Intergenic
1039516256 8:38136476-38136498 ATATATAGAAAAGTTGGGGCTGG + Intronic
1041180222 8:55239591-55239613 CTATATAGAAAGGCTGAGAGGGG - Intronic
1042718218 8:71798758-71798780 ATGTATTCAAATATTGAGGGGGG - Intergenic
1042741231 8:72049469-72049491 ATATATACAAATGCTGGAGGAGG - Intronic
1042756875 8:72224310-72224332 ATATATTCAAATGCTGGGGGAGG - Intergenic
1044502379 8:92973593-92973615 AGATATACAAAGGTTGACTTTGG + Intronic
1044729117 8:95216206-95216228 ATAAAAACAAAGGATGAGGAGGG + Intergenic
1044955336 8:97474378-97474400 AAATATAAAAAGGAGGAGGGTGG - Intergenic
1046655003 8:116884096-116884118 ATATATACAAAGGTAGAAAGAGG - Intergenic
1047284956 8:123479909-123479931 ATATATACAGAGGCTGGAGGAGG - Intergenic
1048673698 8:136752535-136752557 ATAGACACAAAGGATGGGGGTGG - Intergenic
1049439683 8:142603596-142603618 ATATATAAAAAGGTCGGGTGTGG - Intergenic
1049970470 9:817726-817748 ATATATAAATAGGCTGAGCGTGG + Intergenic
1050499346 9:6278798-6278820 GTCTATACATTGGTTGAGGGAGG - Intergenic
1051712045 9:19941046-19941068 AAATCTTCAAAGGTTGGGGGAGG + Intergenic
1051803877 9:20968788-20968810 ATATACCCAAAGGTAGAGGAAGG - Intronic
1055115023 9:72596982-72597004 ATATTTACAAGGGTTGCTGGTGG - Intronic
1056102116 9:83309797-83309819 ATATCTGCAAAGGGTGAGGGAGG - Intronic
1056466746 9:86864080-86864102 ATATACATAAATGTTGAGTGAGG + Intergenic
1061332201 9:129902080-129902102 AAATAATCAAAGCTTGAGGGAGG - Intronic
1186168509 X:6852840-6852862 ATGGATACAAAGGATGAGGTTGG + Intergenic
1186579687 X:10804506-10804528 AAAGATACAATGGGTGAGGGAGG - Intronic
1186959235 X:14716957-14716979 ATATGTACAAAGGTTTATTGGGG - Intronic
1187210032 X:17220850-17220872 ATATGTAAAAACGTGGAGGGGGG - Intergenic
1187643102 X:21316324-21316346 ATAGATACATAGCTTGGGGGAGG - Intergenic
1188079102 X:25814982-25815004 GTATCTACACACGTTGAGGGTGG - Intergenic
1188765499 X:34086579-34086601 GTAGATACAAAGGTTAAGGAAGG + Intergenic
1190514676 X:51210799-51210821 ATATATACAAAGCTAGAGGGAGG - Intergenic
1196245921 X:113400364-113400386 CCATACTCAAAGGTTGAGGGTGG + Intergenic
1196583415 X:117401696-117401718 AGATAAGCAAATGTTGAGGGAGG + Intergenic
1196991470 X:121333740-121333762 CTATATACAAAGGTATGGGGAGG + Intergenic
1198010136 X:132544080-132544102 ATCTATACCAAGGTTGCTGGGGG + Intergenic
1199130416 X:144179312-144179334 ATATATATAAAAGTTGAGTGGGG - Intergenic
1200789241 Y:7284994-7285016 ATATATACAAAAGCTGAGCATGG - Intergenic
1200938921 Y:8762431-8762453 ATAAAAACAAAAGATGAGGGAGG + Intergenic
1201181818 Y:11355623-11355645 ACATACACAAAGGTTGAAAGTGG + Intergenic
1201312645 Y:12610835-12610857 ATGGATACAAAGGGTGAGGTTGG + Intergenic
1201986686 Y:19975945-19975967 ATAGAGACAAAGGGTGAGGTTGG - Intergenic