ID: 1002556870

View in Genome Browser
Species Human (GRCh38)
Location 5:180048746-180048768
Sequence CTGAAGCTACAGATGGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 307}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002556870 Original CRISPR CTGAAGCTACAGATGGCAAA GGG (reversed) Intronic
901398646 1:9000940-9000962 CTGAAGCCCCAGATGTCAAAGGG + Intergenic
903067881 1:20710958-20710980 CTGAAGCTTGAGATGACAGAGGG + Intronic
903713839 1:25347766-25347788 CAGAAGCCACTGATAGCAAAGGG + Intronic
904194274 1:28773305-28773327 GTGAAGCAACATTTGGCAAATGG - Intergenic
904390919 1:30185303-30185325 CAGATGCCACAGATGGCACAAGG - Intergenic
904560358 1:31393065-31393087 ATGAACCTTCAGAGGGCAAAAGG + Intergenic
906065266 1:42975975-42975997 GTGAACCTTCAGAGGGCAAAGGG - Intergenic
907639082 1:56167470-56167492 CTGAATCTACAGGTGGGAAAGGG + Intergenic
909284272 1:73795118-73795140 CTGAAGCCAGAGCTGGCTAAAGG + Intergenic
910196212 1:84642268-84642290 CTGTAGCTACAGTTGGGACACGG + Intergenic
910656094 1:89620146-89620168 CTGCATCTTCATATGGCAAAAGG + Intergenic
911203545 1:95070398-95070420 GTGAAACTTCAGAGGGCAAAAGG + Intronic
911407120 1:97455916-97455938 CTGAAGTTCCTGATGACAAAAGG - Intronic
912314918 1:108659421-108659443 CAGTAGCTACACATGGCAAGTGG - Intronic
912317889 1:108682602-108682624 TTCAAGTTTCAGATGGCAAATGG + Intergenic
918039741 1:180906753-180906775 CTGAATCTACAGATGCCCAAAGG - Intergenic
919044188 1:192430612-192430634 CTGAAGCTGCAGAGGGCAGCTGG - Intergenic
923775779 1:236977386-236977408 CTGCATCTTCAGATGGCAAAAGG + Intergenic
923779688 1:237010976-237010998 GTGAAACTTCAGAGGGCAAAGGG + Intergenic
1065829159 10:29598618-29598640 CTGAAACTAGAGATGGCAGAGGG - Intronic
1066247960 10:33602861-33602883 GTGAACCTTCAGAGGGCAAAGGG - Intergenic
1067151826 10:43742267-43742289 CTGATGCCACATATGTCAAATGG - Intergenic
1067206893 10:44225623-44225645 CTCAGGTTACAGATGGCAATGGG + Intergenic
1067709548 10:48637178-48637200 CTGAAGCTGCAGATGGAGACAGG + Intronic
1067719840 10:48719988-48720010 CTGAAGCAACAGATGGGACTTGG - Intronic
1067756454 10:49009320-49009342 CTGAAGCAAGAGAAAGCAAATGG + Intergenic
1071689178 10:87797434-87797456 TTGGTACTACAGATGGCAAAGGG - Intronic
1071897240 10:90080967-90080989 TTGATACTTCAGATGGCAAAGGG - Intergenic
1071991378 10:91103750-91103772 CTGAAGGTACTCATGGCCAAAGG - Intergenic
1072470861 10:95711858-95711880 GTGAAACTTCAGAGGGCAAAGGG + Intronic
1073676010 10:105647868-105647890 CTGAAACTGCAGAGGGCAAAAGG + Intergenic
1073678407 10:105675860-105675882 GTGAACCTTCAGAGGGCAAAGGG + Intergenic
1074818227 10:117160319-117160341 CAGAAGCTCCAGTTGGCAGAAGG - Intergenic
1074935555 10:118176589-118176611 CAGAATCTACAGATAGTAAAAGG + Intergenic
1076585782 10:131546528-131546550 CTGAAGCTGCTGGTGACAAAAGG - Intergenic
1077213578 11:1384607-1384629 CTGTAGCTACAGAAGGCAGAGGG - Intergenic
1077925903 11:6682016-6682038 CTGGAGCTAGAGATGTAAAATGG - Exonic
1078571842 11:12465269-12465291 CTGAGGCAGCACATGGCAAAGGG - Intronic
1079276164 11:19039896-19039918 CAGGAGCTGCAGGTGGCAAAGGG + Intergenic
1079721662 11:23822509-23822531 CTGAAGGAACAGAAGGCAAAAGG - Intergenic
1081597192 11:44467385-44467407 CTGAGGCTGCAGATGGCCAAGGG + Intergenic
1082869644 11:57932153-57932175 CAGAAGCAACAGATGAAAAAAGG - Intergenic
1083177490 11:60960296-60960318 GTGAAACTTCAGAGGGCAAAAGG - Intergenic
1084150779 11:67287007-67287029 CTGAAGCCAGAGATGGCCAAGGG - Intergenic
1084757253 11:71247746-71247768 CTGAGGCTGCAGATTCCAAATGG - Intronic
1085868629 11:80324478-80324500 CTGATGCTAGAGATGGGAACGGG - Intergenic
1086288374 11:85275121-85275143 GTGAAACTTCAGAGGGCAAAGGG + Intronic
1086648475 11:89255720-89255742 CAGAACCTACAGATATCAAAAGG - Intronic
1087482787 11:98722261-98722283 CTGAAGCCACATATAACAAATGG + Intergenic
1090457839 11:126865175-126865197 TTTTAGCTACAGATGGTAAATGG - Intronic
1093772442 12:23033369-23033391 CTGGAGCTACAGGTGCCAAATGG - Intergenic
1094296727 12:28915116-28915138 CAGAAGCTGCAGCTGGCAACAGG - Intergenic
1095270639 12:40214651-40214673 CTGCATCCACACATGGCAAAAGG - Intronic
1095303997 12:40619570-40619592 GTGAAACTTCAGAGGGCAAAGGG + Intergenic
1095897839 12:47298311-47298333 CTGAAGCCATAGAAGCCAAAAGG - Intergenic
1097386949 12:58961572-58961594 CTGAAGATAAACTTGGCAAATGG + Intergenic
1097557417 12:61156501-61156523 GTGAACCTGCAGAGGGCAAAAGG - Intergenic
1097791000 12:63815540-63815562 CTCAAACAACAGATTGCAAAAGG - Intergenic
1100790321 12:98123252-98123274 CTGAAGCTACAGCTAGCACAGGG + Intergenic
1100796927 12:98192017-98192039 CTGAAGTTACAGATGTGAATGGG + Intergenic
1103136714 12:118513783-118513805 CTTGAGCCACAGATGGCAAATGG - Intergenic
1103842324 12:123875267-123875289 CTGAAGCTGCTGTTGGAAAAAGG + Exonic
1104173839 12:126309702-126309724 CTGAAGCCAGAGATGGTAAGTGG - Intergenic
1104179320 12:126363100-126363122 CTGAAGCTACAGAATGCATTGGG + Intergenic
1104510116 12:129369770-129369792 CTGAAGCTACAAATAGGAAAAGG + Intronic
1105324806 13:19360690-19360712 CTGTGGCTACACATGTCAAATGG + Intergenic
1105868479 13:24482869-24482891 CTGTGGCTACACATGTCAAATGG - Intronic
1105941163 13:25149257-25149279 CTGAAGCTACACAAAGAAAAGGG - Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106939670 13:34764033-34764055 GTGAACCTTCAGAGGGCAAAGGG + Intergenic
1107242631 13:38255123-38255145 GTGAACCTTCAGATGGCTAAGGG + Intergenic
1109258226 13:60110291-60110313 CTGTAGGTACAAATGCCAAAAGG + Intronic
1109337002 13:61006664-61006686 CTGAAGCTACTCAAGGCAACAGG - Intergenic
1109766109 13:66900266-66900288 CTTATTCTACAGATGGGAAAAGG - Intronic
1109832432 13:67808961-67808983 CTAAAACTACAAAGGGCAAATGG + Intergenic
1110940501 13:81342851-81342873 CTGAAGCAACAAAAGGCAATAGG + Intergenic
1112630151 13:101152129-101152151 CTGAAGCCACAGATAGAAATTGG + Intronic
1113130038 13:107026059-107026081 TGGAAGCAATAGATGGCAAAGGG - Intergenic
1114592907 14:23884524-23884546 GTGAACCTTCAGAGGGCAAAGGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1119638752 14:76297909-76297931 GTGGTGCTACATATGGCAAATGG - Intergenic
1120081296 14:80219373-80219395 CTGGGGCTACAGATAGAAAACGG - Intronic
1120375883 14:83706686-83706708 CTGCATCAACAGATGGCAGACGG - Intergenic
1120401914 14:84043042-84043064 CTGAAAATGCAGATGGCAAGTGG - Intergenic
1120470690 14:84919756-84919778 CTGAATCAACAGATGTGAAATGG + Intergenic
1121365317 14:93303787-93303809 TTGAAGCAACAGATGGAAAATGG + Intronic
1122141167 14:99663927-99663949 CTGGAGCTCCTGATGGCAAATGG + Intronic
1125399729 15:39288123-39288145 GTGAGGTTTCAGATGGCAAAGGG + Intergenic
1127379931 15:58422153-58422175 ATGAAGGTACAAATGGCAAATGG - Intronic
1127686817 15:61354009-61354031 ATGAAGTTACAGATGGGAAGAGG + Intergenic
1128403900 15:67315348-67315370 GTGAAGCTACATTTGCCAAAAGG + Intronic
1129815524 15:78549561-78549583 ATGAAGCCACAGATAGCCAAGGG - Exonic
1129909722 15:79216349-79216371 CAGTAGCTACATATGGCTAATGG - Intergenic
1131463540 15:92637022-92637044 CAGAGGATACAGATGCCAAAAGG - Intronic
1131823513 15:96296674-96296696 CTGAAACTATAGATGGAAACTGG + Intergenic
1132607888 16:801035-801057 CAGAGGCTTCAGAGGGCAAAGGG - Intergenic
1133866143 16:9645277-9645299 CTGAATTTACAGATAGGAAATGG - Intergenic
1134796228 16:17039549-17039571 CCAAAGTTACAGATGGGAAAAGG + Intergenic
1137797054 16:51230255-51230277 CAGAAGCTAAAGTTGACAAATGG + Intergenic
1140577755 16:76192032-76192054 TTGAAGTTAAAGATGGCAAAAGG - Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1141061313 16:80874340-80874362 GTGAAACTATAGAAGGCAAAAGG + Intergenic
1141275580 16:82584926-82584948 AGGAAGCTTCAGATGGCAAAGGG + Intergenic
1141919971 16:87129112-87129134 CAGGAGCTACAGAAGGCAAGAGG - Intronic
1144017946 17:11214425-11214447 GTGAATCTTCAGAGGGCAAAGGG + Intergenic
1144288178 17:13799796-13799818 CTGAGGCAAGAGATGGCAAAGGG - Intergenic
1146602536 17:34230632-34230654 CAGAAGCTAGCAATGGCAAAAGG + Intergenic
1149841785 17:59971548-59971570 CAGAACCTACAGATGTTAAACGG - Intronic
1149855209 17:60076840-60076862 CTGAAGCTAAAAATATCAAAAGG + Intronic
1149865273 17:60148124-60148146 TTGAAGTTAGAGATGGCAGATGG + Intergenic
1149895386 17:60424991-60425013 CTCAAACTACAGATGGCAGTTGG + Intronic
1151952375 17:77362217-77362239 CTGGAGCTACAGAGCCCAAAGGG - Intronic
1152097478 17:78280297-78280319 GCGAAGCTTCAGAGGGCAAAGGG - Intergenic
1153409484 18:4777932-4777954 GTGAACCTTCAGAAGGCAAAAGG - Intergenic
1154236786 18:12613475-12613497 CTGTAGCTACATTTGGCTAAAGG - Intronic
1156232044 18:35163047-35163069 CTGAAGGTGCTGAAGGCAAAGGG + Intergenic
1157540549 18:48501098-48501120 CTGAATCTACAGATATTAAAAGG + Intergenic
1157706574 18:49812963-49812985 CTAAAGCAACAGAAGGGAAATGG + Intronic
1159098616 18:63935094-63935116 CTGAAGCTGCAGCTGGCAGTGGG + Exonic
1160303484 18:77707951-77707973 CAGAAGCAAAAAATGGCAAATGG + Intergenic
1160662878 19:309187-309209 CTGATGCTACAGAAGGGAAAGGG - Intronic
1161640012 19:5416400-5416422 GAGGAGATACAGATGGCAAATGG - Intergenic
1162365449 19:10246080-10246102 CTGAAGCTACAGCAGGTAATAGG + Intergenic
1164539014 19:29108486-29108508 CTCAACCTAAAGATGGTAAAAGG + Intergenic
1165895818 19:39140251-39140273 CTGAAGCCACAGAGGGGAGATGG + Intronic
1166123023 19:40696943-40696965 CTGGAGCGACACATGGCAACAGG - Intronic
1167737590 19:51305717-51305739 CAGAAGCTGCAGATGGCTATGGG - Intergenic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
1168368359 19:55809543-55809565 CTGAAGCGGCAGATGGACAAGGG - Exonic
1168705781 19:58469592-58469614 CAGAATCTAAAGATGGCACAGGG - Intronic
927256591 2:21044925-21044947 CTGAAGCTTCCGGTGGGAAATGG - Intergenic
927745075 2:25611555-25611577 CTGCAGATACAGAGGGCCAAGGG + Intronic
928129924 2:28642013-28642035 CTCCAGGAACAGATGGCAAAAGG - Intronic
929478651 2:42280102-42280124 ATGAACCTACAGATGTTAAACGG - Intronic
930028121 2:47042014-47042036 CTGGAGCTACAGAAAGGAAAAGG + Intronic
930258831 2:49121853-49121875 CTGAAGATACAGATCACGAAAGG - Intronic
934108310 2:88716794-88716816 GTGAATCTTCAGAGGGCAAAGGG - Intronic
934899861 2:98150888-98150910 GAGAAGCTTCAGAAGGCAAACGG - Intronic
935071847 2:99701221-99701243 CTTAGGCTACAAATGACAAATGG + Intronic
936828805 2:116614881-116614903 CAGAAGCCACAGAGGCCAAAGGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
941622880 2:167798296-167798318 CAGAAGCTAAAAATGACAAATGG - Intergenic
943014516 2:182494999-182495021 CTGAAGCTAGGGATGAGAAAGGG - Intronic
943304721 2:186245890-186245912 CTGCAGCTAGAGATGGCTAAAGG - Intergenic
943606993 2:189987629-189987651 ATGAAGCTCTAGAAGGCAAAAGG + Intronic
943814709 2:192237996-192238018 CAGAAGCTACAATTGGCAAATGG - Intergenic
944774282 2:202946629-202946651 CAGAAGCTAAAGTTGACAAATGG + Intronic
946026566 2:216675247-216675269 CTGAAGTAAGAGATGGCAGAGGG - Exonic
946409826 2:219510424-219510446 CTGAGGCTGCAGAGGGCAAAGGG - Intergenic
946915083 2:224510822-224510844 CTGAAGTTACAGAATGGAAAAGG - Intronic
948084004 2:235231281-235231303 CTAAAGATTCAGATGGCCAAGGG - Intergenic
948579621 2:238976026-238976048 CAGAAGCTATAGATGCCAGAAGG + Intergenic
1169319024 20:4616004-4616026 GTGAACCTTCAGAGGGCAAAGGG - Intergenic
1170434361 20:16310316-16310338 ATGAAGCAGCAGATGCCAAAAGG + Intronic
1171395903 20:24832893-24832915 CTGAGGATGCGGATGGCAAAAGG - Intergenic
1173866667 20:46316920-46316942 CTGAGGCCACAGATGGGACAAGG + Intergenic
1174569274 20:51489629-51489651 CTCAAGGTACAAATGGCACATGG + Intronic
1176314175 21:5226541-5226563 TTGAAGATGCAGATGACAAATGG - Intergenic
1176695260 21:9969646-9969668 CTGAAGCAGCAAAGGGCAAAGGG + Intergenic
1177415980 21:20794033-20794055 GTGAACCTTCAGAGGGCAAAGGG + Intergenic
1177927532 21:27236831-27236853 CTGAAGGTGCAGATGACAATGGG + Intergenic
1179151131 21:38809259-38809281 CTGTAGCCACACATGGCAAGTGG + Intronic
1180391985 22:12292661-12292683 TTGAAGATGCAGATGACAAATGG - Intergenic
1180407759 22:12572095-12572117 TTGAAGATGCAGATGACAAATGG + Intergenic
1182062946 22:27410861-27410883 CAGAAGCCCCAGATGGCAAGTGG - Intergenic
1184942343 22:47778270-47778292 CTGATGCCACCGATGTCAAAAGG - Intergenic
1184981174 22:48096976-48096998 CTGCAGCTCCAGATGGCAGGGGG - Intergenic
949781913 3:7699077-7699099 TCAAAGCTACAGATGGCAAAGGG + Intronic
950097749 3:10339659-10339681 CTGAGGCCACAGATGGCCACAGG + Intronic
950887087 3:16372034-16372056 CTGCAGCTACCGAGGGCAAGAGG + Intronic
951228262 3:20146026-20146048 CTTATGCTACAGATGACAAGTGG + Intronic
951645267 3:24883022-24883044 CTGAAGCTGAACATGTCAAACGG + Intergenic
951667404 3:25142640-25142662 CCAAAGCTAATGATGGCAAACGG - Intergenic
952163783 3:30723649-30723671 CTGAAGAGAAATATGGCAAATGG + Intergenic
955367265 3:58321747-58321769 GTGAACCTTCAGAGGGCAAAGGG - Intergenic
956633009 3:71334517-71334539 CTGAAACTACATATTGCAAAAGG + Intronic
956930421 3:74037148-74037170 GTGAACCTGCAGATGGCGAAGGG - Intergenic
957156987 3:76556326-76556348 CTGAAGCCTCAGAAGGGAAAGGG + Intronic
959152101 3:102619851-102619873 GTGAACCTTCAGAAGGCAAAGGG + Intergenic
959501326 3:107108854-107108876 CTGCATCTTCACATGGCAAAAGG + Intergenic
959600333 3:108175720-108175742 CTAGAGCTAGAGATGGTAAATGG + Intronic
960173072 3:114485761-114485783 CTGTATCTTCATATGGCAAAGGG - Intronic
962471086 3:135709921-135709943 GTGATACTACAGATGGCAAAAGG + Intergenic
963946146 3:151147519-151147541 CTGCGGCTACTGAAGGCAAATGG - Intronic
964611689 3:158622200-158622222 TTGATACTGCAGATGGCAAAGGG + Intergenic
965241392 3:166203663-166203685 CTGATGTTACAGATGTAAAAGGG + Intergenic
966164824 3:177005958-177005980 CTGAGGCTACACATGGCAGTGGG - Intergenic
969522821 4:7688755-7688777 CTGAACCAACAGATGCCAAAAGG - Intronic
969899931 4:10339608-10339630 CAGAAGCTACAGCTTACAAATGG - Intergenic
970854547 4:20636898-20636920 TTGGTACTACAGATGGCAAAGGG + Intergenic
970859373 4:20684122-20684144 CTGAAGATAAAGAAGGCTAAGGG + Intergenic
971850699 4:31982979-31983001 ATGAAACTACAGAGGGCAAAGGG - Intergenic
973645694 4:52949423-52949445 CTGAAGCTACAAATGGCTGTGGG - Intronic
973788879 4:54360394-54360416 CTGATCCTAAAGATGGCCAATGG - Intergenic
974002329 4:56524243-56524265 CTCAAGCTCCTGATGGAAAATGG - Exonic
974109970 4:57513941-57513963 CAGAAGCCACAGATGTCAACAGG - Intergenic
974166706 4:58213792-58213814 GTGAACCTTCAGAGGGCAAAGGG - Intergenic
974345821 4:60679720-60679742 CTGCAGCTTCACATGGCAAAAGG - Intergenic
975007730 4:69311606-69311628 CAAAAGCTACAGTTGACAAATGG - Intronic
975745249 4:77468922-77468944 CTGAAGCCACAGGTGGCTGAGGG - Intergenic
976008580 4:80459873-80459895 GTGAACCTTCAGAGGGCAAAAGG - Intronic
976781754 4:88767050-88767072 TTGAAGATACAGATGACATAAGG + Intronic
978270332 4:106881816-106881838 CTGAAACTTCAGATGGGAAATGG - Intergenic
980106271 4:128591512-128591534 CTGAAGCTCCAGGTTGGAAATGG - Intergenic
980190175 4:129514984-129515006 CTGCAGCTAAAGATGGAAGATGG + Intergenic
980237500 4:130128397-130128419 CAGAAGCATCACATGGCAAAAGG - Intergenic
980367887 4:131829876-131829898 CTGAAGCAGCAAAGGGCAAAGGG + Intergenic
980512404 4:133811999-133812021 CAGGAGCTACACATGGCAAAGGG + Intergenic
980729529 4:136809256-136809278 GTGAAACTTCAGAGGGCAAAGGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982643846 4:157997418-157997440 CTGTAGCTAGAGAAGACAAAAGG + Intergenic
982848798 4:160284060-160284082 CTGAAGTTACAAATAGTAAATGG + Intergenic
983631142 4:169850619-169850641 TTGAAGCTAGAGCTGGCAAAAGG + Intergenic
985590646 5:762977-762999 CAGACCCTACAGATGGGAAAAGG + Intronic
985897464 5:2757310-2757332 CCGAATTTACAGTTGGCAAAGGG - Intergenic
985991792 5:3567768-3567790 CTGAAGCCACACAAGGCTAATGG - Intergenic
987016406 5:13824531-13824553 CTTAAGCTAATGATGGCACATGG - Intronic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
987987113 5:25161868-25161890 TTGGTACTACAGATGGCAAAGGG + Intergenic
988693528 5:33596233-33596255 CTGATGCTGCAGCTGGCAAGAGG + Intronic
989781395 5:45269136-45269158 CTGAGGCAAAAGATGGAAAAGGG + Intronic
991080072 5:62589132-62589154 CTGAAAGTACAGGTGCCAAAGGG - Intronic
991263244 5:64689189-64689211 CTTAAGCTTCATATGGTAAAAGG + Intergenic
992407750 5:76475839-76475861 GAGAACCTTCAGATGGCAAAGGG + Intronic
992744609 5:79806805-79806827 CAGAAGCTGAAAATGGCAAAAGG - Intergenic
992817370 5:80457310-80457332 CTAAACCTAAAGATGTCAAAAGG - Intronic
992846606 5:80755647-80755669 CTGAGGGAACAGATGGAAAAAGG + Intronic
992864930 5:80948531-80948553 GTGAAACTGCAGATGGCATAGGG - Intergenic
993630631 5:90281998-90282020 CTGGAGCTAAAGAGGGCACATGG - Intergenic
996293879 5:121889153-121889175 GTGAAGCAACTGATGGCTAAGGG + Intergenic
996822896 5:127650302-127650324 CTTCAGCTACAGATGTCAACAGG - Intronic
997519842 5:134515937-134515959 TGGTGGCTACAGATGGCAAAAGG - Intergenic
998415494 5:141943375-141943397 CTGGAGCTATAGCTGGCAACTGG - Intergenic
999890093 5:155968283-155968305 CTGAAGTTACACATGGCACGTGG + Intronic
1000053280 5:157580438-157580460 CTGAAACTTCAGAGGGCAAAGGG + Intergenic
1000788086 5:165570857-165570879 CTGAGGCTGCATAGGGCAAAGGG + Intergenic
1001858457 5:175032932-175032954 CTGAAGATATACATTGCAAAAGG + Intergenic
1002556870 5:180048746-180048768 CTGAAGCTACAGATGGCAAAGGG - Intronic
1005651185 6:27886546-27886568 GTGAAACTTCAGAGGGCAAAGGG + Intergenic
1007445571 6:41903011-41903033 GGGTAGCTACAGATGGGAAAAGG + Intergenic
1007739956 6:44004203-44004225 CTGAAACTCAAGATGACAAAAGG - Exonic
1008149967 6:47938447-47938469 CTGTGGCTACAGATGCTAAAAGG + Intronic
1010185769 6:73141696-73141718 CTGGATCTACAGAAGCCAAAAGG - Intronic
1010394855 6:75379388-75379410 CAGAAGCTAAAGATGCCTAATGG + Intronic
1010929861 6:81788734-81788756 CTGAAGTTGGAGATGGCAATTGG - Intergenic
1011146347 6:84221905-84221927 GTGAAGATACAGATATCAAATGG - Intronic
1011939623 6:92826624-92826646 TTGGTACTACAGATGGCAAAGGG - Intergenic
1012148945 6:95721245-95721267 CAGAAGCCACAATTGGCAAATGG + Intergenic
1012902473 6:105022261-105022283 GTGAATCTTCAGAAGGCAAAGGG - Intronic
1013379430 6:109552715-109552737 CAAAAGCTACAGTTGACAAATGG - Intronic
1015716743 6:136200847-136200869 ATAAAGCTCCAGATGCCAAAAGG - Intergenic
1016314912 6:142774333-142774355 CAGAGGCAACGGATGGCAAAGGG + Exonic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017311216 6:152980055-152980077 CTGAAGCAACTGTTTGCAAAAGG + Intronic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1019391217 7:787661-787683 CAGAAGCCACAGAGGTCAAAGGG - Intergenic
1020833232 7:13116638-13116660 CTGAAGAAAGAGATGGAAAATGG - Intergenic
1024211652 7:47211209-47211231 CAGAGGCAATAGATGGCAAATGG + Intergenic
1025474027 7:60897199-60897221 GGGAAGCTTCAGAAGGCAAAAGG - Intergenic
1025512975 7:61592675-61592697 GGGAAGCTTCAGAAGGCAAAAGG + Intergenic
1030639498 7:111988182-111988204 CTGAAGGTCCAAATAGCAAATGG + Intronic
1031939845 7:127776935-127776957 CTGAACCCACAGATCCCAAAGGG - Intronic
1032258983 7:130319459-130319481 ATGAACCTTCAGAAGGCAAAGGG - Intronic
1032712038 7:134468988-134469010 ATGAAGCCAAAGATGGCAAGAGG + Intergenic
1033789704 7:144776670-144776692 CAACAGCTACAGATGCCAAATGG + Intronic
1034125575 7:148668615-148668637 CAGAAACAACAGATAGCAAAAGG + Intergenic
1035077829 7:156192647-156192669 CAGAAGCGACAGAAGCCAAACGG - Intergenic
1035449590 7:158967870-158967892 AGGAGGCAACAGATGGCAAATGG + Intergenic
1036054613 8:5237854-5237876 CTGAACCTACAGATCGCGGATGG + Intergenic
1036275799 8:7350638-7350660 CTGAAACACCAGATGGCAGAAGG - Intergenic
1036345556 8:7959720-7959742 CTGAAACACCAGATGGCAGAAGG + Intergenic
1036840883 8:12120474-12120496 CTGAAACACCAGATGGCAGAAGG + Intergenic
1036862690 8:12366724-12366746 CTGAAACACCAGATGGCAGAAGG + Intergenic
1037715247 8:21392030-21392052 GTGAAACTTCAGAGGGCAAAGGG + Intergenic
1037940522 8:22947720-22947742 CTGTAGCTCCAGAGGGGAAATGG + Intronic
1038104465 8:24416775-24416797 CTCAAGCCACAGATGCCAGATGG + Intergenic
1038378703 8:27070936-27070958 CTGAGGCTACAGAGGTAAAATGG + Intergenic
1038704779 8:29883504-29883526 GTGAACCTTCAGAGGGCAAAAGG - Intergenic
1039695103 8:39902312-39902334 ATGAACCTTCAGAGGGCAAAAGG + Intronic
1039878326 8:41606516-41606538 GTGAATCTTCAGAGGGCAAAGGG - Intronic
1040122729 8:43700695-43700717 CTAAATCAACAGATGGCAATGGG - Intergenic
1040297784 8:46169795-46169817 CTGAATCTACATATCACAAAGGG + Intergenic
1040347322 8:46518381-46518403 CTGAATCTACAAATCACAAATGG - Intergenic
1040835134 8:51723349-51723371 TTGCAGCTACAGATGAGAAAAGG + Intronic
1041349513 8:56934575-56934597 CTGGAGCAAGAGATGACAAACGG - Intergenic
1042579263 8:70258327-70258349 CTGAAGCTACAAATGAAAATTGG - Intronic
1042773545 8:72404988-72405010 CAGAAGCTGCACAAGGCAAAGGG + Intergenic
1042965366 8:74346058-74346080 CTGCATCTAAAGATCGCAAATGG - Intronic
1043514468 8:80983160-80983182 CTGAAGCTAGAGCTTGCAACTGG - Intronic
1044949668 8:97423381-97423403 CTACAGCTATTGATGGCAAAGGG - Intergenic
1045000221 8:97871704-97871726 CTGAAGCTCCAAGTGGCAAGTGG - Intronic
1045231551 8:100311046-100311068 GTTAAGTAACAGATGGCAAATGG - Intronic
1045341153 8:101255545-101255567 CTGCATCTTCACATGGCAAAAGG - Intergenic
1046175954 8:110575315-110575337 CTGATTCTACTTATGGCAAAAGG + Intergenic
1047035706 8:120936622-120936644 CTGAAGCTGGAGATGGGTAATGG + Intergenic
1047250773 8:123180721-123180743 CAGAAGCAAGAGTTGGCAAAAGG + Intronic
1047535833 8:125718874-125718896 CTGGAGCTTCAGATGCCAACAGG + Intergenic
1048152943 8:131911554-131911576 GTGAACCTTCAGAGGGCAAAGGG - Intronic
1048229305 8:132621291-132621313 CTCAAGCTCCAGAGGGCACAGGG + Intronic
1048509935 8:135053171-135053193 CTGCAGATACAGAGGGCCAATGG - Intergenic
1050184721 9:2960687-2960709 ACACAGCTACAGATGGCAAAAGG - Intergenic
1050788924 9:9441487-9441509 CTGAGGCTTCAAAAGGCAAAAGG + Intronic
1050856685 9:10366192-10366214 CTGTATTTACAGATGGCATAGGG - Intronic
1051572304 9:18573183-18573205 ATGAGGCCACAGAAGGCAAAGGG - Intronic
1051815136 9:21096018-21096040 GTGAAGCTTCAGAGGTCAAAGGG + Intergenic
1051834880 9:21324589-21324611 ATGAAACTACAGATATCAAAAGG + Intergenic
1052031607 9:23635680-23635702 CTGCAGCCACAGATATCAAAAGG + Intergenic
1053616995 9:39778081-39778103 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1053632238 9:39955590-39955612 CTGAAGCAGCAAAGGGCAAAGGG + Intergenic
1053722094 9:40956844-40956866 ATGAAGATGCAGATGACAAATGG + Intergenic
1053773523 9:41507940-41507962 CTGAAGCAGCAAAGGGCAAAGGG - Intergenic
1053875176 9:42537430-42537452 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1054211650 9:62295108-62295130 CTGAAGCAGCAAAGGGCAAAGGG - Intergenic
1054236521 9:62564298-62564320 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054267172 9:62929356-62929378 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054313332 9:63553727-63553749 CTGAAGCAGCAAAGGGCAAAGGG + Intergenic
1054343877 9:63895129-63895151 TTGAAGATGCAGATGACAAATGG - Intergenic
1054550661 9:66598801-66598823 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054931301 9:70638130-70638152 CAGAAGAGACAGAGGGCAAAAGG - Intronic
1057287709 9:93773593-93773615 GTGAAACTACAGATGTCAACTGG - Intergenic
1058166171 9:101621768-101621790 CTGAAGATAAAGGTGGAAAATGG + Intronic
1058690768 9:107518719-107518741 GTGAAGCTCCAGCTGGAAAAGGG - Intergenic
1059338965 9:113586676-113586698 CTGAAGCTACTGGTGGAAGAGGG - Intronic
1060925278 9:127451563-127451585 CTGAAGCTAGAGATTCCGAAAGG + Exonic
1061925673 9:133805003-133805025 CTGAAGCTACAGAGCACACAGGG + Intronic
1062491333 9:136806487-136806509 TTGAAGCTGCAGAAGGCAATAGG - Exonic
1203453079 Un_GL000219v1:139113-139135 TTGAAGATGCAGATGACAAATGG - Intergenic
1186314022 X:8349557-8349579 GTAAAGCTTCAGAGGGCAAAGGG - Intergenic
1186429317 X:9490908-9490930 CAGAAGAAACAGCTGGCAAAAGG - Intronic
1186749039 X:12602538-12602560 CTGAAGTTCCACATGTCAAAAGG - Intronic
1186810744 X:13186113-13186135 CAGAAGCTAAAATTGGCAAATGG + Intergenic
1187070634 X:15883954-15883976 GTGAACCTTCAGAGGGCAAAGGG + Intergenic
1187235513 X:17463645-17463667 GTGAACCTCCAGATGGCAAAAGG - Intronic
1188606827 X:32041416-32041438 CTCAAGCCACAGATGCCATATGG - Intronic
1189162418 X:38823361-38823383 CTGAAGATAAAGATGTAAAAGGG + Intergenic
1189338914 X:40189330-40189352 CTAAGGCGACAGAAGGCAAAGGG - Intergenic
1192282076 X:69698147-69698169 AGGAAGCCAAAGATGGCAAAAGG - Intronic
1194653145 X:96539312-96539334 CTGAAGCAACAAAATGCAAAAGG + Intergenic
1195921814 X:109991151-109991173 CTGAGGCTACAGAAGTAAAAGGG + Intergenic
1197094325 X:122575008-122575030 CTGAAGCTGCACAGGGAAAACGG + Intergenic
1197142475 X:123131780-123131802 CAGAAGCCAAAGATGGCAAGGGG + Intergenic
1198501878 X:137257848-137257870 GTGAAACTTCAGAAGGCAAAGGG - Intergenic
1198989309 X:142492310-142492332 CTGTAGCTACAGGTGCCAGAAGG - Intergenic
1200834889 Y:7723778-7723800 CTGCAGCTACCGAGGGCAAGAGG + Intergenic
1200873157 Y:8124891-8124913 CTAAATCAACAGATGGCAAAGGG - Intergenic
1202193622 Y:22272526-22272548 CTGAAGATCCAGAGGGCACATGG + Intergenic