ID: 1002558532

View in Genome Browser
Species Human (GRCh38)
Location 5:180063390-180063412
Sequence GTGTAAATAACAAGGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002558527_1002558532 4 Left 1002558527 5:180063363-180063385 CCAAAGAAGCAAGGATGGTCCTA 0: 1
1: 0
2: 1
3: 39
4: 344
Right 1002558532 5:180063390-180063412 GTGTAAATAACAAGGGTGGATGG 0: 1
1: 0
2: 1
3: 8
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002558532 Original CRISPR GTGTAAATAACAAGGGTGGA TGG Intronic
900077172 1:827236-827258 GTGAAGAGAACTAGGGTGGAAGG + Intergenic
903558955 1:24213521-24213543 GTATACATAAAAAGGCTGGAAGG - Intergenic
904242951 1:29162031-29162053 GTGTAGGTAACAACGTTGGAGGG + Intronic
905698754 1:39995978-39996000 TTGCAAATTACAAGGGTAGAGGG + Intergenic
908731179 1:67228194-67228216 GTCTAAAAAAGAAGGGAGGAAGG - Intronic
912552290 1:110492116-110492138 GTGCAAAGAAAAAGGGAGGAGGG - Intergenic
913226425 1:116704298-116704320 GGGTGAATAAAGAGGGTGGATGG - Intronic
915027706 1:152847694-152847716 GTCTAAATAAGAAGGAGGGAGGG + Intergenic
915730225 1:158048198-158048220 CTGTAAATAAGAAGGATGGAAGG + Intronic
920936230 1:210437658-210437680 GTCTAAATAACAAGGTAGCATGG - Intronic
921579408 1:216877815-216877837 GTGTACATAGCAAATGTGGATGG - Intronic
923288264 1:232518504-232518526 GCGTAGAAAACAAGGGAGGAGGG - Intronic
924656544 1:245977783-245977805 GTGTTAATAACAGGGCAGGAAGG - Intronic
1064157943 10:12919171-12919193 GTGTAAAGACCTAGGCTGGAAGG + Intronic
1065645792 10:27832504-27832526 GTGTGAACAACATGGGTGGGGGG - Intronic
1070407510 10:76110272-76110294 AAGTAAAGAACAAGAGTGGATGG - Intronic
1072470724 10:95710677-95710699 GTATTAATAACAAGGGAAGAGGG + Intergenic
1072509172 10:96101144-96101166 GTGTCATAAATAAGGGTGGAGGG - Intergenic
1074875564 10:117610598-117610620 GTGGGAACAACAAGGCTGGATGG + Intergenic
1077600804 11:3573169-3573191 GTGTACATTTCAAGGGTGGCTGG + Intergenic
1079369055 11:19834508-19834530 GAATAAATAACAAATGTGGAAGG + Intronic
1081374313 11:42340652-42340674 GAGTTAATAACATTGGTGGAGGG - Intergenic
1083215420 11:61215774-61215796 GTGTGAATGAAAAGGATGGAAGG - Intergenic
1083218304 11:61234603-61234625 GTGTGAATGAAAAGGATGGAAGG - Intergenic
1084256724 11:67947754-67947776 GTGTACATTTCAAGGGTGGCTGG + Intergenic
1086906436 11:92423395-92423417 GTTTGAAAAACAAGGGTGAAAGG + Intronic
1088396505 11:109375665-109375687 GTGTAAATGGCAGGGGTGGCAGG + Intergenic
1088810009 11:113385900-113385922 GAGGAAATACCAAGGGTGAATGG - Intergenic
1090988717 11:131796541-131796563 GGGTCACTAAGAAGGGTGGAAGG - Intronic
1092491946 12:8953430-8953452 GTGTATATAAAATGGGTGAAAGG + Intronic
1094345591 12:29465018-29465040 GTATAAATAATAAGTGTGAAAGG + Intronic
1095954191 12:47797172-47797194 GTGGAAAAAAGAAGGGTGGTGGG - Intronic
1102985139 12:117271892-117271914 TTCTAAAAAACAAGGGAGGAGGG - Intronic
1105727260 13:23176811-23176833 AGGTAAACAACAAGGGAGGAAGG - Intergenic
1107817880 13:44260442-44260464 GTGGAATTGACAAGGGTGAAGGG - Intergenic
1107894974 13:44952558-44952580 GTTTAAAAAAGAAGGGAGGAGGG - Intronic
1109018787 13:57056963-57056985 GAGCAAATGTCAAGGGTGGACGG - Intergenic
1110091422 13:71453240-71453262 GACTAAGAAACAAGGGTGGAAGG + Intronic
1111913748 13:94339581-94339603 ATGAAAAGATCAAGGGTGGAAGG + Intronic
1113308155 13:109100866-109100888 GTGTAAATTACAAGGCTGGCAGG + Exonic
1113539958 13:111099234-111099256 ATGTAAATAACATGGGTGGGTGG - Intergenic
1114773974 14:25460591-25460613 GTGTAGATGTCAATGGTGGAGGG - Intergenic
1116974351 14:51099082-51099104 GAGGAAATAACACAGGTGGAGGG + Intergenic
1120193587 14:81460956-81460978 GTGGAAAGAACAATGTTGGAAGG - Intergenic
1128980392 15:72181178-72181200 TGGTAAACAACAAGGCTGGAGGG + Intronic
1129018628 15:72492964-72492986 GTCAAATTAACAAGGTTGGAAGG + Intronic
1130673580 15:85933429-85933451 GAGCAAATCACAAGGGTGGGGGG + Intergenic
1132341894 15:101084129-101084151 GTATAAATGACAAGGCTGGAAGG + Intergenic
1133371296 16:5247834-5247856 GTGTACATTTCAAGGGTGGCTGG - Intergenic
1133910066 16:10057537-10057559 AAGAAAATAACAAGGGTGCAGGG + Intronic
1137899576 16:52252428-52252450 GTCTGAATAACACGGGTGAAGGG - Intergenic
1138320414 16:56106420-56106442 GTGGAAATAACAGTGATGGATGG + Intergenic
1139724388 16:68884945-68884967 GTGAAACTAAGAGGGGTGGAAGG + Intronic
1147352984 17:39866814-39866836 GTTTATATAAAAAGAGTGGATGG + Intergenic
1150029431 17:61716769-61716791 GTGGAAATAATATGGGGGGAGGG - Intronic
1151439252 17:74117656-74117678 CTTTAAATAACAAGGGAGGAAGG + Intergenic
1153547535 18:6224015-6224037 GAGTAATTAACCTGGGTGGAAGG + Intronic
1157997631 18:52578096-52578118 GTGTAAATAATCAGGTTGGAAGG - Intronic
1161661125 19:5546931-5546953 GTGGAAAGAACAGGGGTGGTGGG + Intergenic
1166452463 19:42914080-42914102 CTGGCAATTACAAGGGTGGATGG + Intronic
929066369 2:37979209-37979231 GTGTGAAAACGAAGGGTGGAGGG + Intronic
929619883 2:43343691-43343713 GTGTGAATAGCAAGAGGGGATGG - Intronic
930086888 2:47503963-47503985 GTATAAATAACTGGGGAGGAAGG - Intronic
932763261 2:74454357-74454379 ATCTAGAGAACAAGGGTGGATGG - Intergenic
938733231 2:134162653-134162675 GTGGAAATAACATGGTTGGGAGG - Intronic
941804896 2:169702055-169702077 TTGTAAATAGCAAGGAAGGATGG + Intronic
944555480 2:200884097-200884119 GTTTAAATGACAAGGATGGAAGG - Intronic
944659835 2:201912247-201912269 GTAGAAATATCAAAGGTGGATGG - Intergenic
945378606 2:209111217-209111239 GTCTAATTAACAAGGGTAGTAGG + Intergenic
1172755561 20:37281456-37281478 GTGTAAATAACAAAGGTGAAAGG - Intergenic
1173675554 20:44832090-44832112 GTGTAATGATCAAGGTTGGAGGG + Intergenic
1174702558 20:52623861-52623883 GTCTCAAGAAAAAGGGTGGAGGG + Intergenic
1175106605 20:56619552-56619574 TTGGAAATAACTGGGGTGGAGGG + Intergenic
1175385640 20:58593206-58593228 GTGTGAAGAAGAAGGCTGGAAGG - Intergenic
1176666842 21:9695642-9695664 GTGTAAATACCCAGGGTTCATGG - Intergenic
1176921786 21:14696448-14696470 GTCTAAATAACATGGTTGCAAGG - Intergenic
1178973012 21:37197857-37197879 GCGAAAATAACAGGGGTGGCGGG - Intronic
1179812429 21:43880688-43880710 GTGGAAATAACAAGGGTAATTGG - Intronic
1179884417 21:44307316-44307338 GTGTAAATACCCAGGACGGAGGG - Intronic
1180655334 22:17415576-17415598 GTGTAAATACCAACTGTAGAAGG - Intronic
1184361475 22:44021597-44021619 GAGGAAATAACAAGGGTGATGGG + Intronic
949211419 3:1507278-1507300 GAGGAAATAACAAGTGTTGATGG - Intergenic
949222394 3:1651371-1651393 GTGAAAAGAACAAAGCTGGAAGG - Intergenic
951490035 3:23259865-23259887 GTGTCAATAAGAGGTGTGGATGG + Intronic
951866496 3:27314365-27314387 ATGTAAATGATGAGGGTGGAGGG + Intronic
957071661 3:75572225-75572247 GTGTACATTTCAAGGGTGGCTGG + Intergenic
958072653 3:88634367-88634389 GTGTACATAAAAAGGGAGTATGG - Intergenic
958727670 3:97925408-97925430 GTGTTAATTACAATGGTGGGGGG + Intronic
962377659 3:134872006-134872028 GTGCAAGTAACAGAGGTGGAGGG - Intronic
965744321 3:171907944-171907966 GGGTAAAGATCAAGGGTGAATGG - Intronic
968378555 4:67295-67317 GTTTAAAAAAAAAGGGTGGGGGG + Intronic
969015253 4:4099536-4099558 GTGTACATTTCAAGGGTGGCTGG + Intergenic
971374911 4:26048880-26048902 GAGTAAAAAACAAGTGTGAAAGG - Intergenic
972371418 4:38427178-38427200 GTGTATATAAGAAGAGTGAATGG - Intergenic
974816398 4:67010366-67010388 CTGTAAAGAAAAAGGGTGGGTGG + Intergenic
975039866 4:69733039-69733061 GTGAAAACAATAAGCGTGGAAGG + Intronic
976724562 4:88202969-88202991 GTGTAAAGAATTTGGGTGGAAGG - Intronic
977097784 4:92768420-92768442 ATTTAAAAAACAAGTGTGGATGG + Intronic
977337650 4:95718658-95718680 GGGTATAAAACAATGGTGGAAGG - Intergenic
977757662 4:100692492-100692514 GTGTATATAAGAAGAGTAGATGG - Intronic
981744958 4:148044076-148044098 GTGAAAATAACATTGGTAGAAGG - Intronic
983567814 4:169173361-169173383 GTCTGAATAACAAGGGGGCACGG - Intronic
983953057 4:173664631-173664653 GTCTACCTAACAAAGGTGGAAGG + Intergenic
985808518 5:2066230-2066252 TTAGAAATAATAAGGGTGGAGGG + Intergenic
987445379 5:18011260-18011282 GTGAAGAGAAGAAGGGTGGATGG - Intergenic
989002104 5:36772095-36772117 TTGTAAATAACAAGGCTTGGAGG + Intergenic
991501374 5:67280316-67280338 GAGGAAATAAGAAGGGTGGCTGG - Intergenic
992066374 5:73113706-73113728 ATGAAAATAACAAGGGGGAACGG + Intergenic
996693821 5:126370486-126370508 GTGCTAGTAACGAGGGTGGAGGG + Intronic
997179351 5:131812452-131812474 CTGGAAATTACAAAGGTGGAAGG - Intronic
997658413 5:135572295-135572317 GAGAAAATAGCAAGGGTGGGAGG + Intronic
998257688 5:140601120-140601142 GTATAGAAATCAAGGGTGGATGG - Intergenic
1002558532 5:180063390-180063412 GTGTAAATAACAAGGGTGGATGG + Intronic
1003779547 6:9408299-9408321 GAGCAAAGAAAAAGGGTGGAAGG - Intergenic
1003829660 6:9993816-9993838 GTGTAAATCCCAGAGGTGGAAGG - Intronic
1005600076 6:27417641-27417663 GTGTAAATAAAGAGATTGGATGG + Intergenic
1006797702 6:36741967-36741989 GTGTAAACAATAAGGGTGATTGG - Exonic
1008902740 6:56640752-56640774 ATGTAAATAACAGGGGAAGAGGG + Intronic
1012982883 6:105848395-105848417 GTGGAAGTAAGCAGGGTGGATGG - Intergenic
1014596783 6:123353633-123353655 GTGTAATTAAGAAGGGAAGAAGG + Intronic
1015472787 6:133624875-133624897 ATGGAAATAAGAATGGTGGAAGG - Intergenic
1016071545 6:139745121-139745143 GTATAAATAAGACGGGAGGAAGG + Intergenic
1016841299 6:148528223-148528245 GTCTAAATTGCATGGGTGGAGGG + Intronic
1016844543 6:148557985-148558007 CTGTAGATCACAAGGGTGGGCGG - Intergenic
1016902674 6:149117722-149117744 ATGTAAATAACAAGACTGTATGG + Intergenic
1017578947 6:155839143-155839165 GTGTAAATTAAATGGGAGGAGGG + Intergenic
1019424288 7:966505-966527 GTTGAAATAACACGGGGGGATGG - Exonic
1019625486 7:2013786-2013808 GTGTAGATGAGAAGTGTGGATGG + Intronic
1020959213 7:14781202-14781224 TCAAAAATAACAAGGGTGGAGGG + Intronic
1023489335 7:40721237-40721259 GTGTAAATATCAATGCTGGGAGG + Intronic
1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG + Intronic
1024301118 7:47888603-47888625 GTGGGAATCACAAAGGTGGACGG - Intronic
1024549164 7:50546425-50546447 GGGTAAGTATCAAGGGTGGAGGG + Intronic
1025933974 7:66019235-66019257 GTGTATTTAGCAAGGCTGGAGGG + Intergenic
1026010105 7:66629387-66629409 GTGTAATTGACAGGGGTTGAAGG - Intronic
1030518465 7:110566719-110566741 ATGTAACTAACAAGGTTGGTAGG + Intergenic
1031154605 7:118095085-118095107 GTATAAAGAACAAGGTTAGAGGG + Intergenic
1032785925 7:135199391-135199413 GTGTCAATAACAATTGTGTATGG + Intronic
1032826217 7:135571016-135571038 GTGTAACTAAAATGTGTGGATGG + Intronic
1032921882 7:136558283-136558305 GTGGTAATAACAAGGATGGGTGG + Intergenic
1033438623 7:141357710-141357732 CTGTAAGTAACAAGGGCTGATGG - Intronic
1033930798 7:146518073-146518095 GTTTAAAAAGCAAGGGTGAATGG - Intronic
1035001188 7:155613329-155613351 GTGTAAAAAATAAGGTAGGATGG + Intronic
1035516000 8:232641-232663 GTGAAGAGAACTAGGGTGGAAGG - Exonic
1036257012 8:7213952-7213974 GTGTACATTTCAAGGGTGGCTGG + Intergenic
1036309062 8:7672551-7672573 GTGTACATTTCAAGGGTGGCTGG + Intergenic
1036360472 8:8073561-8073583 GTGTACATTTCAAGGGTGGCTGG - Intergenic
1036890499 8:12593406-12593428 GTGTACATTTCAAGGGTGGCTGG + Intergenic
1038023575 8:23570212-23570234 TTGTAAATAAAAAGGGGGAAAGG - Intronic
1041425664 8:57717708-57717730 GTGATACTAACAAGGGTGGTTGG + Intergenic
1041945345 8:63434504-63434526 GTATGAATGACAAGAGTGGAAGG + Intergenic
1043004283 8:74798948-74798970 TTGGAAATAATAAGGGTTGAGGG - Intronic
1043148534 8:76683549-76683571 GAGTTAATAAAAAGGGTGGGGGG - Intronic
1046755062 8:117964140-117964162 ATGTAAATTAAAAGGATGGAGGG - Intronic
1050025950 9:1334783-1334805 GTATAAAAAAAAAGGGTGGCTGG - Intergenic
1050263328 9:3863888-3863910 GTGGAAAGAAAAAGGGAGGAGGG + Intronic
1051067095 9:13117582-13117604 GTATAAATAGCAAGGATGCATGG - Intronic
1051697421 9:19784056-19784078 ATGCAAATAACAAGGGTTAAGGG + Intronic
1055321249 9:75085596-75085618 ATGTAAATAACAAGTGAGCATGG + Intronic
1055769762 9:79704496-79704518 GAGGAAATAAAAAGGGTGGCAGG - Intronic
1203570683 Un_KI270744v1:126955-126977 GTTTAAAAAAAAAGGGTGGGGGG - Intergenic
1203659255 Un_KI270753v1:26119-26141 GTGTAAATACCCAGGGTTCATGG + Intergenic
1187584286 X:20642919-20642941 GGGTGAAAAACAAGGGTGGGAGG - Intergenic
1190303494 X:49069372-49069394 GAGAAAAAAAAAAGGGTGGAAGG - Intronic
1192751172 X:73993108-73993130 GTGTAGAGAACAAGATTGGAGGG - Intergenic
1193908390 X:87270777-87270799 GTATAAATAAGTAGAGTGGAGGG + Intergenic
1195070706 X:101276765-101276787 GTTAAAATACCAGGGGTGGATGG + Intronic
1197307410 X:124860610-124860632 GTGTAAATAACATAGGAAGAAGG - Intronic
1198283024 X:135161523-135161545 TTTTAAATAACAAGAGAGGACGG + Intronic
1198287931 X:135210983-135211005 TTTTAAATAACAAGAGAGGACGG - Intergenic
1202049208 Y:20763321-20763343 GTTTTAATTTCAAGGGTGGAGGG - Intronic