ID: 1002554082

View in Genome Browser
Species Human (GRCh38)
Location 5:180020634-180020656
Sequence ATCACATACAAGTAGGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002554076_1002554082 28 Left 1002554076 5:180020583-180020605 CCAAAAGCCAAGGGTCTTCTCTT 0: 1
1: 0
2: 0
3: 20
4: 264
Right 1002554082 5:180020634-180020656 ATCACATACAAGTAGGGCCAAGG 0: 1
1: 0
2: 0
3: 7
4: 94
1002554079_1002554082 -2 Left 1002554079 5:180020613-180020635 CCTTGAACAGGAAGTTCTTCAAT 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1002554082 5:180020634-180020656 ATCACATACAAGTAGGGCCAAGG 0: 1
1: 0
2: 0
3: 7
4: 94
1002554077_1002554082 21 Left 1002554077 5:180020590-180020612 CCAAGGGTCTTCTCTTCTTTCTT 0: 1
1: 0
2: 3
3: 65
4: 744
Right 1002554082 5:180020634-180020656 ATCACATACAAGTAGGGCCAAGG 0: 1
1: 0
2: 0
3: 7
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002554082 Original CRISPR ATCACATACAAGTAGGGCCA AGG Intronic
900289235 1:1916886-1916908 AACACACTCAAGTAGGGCCCGGG + Exonic
910679770 1:89850894-89850916 AACACATACAAATAAGGGCAAGG - Intronic
921743598 1:218712991-218713013 ATCACATCCAACTGGGGCCAGGG + Intergenic
922600835 1:226851621-226851643 AGCACATACAAGGAGGTACATGG - Intergenic
1065238384 10:23679053-23679075 ATCACTTACAAGTAGTGCAGTGG - Intergenic
1067382745 10:45790014-45790036 ATCAAATACAAACAGGGCAATGG + Intronic
1067890448 10:50130559-50130581 ATCAAATACAAACAGGGCAATGG + Intronic
1069080681 10:64085252-64085274 ATCACATACATCTGCGGCCATGG - Intergenic
1069915075 10:71782339-71782361 AGCACACACAAGGTGGGCCAGGG + Intronic
1073598836 10:104826262-104826284 AACAAATACAGGAAGGGCCAAGG - Intronic
1081048350 11:38305555-38305577 ATTACAGACCAGCAGGGCCAAGG - Intergenic
1083634957 11:64115928-64115950 ATCACATTCCAGGAGGGCCGCGG + Intronic
1085306831 11:75491032-75491054 ATCACATAGAGGCAGAGCCAGGG + Intronic
1088972803 11:114788318-114788340 GTCACTGACAAGCAGGGCCATGG + Intergenic
1095174108 12:39070929-39070951 ATTGCATACAAGTTGGGCTAAGG - Intergenic
1097045903 12:56187940-56187962 GAAACATAGAAGTAGGGCCAGGG - Intronic
1100744832 12:97634305-97634327 ATCACAGACAATTGGGTCCAGGG - Intergenic
1101858304 12:108462685-108462707 ATCACAGAGGAGAAGGGCCAGGG - Intergenic
1107662531 13:42653827-42653849 ATCACATGCAAGTTGCGCCTGGG - Intergenic
1113780099 13:112971791-112971813 ATCACATAGAAGGGGGGCCAGGG - Intronic
1117049686 14:51847673-51847695 ATCACAGACGAGAGGGGCCATGG + Intronic
1129754517 15:78089104-78089126 GTCACATACAAAGAGGTCCATGG - Intronic
1131865661 15:96706723-96706745 ATCACATACATCTTGGTCCAGGG - Intergenic
1132612381 16:823824-823846 ATAACATACAAGAGTGGCCACGG - Intergenic
1138891148 16:61145630-61145652 ATCAAGTACAAGTAGGGCTAGGG - Intergenic
1142485749 17:246849-246871 ATCACATACAAGTACTGCTCTGG - Intronic
1153994775 18:10431240-10431262 GTCACTTACAAGTAGAGCTAAGG + Intergenic
1159653699 18:71006979-71007001 ATCACAGTCAAGAGGGGCCAAGG - Intergenic
927197799 2:20560068-20560090 AGCACATACAAGCAGGGCTGGGG + Intergenic
927848355 2:26483654-26483676 AGCACATACAGCCAGGGCCATGG + Intronic
932447884 2:71791800-71791822 ATCACATACCTGCAGGGCCTGGG + Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
937923040 2:127145858-127145880 CTCACCAACAAGGAGGGCCAGGG + Intergenic
938378814 2:130825372-130825394 AACACAGACAGGTGGGGCCAGGG + Intergenic
941158516 2:162008176-162008198 GTCAAATACAAGTAGGGCTTTGG - Intronic
941436131 2:165475412-165475434 ACAACATACAGGCAGGGCCAAGG + Intronic
942534076 2:176944809-176944831 ATCACTCACAAGTAGGGGCCAGG + Intergenic
945069459 2:205976452-205976474 ATCAAAAACAAGAAGGGCCATGG + Intergenic
947058244 2:226132584-226132606 AAAACAGACAAATAGGGCCAAGG - Intergenic
1172210850 20:33197436-33197458 AGCACAGACAAGAAGGGCCCAGG - Intergenic
1173076599 20:39825197-39825219 ATGACATGCAAATAGGGCCTAGG + Intergenic
1174076809 20:47943077-47943099 ATCAGATATAAGCAGGGGCAGGG - Intergenic
1174141105 20:48414336-48414358 ATCACATGCAAGTAGGGACTAGG - Intergenic
1174309748 20:49642746-49642768 ATCACATTCATCTAGGTCCAAGG - Intronic
1178698699 21:34815986-34816008 ATCACAAACAAGAAGGGAAATGG + Intronic
1180783795 22:18535931-18535953 ACCACATCCATGTAGGGCCTGGG + Intergenic
1181240695 22:21475283-21475305 ACCACATCCATGTAGGGCCTGGG + Intergenic
1182392250 22:30008251-30008273 ATCACCTACAAGTTGGCACAAGG - Intronic
1183795046 22:40110467-40110489 ATCACTTACAGGTAGAGGCAGGG - Intronic
1185357595 22:50383588-50383610 ATCATAAACAAGAAGGCCCAAGG - Intronic
1203326035 22_KI270738v1_random:19627-19649 ATATCAAACAAATAGGGCCATGG + Intergenic
950800700 3:15550045-15550067 ATCACATGCCTGAAGGGCCAAGG + Intergenic
955310363 3:57880491-57880513 ATGACATACAAGTCTGGGCATGG - Intronic
958610769 3:96423332-96423354 ATCACGTAACAGAAGGGCCAAGG - Intergenic
962945296 3:140163703-140163725 AACTCATACAAGCAAGGCCACGG - Intronic
969936625 4:10688428-10688450 ATCATATTCAAGGAGGACCATGG + Intergenic
977963320 4:103110764-103110786 ATTACATATATGTAGGGACATGG - Intronic
979157740 4:117418981-117419003 ATCATAAACAAGTAGGGACAGGG - Intergenic
985382226 4:189406560-189406582 ATCACATACAAGAGGTGACAGGG - Intergenic
988047428 5:25974089-25974111 ATCACAGGCAAGCAGGGCTATGG + Intergenic
991143166 5:63270576-63270598 TCCACATAAAAATAGGGCCATGG - Intergenic
1002554082 5:180020634-180020656 ATCACATACAAGTAGGGCCAAGG + Intronic
1003562556 6:7194547-7194569 AGCACAAACAAGTAGCACCAAGG - Intronic
1003746262 6:9005869-9005891 AGCACCTACTAGTATGGCCAGGG - Intergenic
1004701234 6:18081549-18081571 ATCACAGACAAGACGAGCCATGG + Intergenic
1015756377 6:136610564-136610586 ATCACAGAGAGGTTGGGCCAAGG + Intronic
1025020979 7:55479021-55479043 GTCACATAGAGGAAGGGCCATGG - Intronic
1031389573 7:121197307-121197329 ATCACATGAAAGTACTGCCAGGG + Intronic
1032453727 7:132056149-132056171 ATCAATTAAAAGTAGGGGCAAGG - Intergenic
1032510949 7:132471837-132471859 AGAACAAACAAGCAGGGCCACGG + Intronic
1040040732 8:42914648-42914670 AAGAAATACAAGAAGGGCCAAGG - Intronic
1041148530 8:54906526-54906548 AGCACATACAATTATGGACAGGG + Intergenic
1041711110 8:60895436-60895458 GTCACGTACAGGTAGTGCCAGGG - Intergenic
1041716935 8:60941022-60941044 CTCACATGGAAGAAGGGCCATGG + Intergenic
1044168556 8:89020250-89020272 ATCACAGATATGTAGGGTCAGGG - Intergenic
1048134167 8:131729920-131729942 ATCACATAGAAGGAGGGGGACGG + Intergenic
1048870015 8:138789650-138789672 ATCACATTGAAGGAGGGGCAGGG + Intronic
1051638800 9:19205171-19205193 TTAAGATACAGGTAGGGCCAGGG - Intergenic
1055420038 9:76130000-76130022 ACCACATCCAAGTGTGGCCATGG + Intronic
1059533902 9:115063425-115063447 TTGACATACAAATAGGGCTATGG + Intronic
1203442744 Un_GL000219v1:26432-26454 ATCTCATACAAGTAGGGAGTAGG + Intergenic
1203513552 Un_KI270741v1:145341-145363 ATCTCATACAAGTAGGGAGTAGG + Intergenic
1186519943 X:10197049-10197071 GTCACCTACAAGTCAGGCCATGG - Intronic
1186871244 X:13776037-13776059 ATCACCTACAATCAGTGCCAAGG + Intronic
1187355872 X:18571049-18571071 ATCACATAGAAGTATGGACTCGG + Intronic
1188742668 X:33805492-33805514 ATAACCTACAAGTAAGGGCAAGG - Intergenic
1191870197 X:65739192-65739214 AAGGTATACAAGTAGGGCCAAGG + Exonic
1193717701 X:84951304-84951326 ATCACATACAGGGAAGCCCAGGG - Intergenic
1198371065 X:135989768-135989790 ATCACACATTAGTAGGGCCTTGG + Intronic
1198954883 X:142118025-142118047 ATTACATACAAGCAAAGCCATGG + Intergenic
1199187706 X:144936738-144936760 TTCACATATCAGAAGGGCCAAGG - Intergenic
1199198544 X:145060223-145060245 ATCACAGACAAGGAGGTCTAAGG + Intergenic
1199295175 X:146149122-146149144 ACCACATAAAAGTAAGGACATGG + Intergenic
1200135893 X:153874519-153874541 GACACATACATGGAGGGCCAGGG - Intronic
1200884858 Y:8257351-8257373 ATCACATAGCATTAGGGGCAGGG + Intergenic
1201058093 Y:10015815-10015837 ATCTCATACTAATAGGGGCAGGG + Intergenic
1202196332 Y:22301633-22301655 ATCGCATACTACTAGGGGCAGGG + Intergenic
1202199114 Y:22328464-22328486 ATCACATACTACTAGGGGCAGGG - Intronic
1202231759 Y:22665973-22665995 ATCGCATACTATTAGGGGCAGGG - Intergenic
1202311399 Y:23530192-23530214 ATCGCATACTATTAGGGGCAGGG + Intergenic
1202559403 Y:26140402-26140424 ATCGCATACTATTAGGGGCAGGG - Intergenic