ID: 1002554726

View in Genome Browser
Species Human (GRCh38)
Location 5:180027387-180027409
Sequence GAGTATAAGCAGAAACAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 412}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002554723_1002554726 18 Left 1002554723 5:180027346-180027368 CCTGGAAAGCAAGGAGTTGCCAG 0: 1
1: 0
2: 0
3: 28
4: 283
Right 1002554726 5:180027387-180027409 GAGTATAAGCAGAAACAGAAAGG 0: 1
1: 0
2: 3
3: 26
4: 412
1002554724_1002554726 -1 Left 1002554724 5:180027365-180027387 CCAGTGTATAATGACCTTCTCTG 0: 1
1: 0
2: 4
3: 43
4: 779
Right 1002554726 5:180027387-180027409 GAGTATAAGCAGAAACAGAAAGG 0: 1
1: 0
2: 3
3: 26
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002554726 Original CRISPR GAGTATAAGCAGAAACAGAA AGG Intronic
901228873 1:7630962-7630984 AAGGATAAGCAAAAACAGAAGGG - Intronic
901269636 1:7941983-7942005 GAGTATAAGGAGAAAGAAGAGGG + Intronic
902178749 1:14671385-14671407 GAGTCTTTGGAGAAACAGAAAGG + Intronic
903989175 1:27253320-27253342 AAGAAGAAGCAGAAACAGAGAGG - Intronic
904157447 1:28496386-28496408 GAGTATCAGATGCAACAGAAAGG + Intronic
904603867 1:31688572-31688594 GTGTCCAACCAGAAACAGAACGG + Intronic
905868724 1:41391015-41391037 GAGTTTGGGCAGGAACAGAATGG - Intergenic
906081443 1:43091577-43091599 GAGATTAATAAGAAACAGAATGG - Intergenic
906887278 1:49663184-49663206 GAATATAAGAAGACATAGAAGGG + Intronic
907712922 1:56901084-56901106 AAGGATAAACAGAAACACAAAGG + Intronic
908390591 1:63679951-63679973 GAGGAGAAGCAAAAAGAGAAGGG - Intergenic
909162017 1:72164035-72164057 AAGTAAAAGCAGAAACAAGAAGG + Intronic
909236408 1:73157717-73157739 GAGGATATGGAGAAAAAGAAAGG + Intergenic
909295436 1:73941844-73941866 GAGTTTATGCAGAAAAGGAATGG - Intergenic
909475627 1:76077786-76077808 GAGAAAAAGCAGATACAGGAAGG - Intronic
909929850 1:81484527-81484549 GAGTAAAACCAGTAGCAGAAAGG + Intronic
910042956 1:82875274-82875296 GAGTAAAAGCAAAGGCAGAAGGG + Intergenic
910543127 1:88383758-88383780 GAGGATAGGCAGAAGCAAAATGG - Intergenic
910998193 1:93131776-93131798 GAGTAGAAGCCAAAAGAGAAGGG + Intronic
911808691 1:102245217-102245239 GAGTATAAGAGGAAAGTGAATGG + Intergenic
913121550 1:115745687-115745709 GACTTGAAACAGAAACAGAATGG + Intronic
913309426 1:117473394-117473416 GGGCAGAGGCAGAAACAGAAAGG - Intronic
915009731 1:152674765-152674787 GAGGAAAAGCAGAAACACAGAGG + Intergenic
915010883 1:152685593-152685615 GAGGAAAAGCAGAAACACAGAGG + Intergenic
915745217 1:158150938-158150960 GAGCAGAAGCACACACAGAAAGG - Intergenic
915865669 1:159495348-159495370 GAGAGCAAGCAGAAACAGGATGG - Intergenic
916504127 1:165412381-165412403 GAGAAAAAGAGGAAACAGAAGGG + Intronic
917071608 1:171157520-171157542 GAGGAGGAGGAGAAACAGAAGGG - Intronic
917606151 1:176631951-176631973 GAGTGTAAGCAAAAGGAGAAAGG + Intronic
917641757 1:176989853-176989875 GAGCACAAGCAGAAACAGTTGGG - Intronic
917672934 1:177290699-177290721 AAGTATAAACAGCAACAAAAAGG - Intergenic
917813910 1:178688201-178688223 AAGCTAAAGCAGAAACAGAAGGG - Intergenic
919276110 1:195418727-195418749 AAGACTAAGCAGACACAGAATGG - Intergenic
921123832 1:212159480-212159502 GAGTAGAAGCTGAAATGGAAGGG + Intergenic
921482885 1:215683711-215683733 GTGAATAAGAAGAAAGAGAAAGG - Intronic
922135733 1:222824421-222824443 GTGTATAAGCAAAAGCAGAAGGG - Intergenic
922918697 1:229281388-229281410 GAAAATAACCAGAGACAGAAAGG - Intronic
923798208 1:237180507-237180529 AAGACTAAGCAGAAAAAGAAGGG - Intronic
924009877 1:239653317-239653339 GAGTTTGATCAGACACAGAAGGG + Intronic
924805142 1:247355946-247355968 GAAGAGAAGCAGAAACAGAAAGG + Intergenic
1062993354 10:1841510-1841532 GAGCAGAAGCAGCCACAGAAAGG + Intergenic
1064825631 10:19396039-19396061 GAGTAGAAACAGAAATAGAATGG - Intronic
1066358762 10:34710781-34710803 GAGAATAAACAAAAACATAAGGG - Intronic
1067169045 10:43890827-43890849 GAGGAGAAGGAGAAATAGAAAGG - Intergenic
1067842025 10:49688640-49688662 GAGGATAGGCAGAAGCAGGAGGG - Intronic
1067994731 10:51258970-51258992 GACTAAAAGCAGAAACAAGAAGG - Intronic
1068318696 10:55381770-55381792 AAGTAAAAGAAGAAAAAGAAAGG + Intronic
1069772022 10:70906165-70906187 GAGAGTAAGAAGAAACAGGATGG - Intergenic
1070292800 10:75131247-75131269 GAGAAGAAGCAGAATTAGAATGG - Intronic
1070322324 10:75363459-75363481 GTGGATAAACAGAGACAGAAGGG - Intergenic
1070908140 10:80092810-80092832 GAATAAAAACAGAAACAAAAAGG - Intergenic
1072279805 10:93855459-93855481 GAGTTTTAGCAGAAACTCAAAGG - Intergenic
1072893017 10:99341661-99341683 GAGTTTGAGCTGAAAAAGAAAGG + Intronic
1075361189 10:121836091-121836113 GAGAAGAAGCAGTAAAAGAAAGG - Intronic
1075881807 10:125858929-125858951 GTCTAAAAGCAGTAACAGAATGG + Intronic
1077703646 11:4463649-4463671 GACTATAAACAAAAACAGATTGG + Intergenic
1077783175 11:5354424-5354446 CAGTATAAGGAAGAACAGAAAGG - Intronic
1078388216 11:10911839-10911861 GTGTAAAGACAGAAACAGAAAGG + Intergenic
1078405298 11:11065554-11065576 GAGTAGTAGCAGATACAGTAGGG - Intergenic
1078675513 11:13409055-13409077 GAGTAAAAGCCAAAACATAAAGG + Intronic
1078681392 11:13480097-13480119 GAGTGTGAGCTGAAACAGAGTGG + Intergenic
1078868676 11:15323777-15323799 GGGTATAATGAGCAACAGAAAGG + Intergenic
1079598462 11:22283623-22283645 GAAGATAAGCATGAACAGAAAGG + Intergenic
1079618164 11:22520624-22520646 GTCAATAAGCAAAAACAGAAGGG + Intergenic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1079953283 11:26830966-26830988 GAGTATGAGCAGAAGTAGACTGG + Intergenic
1080369026 11:31612615-31612637 GTATATAAGGAGAAAGAGAAGGG + Intronic
1081027567 11:38034926-38034948 GAGTGAAAACAGAGACAGAAAGG + Intergenic
1081382871 11:42437262-42437284 GATTTTATGCAGAACCAGAATGG - Intergenic
1083927776 11:65818973-65818995 GAGGCTAGGCAGAAACAGAAAGG + Intergenic
1084580719 11:70021503-70021525 GAAATTAAACAGAAACAGAATGG + Intergenic
1084919473 11:72457615-72457637 GAGGATCAGCAGACAAAGAATGG + Intergenic
1086128305 11:83372912-83372934 GAGTTGGAGCTGAAACAGAATGG - Intergenic
1086923239 11:92611697-92611719 GAGTATATCAAGAAATAGAAGGG - Intronic
1087194060 11:95286903-95286925 GATGATAACAAGAAACAGAAGGG - Intergenic
1087390079 11:97520487-97520509 GAGGGTTAGCAGGAACAGAAGGG + Intergenic
1088162070 11:106884173-106884195 GAGTATAACAAAAAAAAGAAAGG + Intronic
1089804567 11:121072015-121072037 GAGTCTGAGGAGAAACAAAAGGG + Intronic
1090345684 11:126068339-126068361 AAGAAGAAGCAGAAACACAAGGG + Intergenic
1090833533 11:130437262-130437284 GAGAAAGAGGAGAAACAGAAAGG - Intergenic
1091274046 11:134338171-134338193 GAGTATGACCAGACACAGATAGG - Intronic
1091288326 11:134421722-134421744 GGGTTCAAGCAGAAGCAGAATGG - Intergenic
1091541390 12:1465802-1465824 GAGTAACAGCAGCAACAGCAAGG - Intronic
1093668899 12:21848850-21848872 GAAAATATGCAGAAAGAGAAGGG + Intronic
1094777639 12:33749625-33749647 TAGTATAAGCAGTAACAGGTAGG - Intergenic
1095257907 12:40061944-40061966 CAGTATATACAGAAAAAGAAAGG + Intronic
1095703557 12:45215606-45215628 GAGAATAAGCAAAAGAAGAAGGG - Intergenic
1096474545 12:51900246-51900268 GAGGGTAAGGAGAAACAGCAAGG - Intergenic
1098103368 12:67042734-67042756 GATTAGAAGCAGAGACTGAAGGG + Intergenic
1098426660 12:70372041-70372063 GGGGATGAGCAGAGACAGAAGGG + Intronic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1098602608 12:72350133-72350155 GAATATATGCAGAGACAGGATGG - Intronic
1098895304 12:76053279-76053301 AAGAAGAAGCAGAAACACAAGGG - Exonic
1099099525 12:78420947-78420969 GAATCTAAACAGAAACAAAATGG - Intergenic
1100093054 12:90995452-90995474 CAGAAGAAGCAGAAAAAGAATGG + Intronic
1100274778 12:93062134-93062156 AAGAATCAGCTGAAACAGAAGGG + Intergenic
1100800416 12:98224796-98224818 GGGTATAAGAGGAGACAGAAAGG - Intergenic
1100817854 12:98403159-98403181 GAGGATGAGCAGAAACACAGTGG + Intergenic
1101372657 12:104143577-104143599 GAGTTTAAGCAAAAAAATAAAGG - Intergenic
1102730691 12:115106296-115106318 CAGTCTAAGAAGAAACATAAAGG - Intergenic
1103023568 12:117555858-117555880 GAGTAATAGAAGTAACAGAAGGG - Intronic
1104499060 12:129267090-129267112 GAGTATAATGAGGAAGAGAAGGG - Intronic
1104819802 12:131669475-131669497 GGGTAAAAGAAGAAACACAAAGG + Intergenic
1106874309 13:34055080-34055102 GAGGGTGAGCAGAAGCAGAATGG - Intergenic
1108170184 13:47733440-47733462 AAGTAGAAATAGAAACAGAATGG + Intergenic
1108173121 13:47764269-47764291 AAGAAGAAGCAGAAACACAAGGG + Intergenic
1108460125 13:50657415-50657437 GAGTCTAAGCAGAACCAGGTGGG - Intronic
1108603407 13:52014195-52014217 GATTGAATGCAGAAACAGAAAGG + Intronic
1108889243 13:55232623-55232645 TAGTATCAGCAAAAACAGCAGGG - Intergenic
1109157717 13:58931358-58931380 CAGAACAAGCAGAAAAAGAATGG + Intergenic
1109825271 13:67710881-67710903 GATTATAAGTAGAAAAATAATGG + Intergenic
1110025228 13:70529382-70529404 AAATAAAAGCAGAAACACAAAGG - Intergenic
1110143153 13:72155835-72155857 AAGTATGATGAGAAACAGAAAGG - Intergenic
1110605300 13:77425443-77425465 GAGTATAAGTAAAAGCAGATAGG - Intergenic
1110725806 13:78822182-78822204 GAGTTTAAGCAGCAACAGTTTGG - Intergenic
1111058262 13:82978559-82978581 GAAGATAAGCAGACACAGACTGG + Intergenic
1111158294 13:84357811-84357833 GAGTATAAGCTGCATCAGAATGG - Intergenic
1111247813 13:85564259-85564281 GTGTGAAAGCTGAAACAGAAAGG - Intergenic
1112835728 13:103512040-103512062 GAATCTAAGCAGAAAGAGGAGGG + Intergenic
1112946717 13:104937115-104937137 GAATATAAGCAGAAACTGGAAGG - Intergenic
1114040020 14:18669284-18669306 GAATAAAAACAGAAACAAAAAGG - Intergenic
1114045055 14:18867809-18867831 GAATAAAAACAGAAACAAAAAGG - Intergenic
1114119156 14:19651659-19651681 GAATAAAAACAGAAACAAAAAGG + Intergenic
1116162058 14:41280504-41280526 AAGTAGAAGTAGAAACAGAGTGG + Intergenic
1116170507 14:41395712-41395734 TAGCTTAAGAAGAAACAGAAAGG - Intergenic
1116377749 14:44225261-44225283 GAGAATAAGAAAAAACAGCAAGG + Intergenic
1117973422 14:61274600-61274622 GATTCTAAGAGGAAACAGAAAGG + Intronic
1118019495 14:61695947-61695969 GAGCAGCAGCAGAAACAAAAAGG - Intronic
1118690376 14:68333089-68333111 CAGTATATGCAGAGGCAGAAAGG - Intronic
1118799505 14:69176652-69176674 GAGTATAATATGAAAAAGAAGGG - Intergenic
1118983081 14:70731741-70731763 GAGTATAACAAAAAACAGGAGGG + Intronic
1120599711 14:86487067-86487089 TAGAAAAAGAAGAAACAGAAGGG + Intergenic
1120663120 14:87274271-87274293 GAGTAGTAGCAGAAAAAAAATGG + Intergenic
1121506104 14:94478770-94478792 GAGTAGAGGAAGAAACAGCAGGG - Intronic
1122258067 14:100494317-100494339 GACAATACGCAAAAACAGAAGGG - Intronic
1122492884 14:102131818-102131840 AAGGATAAGCAATAACAGAAAGG - Intronic
1123181574 14:106476236-106476258 TAGCAGAAGCAGAAACACAAAGG - Intergenic
1202945330 14_KI270726v1_random:20493-20515 TAGCAGAAGCAGAAACACAAAGG + Intergenic
1123695039 15:22872978-22873000 AACAAGAAGCAGAAACAGAATGG + Intronic
1124140111 15:27069931-27069953 CAGCATGAGCAGAGACAGAATGG - Intronic
1124174864 15:27415138-27415160 GAATATGAGGAGAAAGAGAAAGG - Intronic
1124431551 15:29612963-29612985 GAGTATACGCAGAACGAGACTGG + Intergenic
1124573718 15:30889364-30889386 GAGTACAAGGAGAAAATGAATGG - Intergenic
1126212279 15:46113363-46113385 GAGTATAAGCAGGAAGAGGCTGG - Intergenic
1127234232 15:57030636-57030658 GAGTTTCAGCAGAAAGACAATGG - Intronic
1127876537 15:63116484-63116506 AAGTATGGGCAGAAAGAGAAGGG - Intergenic
1128705752 15:69836549-69836571 CAGTGGAAACAGAAACAGAAAGG - Intergenic
1128877210 15:71212150-71212172 GAGTAGAAACAGAAAGAGAAAGG - Intronic
1130129495 15:81127124-81127146 GAGATTAATAAGAAACAGAATGG - Intronic
1130933058 15:88445566-88445588 GAGTGTTAGCAGAAACAACAGGG + Intergenic
1131536844 15:93244896-93244918 GAGTGTAAGAAGAGACGGAATGG - Intergenic
1131565842 15:93484635-93484657 GAGGATAGGCAGAACCAAAATGG + Intergenic
1131826930 15:96329935-96329957 AGGAATAAACAGAAACAGAACGG + Intronic
1132863583 16:2083130-2083152 AAGTAGAAGCAGCAACAGAGGGG - Intronic
1134544100 16:15094446-15094468 GAGTATAAGGAGAGACGGGAAGG + Intronic
1136516101 16:30769234-30769256 GAGGACATGCAGGAACAGAACGG + Exonic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1138248800 16:55486933-55486955 TAGTAAAAGCATAAACAGGAAGG - Intronic
1138312230 16:56036803-56036825 GAATATTACCAGAAACAGAAAGG - Intergenic
1139350347 16:66331141-66331163 GAGGATATGCAGAATAAGAAGGG + Intergenic
1139870149 16:70101349-70101371 CTGTATAAGCAGAGACAGATTGG + Intergenic
1140385296 16:74531204-74531226 CTGTATAAGCAGAGACAGATTGG - Intronic
1140549851 16:75854031-75854053 GAGTAAAATCAGAAATGGAATGG - Intergenic
1141217384 16:82037598-82037620 GAGTAGAAGCAAAACCAAAATGG + Intronic
1141263073 16:82471333-82471355 AAGGAGAAGGAGAAACAGAAGGG - Intergenic
1141474531 16:84263823-84263845 GTGTAAAAGCAGAAACACAAAGG - Intergenic
1141582450 16:85009368-85009390 GAGTATTAGCATGAATAGAATGG - Intronic
1146502113 17:33373040-33373062 TAGGATAAGCAGAAAGGGAATGG + Intronic
1147328358 17:39681176-39681198 TCTTATAAGCAGAAACACAAGGG + Intronic
1147343729 17:39772581-39772603 GAGAACAAGAAGAAACAGGAAGG + Intronic
1148104226 17:45110806-45110828 GAGGATAATCAGAATCAAAAGGG - Exonic
1149939369 17:60846686-60846708 GAAAATAAGCAGAGACAGAGAGG - Intronic
1152025816 17:77808542-77808564 GAGTTTGAGCAGACTCAGAAGGG - Intergenic
1203182176 17_KI270729v1_random:69422-69444 GAGTATAAACAGATCCACAAAGG - Intergenic
1153253498 18:3147202-3147224 GAGTTTGTGCAAAAACAGAAAGG + Intronic
1154225213 18:12497239-12497261 GAGTAGAATCAGAGACAGACTGG - Intronic
1155523852 18:26696833-26696855 CAGTATTAGCATAAATAGAAAGG - Intergenic
1155705644 18:28807683-28807705 GAAAATTATCAGAAACAGAAAGG - Intergenic
1155895715 18:31323496-31323518 GAGAATGGGCAGAAAAAGAAAGG - Intronic
1156073351 18:33240506-33240528 GAATACAATCAGAAACAAAATGG + Intronic
1156867564 18:41905759-41905781 AAGAAAAATCAGAAACAGAAAGG - Intergenic
1157008148 18:43611629-43611651 AAGTATAAGCACAAACCAAATGG - Intergenic
1157349396 18:46871228-46871250 GAAGAAAAGCAGAAACAAAAGGG + Intronic
1158373623 18:56837529-56837551 GAATTTAAGAAGAAACATAAGGG + Intronic
1158580288 18:58674842-58674864 GAGAAGAAAAAGAAACAGAATGG - Intronic
1158753427 18:60293600-60293622 TAGTATGAGAAGAAAGAGAATGG - Intergenic
1159234151 18:65649342-65649364 GGAAATAAGGAGAAACAGAAGGG + Intergenic
1159290799 18:66416207-66416229 TAATATTAGCAGAAACAGTAAGG + Intergenic
1160156759 18:76440920-76440942 GAGTATATGCAAACACTGAAAGG + Intronic
1160332267 18:78005066-78005088 GAGTAAAAGCACAAACAAAATGG + Intergenic
1161388422 19:4008836-4008858 GAGAATAGGCAGAAAGAGAGGGG - Intronic
1161751051 19:6097017-6097039 CAGTATAATCAGAAACAGAAAGG + Intronic
1161899234 19:7105449-7105471 AAGTAGAGGTAGAAACAGAATGG + Intergenic
1164482416 19:28622701-28622723 GAGCAAAAACAGAAAGAGAAGGG + Intergenic
1167672424 19:50861059-50861081 GAGTTCAAGCAGATACAGCATGG + Intergenic
1168546639 19:57257507-57257529 GAGTATTAACAGGAACAAAAAGG - Intergenic
925274763 2:2640986-2641008 GAGCAGAAGCAGAGGCAGAAGGG + Intergenic
925952382 2:8927252-8927274 GTGTTTAAGAAGTAACAGAAAGG - Intronic
926255621 2:11193445-11193467 GAGATTAAACAAAAACAGAAAGG + Intronic
927360970 2:22232990-22233012 ATGAAAAAGCAGAAACAGAAAGG + Intergenic
930207517 2:48602770-48602792 GAGTAGAAGAAAAAAGAGAATGG + Intronic
931028697 2:58145181-58145203 AAGTAGACTCAGAAACAGAAGGG - Intronic
933448004 2:82406785-82406807 TAGGAAAAGAAGAAACAGAATGG + Intergenic
933831461 2:86213365-86213387 GACTAAAAGCAGGAACAGATGGG - Exonic
935488848 2:103692395-103692417 GAGAAAAAGCAGAATCTGAAGGG + Intergenic
936560866 2:113538823-113538845 AAGTATAAGCATGAATAGAAAGG + Intergenic
936682571 2:114790985-114791007 GAATATAAGAAAAAAAAGAAGGG + Intronic
936824260 2:116561679-116561701 GAAGATAAGCAGAAATAGAATGG + Intergenic
937761625 2:125611213-125611235 GAACAAAAGCAGAAAGAGAAAGG + Intergenic
937851003 2:126635953-126635975 GAGTATCAAAAGAAACAGGAAGG - Intergenic
938270529 2:129966308-129966330 GAATAAAAACAGAAACAAAAAGG + Intergenic
938588146 2:132711928-132711950 GAGAATAAGCAGAAATAAAGAGG + Intronic
940652964 2:156455600-156455622 GACTATGAGCAGAGACATAATGG - Intronic
941134277 2:161694495-161694517 CAGTATATATAGAAACAGAAAGG - Intronic
942676954 2:178436901-178436923 GAGGAAAAGCAGAAAGAAAAAGG - Intronic
944749595 2:202695225-202695247 GTATATAAACAGAAACAAAAAGG - Intronic
944758540 2:202789093-202789115 GAGTGTAAATAAAAACAGAAAGG + Intronic
944763710 2:202842751-202842773 GAGTTTAAGCAGAAGAAGAGAGG - Intronic
945953442 2:216062560-216062582 GGGTACAAGCTGAAACAGACTGG + Intronic
946169509 2:217886248-217886270 GAGTAAAAGAGGAAGCAGAAAGG + Intronic
946346674 2:219116721-219116743 GAGAACAAGCAGAAAGAAAATGG + Intronic
946692683 2:222320546-222320568 GAGGATAAACAGAAACACACTGG - Intergenic
946997582 2:225412643-225412665 TAGTAGAAAAAGAAACAGAAAGG + Intronic
948106288 2:235416860-235416882 AAGTATTAGGAGAAAGAGAAAGG - Intergenic
948500094 2:238386085-238386107 GAGTTTTATCAGAAAGAGAAAGG + Intronic
948539443 2:238677699-238677721 AAATATAATCAGAAACAAAAAGG - Intergenic
1168747925 20:259988-260010 GAGTATAAGGAGGGAGAGAAAGG + Exonic
1169559912 20:6788355-6788377 AAGAATAAGAAGAAACAGACTGG - Intergenic
1169949621 20:11029027-11029049 GAGTATAAGAAAAAGGAGAAAGG - Intronic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170418748 20:16171421-16171443 GAGGGAAAGCAGAAAGAGAAAGG + Intergenic
1171110325 20:22474676-22474698 AAGTATAAGAAGAAACTAAACGG + Intergenic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1172950761 20:38722289-38722311 GAATTTCACCAGAAACAGAAGGG + Intergenic
1173089349 20:39955464-39955486 GAGTAAATGTAGAACCAGAAAGG - Intergenic
1173472597 20:43335386-43335408 GAGTAAAAGCAGAAAGACAAAGG + Intergenic
1174165677 20:48581973-48581995 CAGTTTAGGCAAAAACAGAATGG - Intergenic
1174850399 20:53988343-53988365 GAGACTAAGCAGAGAGAGAAAGG - Intronic
1177191731 21:17859471-17859493 GAGCATCATCAGAAAGAGAAAGG - Intergenic
1177428021 21:20950844-20950866 GAGTAAAAGCAGGGAAAGAAGGG + Intergenic
1180463585 22:15590423-15590445 GAATAAAAACAGAAACAAAAAGG - Intergenic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1182073568 22:27479522-27479544 GAGTATAAGCGGAACGAGAAAGG - Intergenic
1183040231 22:35172386-35172408 GAGTAGGAGTTGAAACAGAATGG - Intergenic
1184259305 22:43305588-43305610 GAGCACAGGGAGAAACAGAAAGG + Intronic
949134273 3:543750-543772 CAAGATAAACAGAAACAGAATGG - Intergenic
949156829 3:837853-837875 GAAAATAAGCAAAAATAGAAGGG + Intergenic
949199659 3:1360011-1360033 GAGTATGTTAAGAAACAGAAAGG - Intronic
949698248 3:6724442-6724464 GATTATAAGCAGAGGCTGAAAGG - Intergenic
950882848 3:16337086-16337108 GAGAGTGAGCAGAAACAGCAAGG - Intronic
950980035 3:17293175-17293197 GAGTCTGAACAGACACAGAAAGG - Intronic
953726820 3:45406829-45406851 GAGTTTAAGAAGAAACCGATTGG - Intronic
955114702 3:55986021-55986043 GAGGATAAGCAGAAAGGAAAAGG + Intronic
955453289 3:59093640-59093662 GAGGATAAACATAAATAGAAAGG - Intergenic
956741746 3:72280901-72280923 GGGTAGAAGGAGAAACAGATAGG - Intergenic
957474944 3:80710375-80710397 TAGTATCAGCATCAACAGAAAGG + Intergenic
958073998 3:88652860-88652882 TAGTATATGTAGAAACATAAAGG - Intergenic
958479320 3:94626647-94626669 GAGTGCAAGCAGAAAAAGGAGGG - Intergenic
960157778 3:114315069-114315091 GAGTATAATGAGAAAAAAAAAGG + Intergenic
960620753 3:119634750-119634772 GAGCAGAAGCAAAAACAAAAGGG - Intergenic
962911435 3:139855121-139855143 GAGGATAGGAAGAAAGAGAAAGG - Intergenic
963554216 3:146766644-146766666 GAGAATAAGTAAAAACTGAAAGG + Intergenic
964355012 3:155842516-155842538 TAGTAAAAGAAGAAACACAAGGG - Exonic
964387620 3:156165345-156165367 GACTATAAACAGAAACGGAGTGG + Intronic
965732921 3:171791849-171791871 AACTATAAGCATAAACACAATGG + Intronic
965956809 3:174379982-174380004 GATTTTAAGCAGAAAAAGGAAGG + Intergenic
966666299 3:182475109-182475131 TAATATAAGCAGTAACGGAAAGG + Intergenic
967014620 3:185470505-185470527 GAGTAGAAGCAGGAAGAGACGGG - Intronic
967516335 3:190373151-190373173 AAGTATAAGGAGAAAGGGAAGGG - Intronic
967672190 3:192250192-192250214 CAGAATAAACAGAAATAGAAAGG - Intronic
969727189 4:8927306-8927328 TAGTAAAAGGAGAAACAGGAGGG - Intergenic
970359573 4:15295306-15295328 GAGATTAAACCGAAACAGAAGGG - Intergenic
970790436 4:19852042-19852064 GAGTAAGACCAGACACAGAAAGG - Intergenic
970932563 4:21529665-21529687 GGATATAAGCAGAAAGAGATGGG + Intronic
971040373 4:22745062-22745084 CAGTATAAGGAGGAATAGAATGG - Intergenic
971125744 4:23752144-23752166 GAGGCTAAGAAGAAACAGTATGG + Intergenic
972332741 4:38078990-38079012 CAGTAGAAACAGAAGCAGAAAGG + Intronic
972484191 4:39527016-39527038 GGGTAAAGGCAGAAAGAGAAGGG + Intronic
972956329 4:44396498-44396520 GACTTTAAGAAGAAACAAAATGG - Intronic
973009847 4:45058758-45058780 GAGTATTACCAGAGACAAAAAGG + Intergenic
973268891 4:48240323-48240345 GGGTAAAAGCAGGAAGAGAAAGG + Intronic
973869313 4:55149160-55149182 GAAGATAAGCAGAAAAAAAAGGG + Intergenic
975425963 4:74227840-74227862 GTGTAAAAGTAGAAACAGAGAGG + Intronic
976468961 4:85404817-85404839 GTATATAAGCAGAAATAAAAGGG - Intergenic
977536880 4:98263809-98263831 GGGGATAAGCAGAAACAGAAAGG + Intronic
978257229 4:106707377-106707399 GAGTATGGGAAGAAACAGGAAGG + Intergenic
978726795 4:111978138-111978160 GAGTAGAGGAAGAAGCAGAAAGG - Intergenic
979056812 4:116005778-116005800 GTGTTTAAACAAAAACAGAAAGG - Intergenic
980767850 4:137331503-137331525 CAGTATAAGAAGAAACAGGCAGG - Intergenic
981521608 4:145668219-145668241 GAATATAAACAGAAGCAAAAAGG - Intergenic
981701357 4:147610478-147610500 GAGTATAAGATGAAGAAGAAGGG + Intergenic
981894137 4:149777246-149777268 GAGTAGAAGCAGAGACAAATTGG - Intergenic
984227925 4:177057515-177057537 GGTTATAAGCAAAAACAGATTGG - Intergenic
985482413 5:122839-122861 GAGTATTACCAGAGACAGATAGG + Intergenic
986484142 5:8218191-8218213 CACTAGAAGCAGAGACAGAAAGG - Intergenic
988626333 5:32879199-32879221 GAGGATAAGGAGAAATAGGAAGG + Intergenic
988628885 5:32907758-32907780 GAGGATATGGAGAAACAGGAAGG - Intergenic
989186849 5:38634215-38634237 GAAAATAAGAAGAAAAAGAAAGG + Intergenic
989276113 5:39591364-39591386 GATAATGAGCAGACACAGAAAGG + Intergenic
989474978 5:41864418-41864440 AAGTCTAGGCAGAGACAGAAAGG + Intronic
990406680 5:55498016-55498038 GAAGATAAGCAGAACCAGGAGGG + Intronic
990441453 5:55849833-55849855 GAGCATAAGCCAAAACAAAAAGG - Intergenic
990446611 5:55899233-55899255 GTGTATAATCAGTAACAGAAGGG + Intronic
991004053 5:61810564-61810586 AATTATAAGCAGAAACAGCTGGG + Intergenic
991111003 5:62899297-62899319 TAGTATAAGCAGAGAGAGAGAGG + Intergenic
991308108 5:65203014-65203036 GAGGAAAAGCAGACACATAAGGG - Intronic
991511682 5:67384542-67384564 GAGTATGAGTTGAACCAGAAAGG - Intergenic
991536829 5:67678498-67678520 GAGTAGAATAAGAAAGAGAATGG + Intergenic
991611855 5:68457709-68457731 GAGTAAAAACATAACCAGAAGGG + Intergenic
991612722 5:68465632-68465654 GAGAATAAGGAGAAAAGGAAAGG - Intergenic
992467595 5:77022481-77022503 GAGAAGAAGAAGAAAGAGAAGGG + Intergenic
995152702 5:108868105-108868127 GGGGATAAGCACAAACTGAAGGG - Intronic
995688104 5:114793529-114793551 AAGTACCACCAGAAACAGAATGG + Intergenic
995763194 5:115586156-115586178 GAGTATAGATAGAAAAAGAAAGG + Intronic
996497189 5:124172601-124172623 GAGTAGAAAGAGAAAGAGAATGG + Intergenic
996937723 5:128967169-128967191 GATAAGAAGAAGAAACAGAAAGG - Intronic
997334617 5:133098100-133098122 GAGCATATGCAGAAATATAATGG - Intronic
997462888 5:134066765-134066787 GAGGAAAAGGAGAAAGAGAAGGG + Intergenic
998343453 5:141439718-141439740 AATTATAAGCAGGAACGGAACGG + Intronic
998461056 5:142310346-142310368 GAGAATAAGCAGCCACTGAAAGG - Intergenic
998626398 5:143851485-143851507 GAGTATTAGAAAAAACAGAAAGG + Intergenic
1000828260 5:166073058-166073080 GAATAAAAGAAGAAAAAGAAAGG + Intergenic
1002554726 5:180027387-180027409 GAGTATAAGCAGAAACAGAAAGG + Intronic
1002985442 6:2186160-2186182 GTGTACAAACAGAAACATAAAGG + Intronic
1003044103 6:2717071-2717093 CAGTATGAGCAGAAACAGGTTGG + Intronic
1003186852 6:3839541-3839563 CACTATAAGCAGGAACAGAATGG - Intergenic
1003981302 6:11392868-11392890 GAGTGGCAGCAGAAACAGACAGG - Intergenic
1004975259 6:20958315-20958337 GAGGATGAGAAGAAACAGCAAGG - Intronic
1004987898 6:21103429-21103451 GAGTATAAGAAAAAAAAAAAAGG + Intronic
1005280620 6:24269997-24270019 GAGTAGAAGAAGAAACAAACAGG + Intronic
1005440117 6:25858290-25858312 AAGAATAAGAAGAAAGAGAATGG - Intronic
1005968011 6:30741385-30741407 GAGAAAAAGCAGAGAGAGAAGGG + Intronic
1006290368 6:33130713-33130735 GAATATAAGGAGTCACAGAAAGG + Intergenic
1006356517 6:33561996-33562018 GAGAAGAAGCAGAAACACACAGG - Intergenic
1006906113 6:37534870-37534892 CAGGATAAGGAGAAGCAGAAAGG - Intergenic
1006974116 6:38081282-38081304 GAGTGTAAGAAGACACAGATGGG - Intronic
1007648967 6:43405255-43405277 GAGTATAAACAGAAAAAAAGTGG + Intergenic
1008178473 6:48298210-48298232 AAGGATAAGGAGAAACAGAGTGG - Intergenic
1008178615 6:48299982-48300004 AAGGATAAGGAGAAACAGAGAGG + Intergenic
1008826068 6:55695934-55695956 GAGTATAAGTAAAAATAGAGAGG - Intergenic
1009052629 6:58295366-58295388 GAGTATAAACTGAAACATCATGG - Intergenic
1009238475 6:61155227-61155249 GAGTATAAACTGAAACATCATGG + Intergenic
1009377285 6:62988643-62988665 GAGTATAATCAGAAACAAATAGG - Intergenic
1009533278 6:64847981-64848003 GAAAATATGCAAAAACAGAATGG - Intronic
1009676304 6:66826830-66826852 GTGAATAAGCAGAAGCAGCAGGG - Intergenic
1010091883 6:71992488-71992510 GAGGAGAAGAAGAAAAAGAAGGG - Intronic
1010168012 6:72940187-72940209 GATTTGAAGCAGAACCAGAAAGG + Intronic
1010303500 6:74288807-74288829 AAGAAAAAGCAGAAACTGAATGG - Intergenic
1011009484 6:82687594-82687616 GAATATAAAGAGAAACAGAAAGG + Intergenic
1012155869 6:95819453-95819475 GGGTAGAGGTAGAAACAGAAAGG + Intergenic
1012182943 6:96177516-96177538 GAGTGTAGTCAGAAACAGATAGG - Intronic
1012292002 6:97468271-97468293 TAGTATAAGAAGAAATAAAAGGG + Intergenic
1013611069 6:111795644-111795666 TAGCAAAATCAGAAACAGAAGGG + Intronic
1013891259 6:115030589-115030611 GAGGAGGAGGAGAAACAGAAGGG - Intergenic
1014290310 6:119550767-119550789 GAGTGGAGGCAGAAACAGACAGG + Intergenic
1014671840 6:124314041-124314063 CTGTATAAGCAAAAACTGAAAGG - Intronic
1014905592 6:127023275-127023297 TTGTCTAAGTAGAAACAGAAGGG - Intergenic
1014929400 6:127316511-127316533 AAAAATAAGCAGAAACACAAAGG + Intronic
1015827733 6:137333010-137333032 GAGAAAATGCAGAAACAGCAGGG - Intergenic
1015868445 6:137751804-137751826 AAGAATAAGCAGCAGCAGAAGGG + Intergenic
1016942354 6:149493378-149493400 GGGTGTAAGCAGGATCAGAATGG - Intergenic
1017250113 6:152271223-152271245 GAAAAAAAGAAGAAACAGAAAGG - Intronic
1021530014 7:21633708-21633730 GAGTCTAAGAAGAGACAGAGAGG + Intronic
1022163070 7:27731388-27731410 CAGAAGAAGCAGAAACAGAGAGG - Intergenic
1023140381 7:37096042-37096064 GAGTACATACAGAAAAAGAAAGG - Intronic
1023526823 7:41113010-41113032 GAGTATGCCCAGAAACAGAGTGG - Intergenic
1025055781 7:55763862-55763884 GAGGAAAGGCAGAAACAGACAGG - Intergenic
1025608829 7:63058968-63058990 GAGGAAAGGCAGAAACAGACAGG - Intergenic
1025845737 7:65195246-65195268 CATTATAACCTGAAACAGAAGGG + Intergenic
1025895959 7:65700959-65700981 CATTATAACCTGAAACAGAAGGG + Intergenic
1026596814 7:71739760-71739782 AAGTAGAAGCTGAAACAGAGAGG - Intergenic
1027723615 7:81774749-81774771 AAGTGGTAGCAGAAACAGAATGG - Intergenic
1028017100 7:85729788-85729810 GAGAAGGAGCAGAAAAAGAATGG - Intergenic
1031226096 7:119040011-119040033 CAGTGTTAGGAGAAACAGAAAGG - Intergenic
1033004392 7:137545865-137545887 GAGAAAATGTAGAAACAGAATGG + Intronic
1033171509 7:139088716-139088738 TAGTTGCAGCAGAAACAGAATGG - Intronic
1033176761 7:139131481-139131503 GAGTGTAAGGAGAAAAGGAAAGG - Intergenic
1034004377 7:147452978-147453000 GGGAAGAAGTAGAAACAGAAAGG + Intronic
1034911200 7:155000387-155000409 GAGTAGGATCAGAAACAGACTGG - Intronic
1035330461 7:158093423-158093445 GAGTAAAAGCACAAACAGTGTGG - Intronic
1036624407 8:10455157-10455179 AAGTATAAACAGACTCAGAAAGG - Intergenic
1037081482 8:14792792-14792814 GAGGATGAGAAGCAACAGAAGGG - Intronic
1038094119 8:24288225-24288247 GAATTTAAGCAGAAACAACAGGG - Intergenic
1038806902 8:30802380-30802402 GATTATATACAGAAACATAATGG + Intronic
1039281648 8:35992048-35992070 AACTATAAGAAGAAACAAAAAGG - Intergenic
1039416091 8:37395195-37395217 GAATATAAGGAGAAACCTAAGGG - Intergenic
1039434898 8:37553335-37553357 GAGTCTAAGCAGCAACCGAGGGG + Intergenic
1040575363 8:48647037-48647059 CAGTAGAAGCAGAAACACACAGG + Intergenic
1040932932 8:52754152-52754174 GAGATTAATAAGAAACAGAATGG - Intergenic
1041012085 8:53554603-53554625 GAGAATAGTCAGAAACAGATTGG + Intergenic
1042008798 8:64215109-64215131 GACTATAATCAAAAACACAAAGG + Intergenic
1043261709 8:78208373-78208395 GAGTAAAAACAGAAGCAGCATGG + Intergenic
1043609523 8:82045176-82045198 GAGGATAAGAAGAAATAAAAAGG + Intergenic
1044512422 8:93098033-93098055 GAGTACAAACAAAAACAGAAAGG - Intergenic
1046816384 8:118588700-118588722 GAGTATAACCATAACCTGAAGGG + Intronic
1047275867 8:123404519-123404541 GAGTACAAGCACAAAAAGACAGG - Intronic
1047435376 8:124831456-124831478 GAGGATGAGAAGAAGCAGAAAGG - Intergenic
1047561224 8:125989702-125989724 GAGCCTCTGCAGAAACAGAAAGG - Intergenic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1049112492 8:140656246-140656268 GAGTATTATCAGAAATAAAAAGG + Intergenic
1049207044 8:141368427-141368449 GAGTATCAGCAGAAGCACACGGG - Intergenic
1049891816 9:76503-76525 AAGTATAAGCATGAATAGAAAGG - Intergenic
1050020773 9:1282509-1282531 CAGTAAAATCAGAAACAAAAGGG - Intergenic
1050107768 9:2183205-2183227 GAGTACAATCAGAAAAATAAAGG - Intronic
1050934491 9:11377978-11378000 TAGTGTAAGCAGAGACACAATGG + Intergenic
1052130802 9:24844302-24844324 GAGAATAAACAGAAACACTATGG - Intergenic
1053033389 9:34802491-34802513 GAGTATTAACAGAAACATAATGG - Intergenic
1053392824 9:37747960-37747982 CAGCAAAAGCAGGAACAGAAAGG + Intronic
1053733240 9:41077594-41077616 AAGTATAAGCATGAATAGAAAGG - Intergenic
1055814962 9:80194187-80194209 AAGTATAGGCACAAAAAGAAGGG + Intergenic
1056170271 9:83979372-83979394 AAGTTTAAGCAAAAACAGCAGGG + Intronic
1058779337 9:108317669-108317691 AAATAGAAGCAGAAAAAGAATGG + Intergenic
1058792975 9:108469746-108469768 TACTTAAAGCAGAAACAGAAAGG - Intergenic
1060378301 9:123139174-123139196 GAGTATCAGCAGTAACTGATGGG - Intronic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1187004683 X:15220457-15220479 GAGTATATGCAGCATGAGAAGGG - Intergenic
1188379688 X:29476220-29476242 GAGTATAACCAGAGACAAGATGG + Intronic
1189412459 X:40784971-40784993 TAGTTTAAGCAGAAAGAGATTGG - Intergenic
1189865304 X:45321375-45321397 GAATAGAAGGAGAAACAAAAAGG - Intergenic
1189985165 X:46546864-46546886 GTGTTTATGCAGAAAGAGAAGGG + Intergenic
1190473460 X:50805716-50805738 GGGTATGAGAAGAAACAGGAGGG + Intronic
1191119660 X:56890468-56890490 GAGTGTAAGCAGAAGCAGGATGG + Intergenic
1192002415 X:67168110-67168132 TTGTATAAGCAGAGAAAGAAAGG - Intergenic
1192740943 X:73892376-73892398 GAGTATGAGCCGAAGCAGGATGG + Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1192995240 X:76505957-76505979 GAGTAGAAGGAGCAGCAGAAAGG - Intergenic
1193572757 X:83163696-83163718 GAATTTAATCAGAAACAGGAAGG - Intergenic
1193598685 X:83481210-83481232 GAGGACAAGCAGAAACAAAATGG + Intergenic
1195011671 X:100738166-100738188 GAGCATAAGCAAAAACAGAAAGG + Intergenic
1195558546 X:106255978-106256000 AAGTATAAGAAGAGACAAAACGG - Intergenic
1195636423 X:107121021-107121043 GAATATAAGTATAAACAAAACGG + Intergenic
1196001248 X:110788628-110788650 GAGTAGATGAAGAAACAGAGGGG - Intronic
1198014724 X:132598039-132598061 GAGTACAAATTGAAACAGAATGG + Intergenic
1198229121 X:134672994-134673016 CAGTTTAAGCAGACACAGAGGGG - Intronic
1198549773 X:137732902-137732924 AAGTGTTAGAAGAAACAGAAAGG - Intergenic
1198784563 X:140273179-140273201 GAGAGTGAGCAGAATCAGAATGG - Intergenic
1199074056 X:143510222-143510244 GAGAACAAGCAGAAATAGAAAGG - Intronic
1199784097 X:151088963-151088985 GAATATAAGGAGAAAGAGTAGGG - Intergenic
1200287685 X:154839180-154839202 GGATAAAAGAAGAAACAGAAGGG - Intronic
1200416075 Y:2911449-2911471 GAGGATAGGCAGAAACAAAGAGG + Intronic
1200809622 Y:7470209-7470231 GAGGAGGAGGAGAAACAGAAGGG + Intergenic
1201473917 Y:14360807-14360829 GTGGATGAGCAGACACAGAATGG - Intergenic