ID: 1002559427

View in Genome Browser
Species Human (GRCh38)
Location 5:180071630-180071652
Sequence GCTGACCTGCAGCCTGTGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 1, 2: 5, 3: 38, 4: 385}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002559427_1002559431 -10 Left 1002559427 5:180071630-180071652 CCGGCCACAGGCTGCAGGTCAGC 0: 1
1: 1
2: 5
3: 38
4: 385
Right 1002559431 5:180071643-180071665 GCAGGTCAGCAGGGCGAGCGCGG 0: 1
1: 0
2: 1
3: 21
4: 237
1002559427_1002559432 -2 Left 1002559427 5:180071630-180071652 CCGGCCACAGGCTGCAGGTCAGC 0: 1
1: 1
2: 5
3: 38
4: 385
Right 1002559432 5:180071651-180071673 GCAGGGCGAGCGCGGCGAGCCGG 0: 1
1: 0
2: 3
3: 42
4: 335
1002559427_1002559435 4 Left 1002559427 5:180071630-180071652 CCGGCCACAGGCTGCAGGTCAGC 0: 1
1: 1
2: 5
3: 38
4: 385
Right 1002559435 5:180071657-180071679 CGAGCGCGGCGAGCCGGGCAGGG 0: 1
1: 0
2: 4
3: 19
4: 161
1002559427_1002559434 3 Left 1002559427 5:180071630-180071652 CCGGCCACAGGCTGCAGGTCAGC 0: 1
1: 1
2: 5
3: 38
4: 385
Right 1002559434 5:180071656-180071678 GCGAGCGCGGCGAGCCGGGCAGG 0: 1
1: 1
2: 6
3: 33
4: 319
1002559427_1002559433 -1 Left 1002559427 5:180071630-180071652 CCGGCCACAGGCTGCAGGTCAGC 0: 1
1: 1
2: 5
3: 38
4: 385
Right 1002559433 5:180071652-180071674 CAGGGCGAGCGCGGCGAGCCGGG 0: 1
1: 0
2: 3
3: 26
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002559427 Original CRISPR GCTGACCTGCAGCCTGTGGC CGG (reversed) Exonic
900120763 1:1047772-1047794 GGTGCCCTGAAGGCTGTGGCTGG - Exonic
900123350 1:1058909-1058931 GCTGGGCTGAAGCCTGAGGCAGG + Intergenic
900242090 1:1621969-1621991 GCTCACCTGCAGCCTCTCCCGGG + Intronic
900499780 1:2998110-2998132 GCAGAGCTGCAGCCTGATGCTGG - Intergenic
900596474 1:3482358-3482380 GCTGCCCTGCAGCCTCCGGGCGG + Intergenic
900649781 1:3725209-3725231 CTTGACCTCCAGCCTGTGTCAGG + Intronic
901061258 1:6473013-6473035 GCTGTCCTCCAGCCTCAGGCAGG + Exonic
901777426 1:11569934-11569956 GCTGAGCTGCTGCCCCTGGCAGG + Intergenic
901791565 1:11655928-11655950 CCTGGTCTGCAGCCTCTGGCGGG + Exonic
901793798 1:11668772-11668794 CCTGGTCTGCAGCCTCTGGCGGG + Exonic
902167442 1:14583988-14584010 CCTGACCTGCAGCCTGGGCGGGG - Intergenic
902728317 1:18351903-18351925 CCTGCCCCGCAGCCTGTGGGTGG - Intronic
903176955 1:21587146-21587168 GCTGGACTGCAGCCAGTGGGTGG - Intergenic
904334795 1:29789889-29789911 GATGACCTGCAGCCAGTCACTGG + Intergenic
904710356 1:32425517-32425539 GCTGAGCTGCGGCCTGTTCCTGG + Intergenic
905534382 1:38708862-38708884 CCTGTGCTGCGGCCTGTGGCTGG + Intergenic
905795996 1:40817019-40817041 TCTGAGCTGCAGCCTGCAGCAGG + Intronic
905947921 1:41919316-41919338 CCTGATCTGCAGCCAGAGGCTGG - Intronic
906694359 1:47814209-47814231 GCTGGAGTGCAGCCTGTGGCTGG + Intronic
907513014 1:54976344-54976366 GCTGAGCTACAGCCTAGGGCAGG + Intergenic
907879461 1:58532637-58532659 GCTGTTCTGGAGCCTGAGGCAGG - Intronic
908445618 1:64196675-64196697 GCTTGCCAGCAGCCTGGGGCTGG + Intergenic
909413530 1:75380170-75380192 GCTGCACTGCCGCTTGTGGCGGG - Intronic
911058002 1:93724112-93724134 ACTGAGCTGCAGCCTGTGCTTGG + Intronic
915402358 1:155632739-155632761 GCTGCACTGCCGCTTGTGGCGGG + Intergenic
918185258 1:182121141-182121163 GCTGCCCTGGAGCCTGGGTCAGG + Intergenic
920135167 1:203763665-203763687 ACTCACCTGCAGTCTGAGGCAGG + Intergenic
920438149 1:205961451-205961473 GCTGACCTCCAGCCTGAGTGAGG - Intergenic
920629619 1:207638913-207638935 GCTGCACTGCCGCTTGTGGCGGG + Intronic
920748932 1:208655782-208655804 GCTGACATGAAGCCTGTGTCTGG - Intergenic
922459308 1:225802791-225802813 GAGGACCTGCAGCCAGTGGAAGG - Intergenic
922810182 1:228410940-228410962 GCTCACCTGCAGCATCTGGAGGG + Exonic
924435656 1:244038741-244038763 TCTTCCCTGCAGCCTGTGGAAGG + Intergenic
924694043 1:246381835-246381857 GCTGGCCTGGAGCCTGCGGTTGG - Intronic
1063451682 10:6154355-6154377 GCTGCCCTGGAGGCTGAGGCAGG - Intronic
1066536059 10:36393361-36393383 GCTGCTCTGCAGGCTGAGGCAGG + Intergenic
1066583048 10:36901401-36901423 CCTGACCTGCTTCCAGTGGCTGG + Intergenic
1067308840 10:45093281-45093303 GCTGACCTGCAGCCTCGGGGGGG + Intergenic
1068712425 10:60149371-60149393 TCTGACCTGCTTCCTGTGGAAGG - Intronic
1068934444 10:62622290-62622312 CCTGGCCTGCTGCCTGAGGCAGG - Intronic
1069604322 10:69730265-69730287 GCAGACCTGAAGCCTGGGGTTGG - Intergenic
1069773666 10:70914730-70914752 GCTGACCAGCAACCTGAGGCGGG - Intergenic
1070607065 10:77906197-77906219 GCTGTCCTGGAGCCTCTGGCAGG - Intronic
1072588840 10:96808111-96808133 GGTCTCCTCCAGCCTGTGGCAGG - Intergenic
1072743901 10:97926818-97926840 GCTGTCCTGGAGGCAGTGGCAGG + Intronic
1072825015 10:98598306-98598328 GCTGACCTGGTGCCTGGGTCAGG + Intronic
1073481519 10:103788950-103788972 GCTGAGGTCCAGCCTGGGGCGGG + Intronic
1073965694 10:108987077-108987099 TCTGAGCTGCAGCCTGGGGCTGG + Intergenic
1074122471 10:110503103-110503125 GCTGCCAAGCATCCTGTGGCTGG - Intronic
1075411898 10:122234256-122234278 TCAGACCTGCAGGCTGTGCCTGG - Intronic
1075738968 10:124681854-124681876 CCTGACCTGCACCCCGTGGGAGG - Exonic
1076309503 10:129494406-129494428 GCTGACACGCAGCAAGTGGCTGG - Intronic
1076368437 10:129936664-129936686 GGGGACCTGCAGCCTGTGTGGGG + Intronic
1076373965 10:129971553-129971575 GCTGAGCTGCAGCCTTTTGTGGG + Intergenic
1076645919 10:131954131-131954153 GCTGCCCAGCAGCCTGGTGCTGG - Intronic
1076715104 10:132359702-132359724 GCAGAGCTAAAGCCTGTGGCTGG + Intronic
1076831609 10:132997397-132997419 GGTGCCCTGCAGCCTCTGGCAGG + Intergenic
1077014680 11:394317-394339 TCGGCCCTGCAGCCTGAGGCCGG + Exonic
1077078074 11:710153-710175 GGGGACCAGCAGCCTGTGCCCGG - Intronic
1077168915 11:1157802-1157824 GCTGGCCAGCGGCCGGTGGCAGG - Intergenic
1077187606 11:1242418-1242440 GCTGACCTGCAGCCTGGAGACGG + Exonic
1077224353 11:1433619-1433641 GCTGGCCTGCATCCCGGGGCAGG - Intronic
1077319960 11:1936676-1936698 ACTTACCTTCAGCCTGCGGCAGG - Intronic
1077359947 11:2136463-2136485 GTGGCCCTGCAGCCTGTGGAGGG - Intronic
1077465756 11:2732969-2732991 GCTGGCTTGCTGCCTGTGGGTGG - Intronic
1078545700 11:12245631-12245653 GCTGACCTGGAGCAGGTGGCTGG - Intronic
1078616532 11:12871060-12871082 GATGACCCACAGCCTGTAGCTGG + Intronic
1078689058 11:13560840-13560862 ACTGACCTGCACCCTCTGTCTGG + Intergenic
1079420259 11:20279603-20279625 GCCGAATTTCAGCCTGTGGCAGG + Intergenic
1079472139 11:20789103-20789125 TCTGACCAGAAACCTGTGGCTGG + Intronic
1079988184 11:27219826-27219848 GCTGACCTGCACCCACTGTCTGG - Intergenic
1082996418 11:59259281-59259303 GCTGACCTGGTGTCTGAGGCAGG + Intergenic
1083262055 11:61528466-61528488 GCTGAGCTGGAGCTTGGGGCAGG - Intronic
1083681025 11:64351952-64351974 GCTCACCATCAGCCTCTGGCTGG + Intronic
1084091409 11:66881507-66881529 GACGACCTGCAGGCTGAGGCAGG + Intronic
1084175659 11:67420994-67421016 GCTGAACGGCGGCCTGTGTCTGG + Exonic
1084688212 11:70709847-70709869 GGTGACCTGAGGCCTGCGGCTGG - Intronic
1084700299 11:70782471-70782493 GCTGCCCTGCTGTCTGTGGGAGG + Intronic
1084717443 11:70882940-70882962 GCTTGCCTGCGGCCTGTGGGAGG + Intronic
1085212185 11:74791340-74791362 GATGACCTGAAGCCAGGGGCTGG - Intronic
1085459008 11:76681869-76681891 GCTGACATGCTGCCTGTGCCTGG + Intergenic
1085904145 11:80739453-80739475 CCTGACCTGCTTCCAGTGGCTGG - Intergenic
1087724072 11:101698147-101698169 GCTGCACTGCCGCTTGTGGCGGG - Intronic
1087882953 11:103440435-103440457 GCTGAACTCAAGCCAGTGGCTGG + Intronic
1088161386 11:106875665-106875687 GTTGGCCTGTAACCTGTGGCTGG - Intronic
1089063324 11:115643693-115643715 GCTGAGCTCCAGGCTCTGGCCGG - Intergenic
1089143047 11:116303045-116303067 GCTGAGCTTCAGCCTGTGCTTGG + Intergenic
1089471767 11:118727073-118727095 GCTGCACTGCCGCTTGTGGCGGG + Intergenic
1090305846 11:125690290-125690312 GAAGAACTGCAACCTGTGGCTGG - Intergenic
1090759626 11:129825030-129825052 GCTAACCAGCAGCCTGTGGAGGG - Intronic
1092514313 12:9192609-9192631 ATTCACCTGGAGCCTGTGGCTGG - Exonic
1092977924 12:13763711-13763733 GCTGACCTCCACCCTGTGGCAGG + Intronic
1093247250 12:16754716-16754738 GCTGTCTTGCAGAGTGTGGCTGG + Intergenic
1096789700 12:54037102-54037124 GCAGACCTGCAGATTGTGACAGG - Intronic
1096966609 12:55632870-55632892 GATGACCAGCAGGGTGTGGCTGG - Intergenic
1097487602 12:60225398-60225420 CCACCCCTGCAGCCTGTGGCAGG + Intergenic
1102085960 12:110139952-110139974 GCTGTCCAGGAGCCTGAGGCAGG + Intronic
1102322102 12:111944961-111944983 GCTACCCTGGAGCCTGAGGCAGG + Intronic
1102666348 12:114577332-114577354 GCTGAGCTCCAGTCTGGGGCTGG - Intergenic
1103432955 12:120903885-120903907 GCTCCGCTGCAGGCTGTGGCCGG + Exonic
1103792216 12:123479709-123479731 GGTCACCCGCACCCTGTGGCTGG + Intronic
1104641677 12:130471182-130471204 TGGCACCTGCAGCCTGTGGCAGG + Intronic
1104646356 12:130500514-130500536 GCTTCCCTGCAGCCTGTGATTGG - Intronic
1104727271 12:131085751-131085773 GCTGGGCTGTAACCTGTGGCTGG + Intronic
1107536544 13:41340786-41340808 GCTGATCTGGAGACTGAGGCAGG - Intronic
1109340600 13:61053347-61053369 GCTGCTCTGCAGGCTGAGGCAGG - Intergenic
1109605206 13:64685172-64685194 TCTGCCCAGCAGCATGTGGCAGG - Intergenic
1109719631 13:66259642-66259664 GCTGACCTGCATCCACTGTCTGG + Intergenic
1110176885 13:72567717-72567739 GCTGGCCTGAAGGCTGTGACAGG - Intergenic
1111813227 13:93118552-93118574 GGTGATTTGCAGCCTGTGGAAGG + Intergenic
1113756749 13:112817616-112817638 CCTTCCCTGCAGACTGTGGCTGG + Intronic
1114670679 14:24409255-24409277 GCTCACCTCCAGCCTGTAGTTGG - Exonic
1116455558 14:45117081-45117103 GCTACCCTGGAGGCTGTGGCAGG - Intronic
1118660555 14:68005163-68005185 GCTGCCCAGGAGCCTGAGGCAGG - Intronic
1119270910 14:73303466-73303488 GCTGCTCTGGAGGCTGTGGCAGG + Intronic
1119400554 14:74359552-74359574 GCTGATCAGCAGCTTGTGCCTGG + Exonic
1119407026 14:74405396-74405418 GCTGAGCTGGGGCCTGAGGCAGG + Intergenic
1120978710 14:90272660-90272682 GCTCAACAGCAGCCTGTGGGTGG + Exonic
1123492894 15:20796949-20796971 CCTGCCATGCAGCCTGAGGCTGG - Intergenic
1123549395 15:21366047-21366069 CCTGCCATGCAGCCTGAGGCTGG - Intergenic
1124369021 15:29092912-29092934 GCAGACCGGCCGCCCGTGGCTGG + Intronic
1124573464 15:30886460-30886482 GCTGCCCTGAAGGCTGAGGCAGG - Intergenic
1124624714 15:31301255-31301277 GCTCCCCTGCAGCCTGTGTGGGG + Intergenic
1124658783 15:31528527-31528549 GCTGGCTAGAAGCCTGTGGCAGG - Intronic
1125832944 15:42729223-42729245 CCTTACCTGCAGCCCCTGGCTGG + Exonic
1126048994 15:44669933-44669955 GCTGACCTGCTGACTTGGGCTGG - Intronic
1127130328 15:55855592-55855614 GCTGCCATCCAGGCTGTGGCTGG + Intronic
1127370579 15:58335013-58335035 GCTGACCTGCCACCTGTGAAAGG - Intronic
1127389992 15:58497658-58497680 GCTGACCTGGAGCCTGGGAAAGG - Intronic
1127393096 15:58522505-58522527 GCTCACCTCCAGCCTCAGGCTGG + Intronic
1127619053 15:60715404-60715426 GTTGACCACCAGCCTGTCGCTGG - Intronic
1128043644 15:64597449-64597471 GCTGACCTGCATCCTTGGGGTGG + Intronic
1128780999 15:70358616-70358638 GGTGACCCGCAGGCAGTGGCAGG - Intergenic
1130449523 15:84036841-84036863 CCTGTACAGCAGCCTGTGGCAGG + Exonic
1131556812 15:93406755-93406777 GCTGCTCTGGAGGCTGTGGCGGG + Intergenic
1132089049 15:98933004-98933026 GCTGACCCTGGGCCTGTGGCTGG - Intronic
1132205595 15:99984144-99984166 GCTGACCTGCATATTGTGGCTGG + Intronic
1202957726 15_KI270727v1_random:93265-93287 CCTGCCATGCAGCCTGAGGCTGG - Intergenic
1132567293 16:629400-629422 GCTGACCTGCCGCGGTTGGCTGG + Intronic
1132593656 16:738125-738147 TCTGCCCAGCACCCTGTGGCAGG - Intronic
1132676434 16:1123151-1123173 GCTGACCTGCAACCAGGGACGGG - Intergenic
1132763116 16:1520596-1520618 GCTCACCTTCAGCTTGTTGCCGG + Exonic
1132847725 16:2008213-2008235 TCAGACCTGCAGCCTGGGTCGGG + Intronic
1132989227 16:2784607-2784629 GCTGACCTGGAGCCAGCTGCTGG - Exonic
1133222729 16:4325823-4325845 GCTGCTCTGCAGGCTGAGGCAGG + Intronic
1134112938 16:11527201-11527223 GCTGCTCTGGAGCCTGAGGCTGG - Intergenic
1134206776 16:12244495-12244517 GCTGCTCTGGAGGCTGTGGCAGG + Intronic
1134517306 16:14897458-14897480 GGTGACCTGCAGCCAGCGACAGG - Intronic
1134704974 16:16296112-16296134 GGTGACCTGCAGCCAGCGACAGG - Intergenic
1134962567 16:18416002-18416024 GGTGACCTGCAGCCAGCGACAGG + Intergenic
1134966864 16:18498601-18498623 GGTGACCTGCAGCCAGCGACAGG + Intronic
1137231400 16:46570563-46570585 GCTAACCGGCAGGCTGAGGCAGG - Intergenic
1139592744 16:67942582-67942604 GCTGGCCTGCAGCGGGTGGAAGG + Exonic
1139966951 16:70751024-70751046 GCTGACCTGCAGCGTTGGACAGG + Intronic
1140934002 16:79653807-79653829 GCTGCCCTGCCTGCTGTGGCTGG + Intergenic
1141119336 16:81339709-81339731 GCGGAGGTGCAGCTTGTGGCAGG + Intronic
1141701945 16:85646694-85646716 GCTGGCCTGCAGCCTGCAGCGGG - Intronic
1141735360 16:85848509-85848531 GCAAACCTGCAGCCTGGGGCTGG + Intergenic
1141770893 16:86089096-86089118 GCTTACCTGCAGCCTGGGAGTGG + Intergenic
1142174631 16:88639463-88639485 GCTGAGCTGCTGCTTGCGGCTGG + Intronic
1142302569 16:89267061-89267083 CCTGAGCTTCAGCTTGTGGCTGG - Intergenic
1142569890 17:866894-866916 TCTGACCCGCAGCCTGAGGCTGG - Intronic
1142844028 17:2658119-2658141 GCTGACCTCTGGCCTGTAGCAGG + Intronic
1142933416 17:3307839-3307861 CCTGGCCTGCAGCATGGGGCTGG - Intergenic
1143461534 17:7107366-7107388 GCTAGGCTCCAGCCTGTGGCTGG + Intronic
1143867931 17:9937567-9937589 GCCGCCCTGCGGTCTGTGGCTGG + Intronic
1144006599 17:11106038-11106060 GCTGAGCAGCAACCTGAGGCTGG - Intergenic
1145006039 17:19338347-19338369 TCTCACCTGCTGCCTGTGGGTGG + Intronic
1145166217 17:20614903-20614925 TCTGTCCTGCTGCCTGTGGAGGG + Intergenic
1146277304 17:31523876-31523898 GCTTACCTGCAGCAGGGGGCCGG - Exonic
1146323282 17:31863812-31863834 GCTGCCCTGGAGGCTGAGGCAGG - Intronic
1147036805 17:37687653-37687675 GCTGACCTGAATCCTGAAGCTGG + Intronic
1147120196 17:38331116-38331138 GCTGACCTGAAGCCCAGGGCAGG + Exonic
1147156597 17:38547286-38547308 GCTGCTCTGCTGCCTGTGCCGGG - Intronic
1147922385 17:43925881-43925903 GCTGAGCTGCAGCCTGTTCCTGG + Intergenic
1147989806 17:44325697-44325719 GCTGAGCTGCAGCCCGGGCCGGG + Intergenic
1148870986 17:50658695-50658717 GCTGGCCTGTAGCCTGGGGGCGG - Intronic
1149406018 17:56352314-56352336 GCTGACCTGCAGCCTTTGATAGG + Intronic
1150283738 17:63944055-63944077 GCTGTCTTGCAGCCTGTTTCTGG + Intronic
1151266947 17:72963756-72963778 GCTGAGCTGAAGCCTTTGCCAGG - Intronic
1151720106 17:75850193-75850215 GCTCTCCTGGAGCCTGTGCCTGG + Intronic
1152568058 17:81108900-81108922 GCGGACTCGCCGCCTGTGGCTGG + Intronic
1152662507 17:81549300-81549322 GATGACCTGCAGCCTGGACCTGG - Exonic
1152680262 17:81664254-81664276 GCTGATCTGCAGCCCCTGCCAGG + Intergenic
1152731875 17:81976632-81976654 GCTGCCCAGTAGCCTGTGGAAGG - Intergenic
1152827368 17:82475652-82475674 GCTGGCCTGCAGCCAGTGGCTGG + Intronic
1152922971 17:83074906-83074928 GCAGACCTGCTGTGTGTGGCCGG + Intergenic
1153457402 18:5295807-5295829 GCTTACCTGCAGCCTGGCACAGG + Exonic
1153815388 18:8786075-8786097 GCTGACCTCCAGGCTGAAGCAGG - Exonic
1154009516 18:10563287-10563309 GCAGAACTACAGCATGTGGCTGG - Intergenic
1154314685 18:13295285-13295307 GCTGAGCTGGACCTTGTGGCTGG + Intronic
1154361025 18:13660679-13660701 GCTCAGCTGCAGCCTGGAGCTGG - Intergenic
1154450435 18:14471482-14471504 CCTGCCATGCAGCCTGAGGCTGG - Intergenic
1155167284 18:23241417-23241439 GCTACCCTGCAGGCTGAGGCAGG + Intronic
1156358481 18:36362624-36362646 CCTCACCTGCATCCTATGGCTGG - Intronic
1156863403 18:41863889-41863911 ACTCATCTGCAGCATGTGGCAGG + Intergenic
1157520023 18:48339126-48339148 GCAGACCTCCAGGCTGGGGCAGG - Intronic
1158504660 18:58035913-58035935 CCTGACCTGGAGCCTGGAGCAGG - Intergenic
1159809644 18:73002315-73002337 GCTGCTCTGCAGGCTGAGGCAGG - Intergenic
1160792117 19:927703-927725 GGTGACCTCCAGCCTGGGGATGG + Intronic
1160807909 19:1000695-1000717 GCTGACCCGCGGCCTGTGCCAGG + Exonic
1160941376 19:1621857-1621879 GCTGACAGGCGGCGTGTGGCTGG + Exonic
1161028923 19:2049089-2049111 GCTGAGTTGGAGGCTGTGGCTGG - Intronic
1161527243 19:4764022-4764044 CCTGACCTGCAGCCTGGGCAAGG - Intergenic
1162510667 19:11116245-11116267 TCTGTCCTCCAGCCTGTGCCCGG - Intronic
1162527917 19:11217377-11217399 GCTGACCTGGGCCCTCTGGCAGG + Exonic
1163644112 19:18478645-18478667 GCTGACCTGCTGACTGTGTCAGG - Intronic
1163833306 19:19558250-19558272 GCTCAGCTCCAGCCTCTGGCAGG + Intergenic
1164050566 19:21582948-21582970 GCTGAGCTACAGCCTAGGGCAGG + Intergenic
1164371003 19:27644315-27644337 GCTGCACTGCCGCTTGTGGCGGG + Intergenic
1164587123 19:29483078-29483100 CCTGAACTGGAGCCTGGGGCAGG - Intergenic
1165446636 19:35860386-35860408 CCTCACCTGTAGCCTGTGACAGG - Exonic
1165606821 19:37112960-37112982 GCTGCACTGCCGCTTGTGGCCGG + Intronic
1165676600 19:37730337-37730359 GCTGCTCTGGAGCCTGAGGCAGG - Intergenic
1165725005 19:38106624-38106646 ACTGACCTGCTGCCTGTTGTTGG - Exonic
1166997760 19:46727953-46727975 GCTGACCTGCGGGATGTGGATGG - Exonic
1167801325 19:51744391-51744413 GCTAACCTGGAGGCTGAGGCAGG + Intergenic
925202475 2:1979690-1979712 GCTTCCCTGCATCCTGAGGCCGG - Intronic
927108287 2:19846071-19846093 GCTGATTTGCAGCCTGTGAGTGG - Intergenic
928086840 2:28351207-28351229 GCTTACCTGCCCCCTCTGGCAGG + Intergenic
928697185 2:33861314-33861336 GCTGGCCTTTAGTCTGTGGCAGG - Intergenic
928948123 2:36790347-36790369 GCTGACCAGCATCCTCTGCCGGG + Intronic
932590012 2:73059545-73059567 GGTGACCTGGAGCCTATTGCAGG - Intronic
934164772 2:89284020-89284042 GCTGACCTAGAGGCTGTAGCTGG + Intergenic
934202502 2:89898504-89898526 GCTGACCTAGAGGCTGTAGCTGG - Intergenic
934560099 2:95308730-95308752 GCTTCCCTGCAGGCTGTGACTGG + Intronic
934776761 2:96943833-96943855 ACTGATCTGCAGCCTTTGGGCGG - Intronic
935507579 2:103925353-103925375 CCTGGCCTGCAGCATGGGGCTGG + Intergenic
937138903 2:119580934-119580956 GCTGACCTGTTGCCTGGGCCTGG + Intronic
937308136 2:120884777-120884799 GCTGAGCAGAAGCCTGTGGCTGG - Intronic
938015852 2:127866653-127866675 TCTGCCCTGCAGGCTGTGGATGG - Intronic
938108914 2:128551449-128551471 GATGAGCTGAAGGCTGTGGCTGG + Intergenic
938143344 2:128813503-128813525 GGGGACCTGCAGTCTCTGGCTGG - Intergenic
938378410 2:130823386-130823408 GCTGACAGACAGCCTGGGGCAGG + Intergenic
940971899 2:159904510-159904532 GCTGCCTTCCAGCCTGGGGCAGG - Intronic
941561710 2:167054570-167054592 GCTGCTCTGCAGCCTGAGGCAGG + Intronic
942971726 2:181964815-181964837 GCTACTCTGGAGCCTGTGGCAGG - Intronic
943237738 2:185344519-185344541 GCTGACCTTTAGCTTGTGGAGGG + Intergenic
945143763 2:206715095-206715117 GCTGAGCTGCTCACTGTGGCTGG + Intronic
946117403 2:217475255-217475277 GCTGACCTTCACTCTGTGGGAGG + Intronic
946526875 2:220530224-220530246 GCTTCCCTGCAGCCTCTGGGGGG + Intergenic
948593808 2:239067120-239067142 GGTGGCCTGCAGCCTCTGGGTGG - Intronic
948685506 2:239667184-239667206 GCTTGCCTGCTGCCTGGGGCAGG - Intergenic
1169270452 20:4195357-4195379 GCTTCCCTGCAGACAGTGGCAGG + Intergenic
1170381932 20:15770704-15770726 GGTGACCTACAGCCTAAGGCAGG - Intronic
1170473638 20:16692556-16692578 GCTGACCAACAGCCTGTATCTGG + Intergenic
1170593289 20:17787279-17787301 CCTGCCCTGCAGCCTTTGGAGGG - Intergenic
1170665261 20:18381125-18381147 GCTGTCCTGCAGCCTGGGTCAGG + Intergenic
1172458495 20:35096240-35096262 GCTGCCCTGGAGGCTGAGGCAGG + Intergenic
1172476102 20:35238983-35239005 GCTGCTCTGGAGACTGTGGCAGG - Intronic
1172484036 20:35287853-35287875 GCTGAGTCGCAGCCTGTGGAGGG - Exonic
1174404494 20:50294632-50294654 GGTGACCTCCAAGCTGTGGCTGG + Intergenic
1175215286 20:57389300-57389322 GCTGCCCTGCCGCCTGGGCCCGG + Intergenic
1175801616 20:61804289-61804311 CCTCACCTGCACCATGTGGCTGG - Intronic
1176089817 20:63313791-63313813 GCTGACCTGCAGGCTGTCGGGGG - Exonic
1176363271 21:6016524-6016546 CCTCACCTGCAGAGTGTGGCTGG - Intergenic
1177567690 21:22845518-22845540 GCTAACCTGGAGGCTGAGGCAGG + Intergenic
1178532540 21:33387482-33387504 AGTGACCTTCAGCCTGAGGCAGG + Intergenic
1178717347 21:34978047-34978069 GCTGCCCTGGAGGCTGAGGCAGG - Intronic
1178943532 21:36927205-36927227 GCTGAGATGCAGGCTGTGGGCGG - Intronic
1179043204 21:37823132-37823154 GCTGGCCTGCAGACTGGGGCTGG - Intronic
1179187802 21:39097987-39098009 AGTGACCTGCAGGCTGTGGTTGG - Intergenic
1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG + Intergenic
1179779736 21:43691749-43691771 GCTACCCGGCAGCCTGAGGCAGG - Intronic
1179997493 21:44980730-44980752 CCTGCCCTGCAGCCTGAGGGAGG - Intergenic
1180838080 22:18941758-18941780 GCTGCACTGCTGCTTGTGGCAGG - Intergenic
1181542439 22:23580500-23580522 GCTGACCCTCTGCCTGTGGTGGG - Intergenic
1182151384 22:28029455-28029477 GCAGGCCTTCAGGCTGTGGCAGG + Intronic
1182289155 22:29265536-29265558 GCTGATGAGCACCCTGTGGCTGG - Exonic
1182551145 22:31101282-31101304 CCAGACCTGCAGCCTGGGTCAGG - Intronic
1182987242 22:34731882-34731904 GGTGAGCTGCAGCCAGTGGAGGG + Intergenic
1183494022 22:38132271-38132293 GCAGCCCAGCAGCCTGTGGCAGG - Intronic
1184582030 22:45424405-45424427 TCTGCCCTGCAGCCTTGGGCAGG + Intronic
1184689061 22:46109280-46109302 GCTGACCTGGAGCCCCTGCCTGG + Intronic
1184824460 22:46938695-46938717 GCTACCCTGCAGGCTGAGGCAGG - Intronic
1184835813 22:47020256-47020278 GCTGACCAGCAGCCGGTGGTGGG + Intronic
1185173021 22:49304448-49304470 GTTGAAGTGCTGCCTGTGGCCGG - Intergenic
949365056 3:3271762-3271784 GCTGACCTCCAGCTTGAGACTGG - Intergenic
950030741 3:9851492-9851514 GCTGCACTGCCGCTTGTGGCGGG + Intronic
950676064 3:14555161-14555183 GCTGAGCCCCAGCCTGTGCCGGG - Intergenic
950929231 3:16772416-16772438 CCTGACCTTCTCCCTGTGGCCGG + Intergenic
953135395 3:40177366-40177388 CCTGACCTACAGGCTGTGGAGGG + Intronic
954046962 3:47940177-47940199 GCTGTGCTGCACCCTGTGGAAGG - Intronic
954278031 3:49554856-49554878 GGTGAGCTGCAGCCTGAGGCCGG + Intronic
954722087 3:52573329-52573351 ACTGCACTCCAGCCTGTGGCTGG - Intronic
955159444 3:56449324-56449346 GCCCACCTGGAGCCTGTGCCTGG - Intronic
958528758 3:95296025-95296047 GCTGATCTTTAGCCTGTGGGTGG + Intergenic
959820180 3:110724788-110724810 CCTGATCTGCAGTATGTGGCAGG + Intergenic
961297052 3:125893378-125893400 GCTGCACTGCTGCTTGTGGCGGG - Intergenic
961641003 3:128364820-128364842 GCTGCCATGCAGGCTGTGGAGGG - Intronic
962200032 3:133393373-133393395 GCTGTCCTGCTGCCTGAGGCAGG + Intronic
962315089 3:134354227-134354249 GTGGAGCTGCAGGCTGTGGCAGG - Intergenic
962745036 3:138390632-138390654 GCTGACAAGGGGCCTGTGGCCGG + Intronic
963278644 3:143358941-143358963 GCTGACCTCCTTCCTGTGGTTGG - Intronic
964635042 3:158849132-158849154 GCTGACCTACTGCCTGTGAGAGG - Intergenic
964772509 3:160239229-160239251 GGTGGCCTGGAGCCTGGGGCGGG + Intronic
967026426 3:185568618-185568640 GCTGCACTGCCGCTTGTGGCGGG + Intergenic
967908539 3:194521978-194522000 GCTACTCTGCAGCCTGAGGCAGG + Intergenic
968206757 3:196809134-196809156 GCTGACTGGGAGCCTGAGGCAGG + Intronic
968594084 4:1473430-1473452 CCTGTCCTGCTGCCTGTGGCTGG - Intergenic
969227800 4:5810464-5810486 CCGGACCTGTTGCCTGTGGCTGG + Intronic
969391166 4:6892233-6892255 CCTGACCAGCAGCGTGGGGCAGG + Intergenic
971385785 4:26139502-26139524 ACTGAGCTGCAGGCTGTGACTGG - Intergenic
971693458 4:29867574-29867596 GGTGTCCTGCAGGCTGTGACAGG - Intergenic
973140712 4:46765403-46765425 GTTGACCTGGTGCCTGCGGCTGG - Intronic
977472021 4:97453492-97453514 TCTGACCTGAAACCTCTGGCCGG - Intronic
981889213 4:149716036-149716058 GATGGCCTGAAGCCTGGGGCTGG - Intergenic
982068486 4:151674882-151674904 GCGGACGAGCAGCCTGTGCCTGG + Intronic
982844636 4:160234434-160234456 GCTGTTCTGCAGGCTGTGGTGGG - Intergenic
983207242 4:164923578-164923600 GCTGTCCTGGAGGCTGAGGCAGG - Intergenic
983215510 4:164998754-164998776 GCTGCACTGCTGCTTGTGGCAGG - Intergenic
983446337 4:167858011-167858033 GCTGACCTGCACCCAGTGTCTGG - Intergenic
983881199 4:172935165-172935187 GCTGCCCTGCAGACTGTGAGTGG + Intronic
984335028 4:178379421-178379443 TCTGTCCTTCAGCCTGTGGCTGG - Intergenic
984345751 4:178522473-178522495 AGTGACCTGCAGCCAGTGGCCGG + Intergenic
985647981 5:1093999-1094021 CCTGTCCTGAAGGCTGTGGCGGG - Intronic
985758882 5:1734627-1734649 GCAAACCTGCAGCCAGAGGCTGG + Intergenic
985828107 5:2207721-2207743 GGTGACCAGCAGCATGTGGTGGG - Intergenic
986325502 5:6670279-6670301 GCTTCCCTGCAGCTTGAGGCAGG - Intergenic
986702793 5:10427956-10427978 GCTGCCCTGCAGGCTGATGCAGG + Intronic
987127375 5:14827013-14827035 ACTGACTTTCAGCCTGTAGCTGG - Intronic
987234383 5:15928278-15928300 GCTGACCCGCAGACTCTGCCAGG + Exonic
988380569 5:30493006-30493028 GCTGCACTGCCGCTTGTGGCGGG + Intergenic
989982778 5:50663879-50663901 CCTGGCCTGCAGCCATTGGCGGG + Intergenic
990884844 5:60579639-60579661 GGTGAGCTGCAGCTGGTGGCTGG - Intergenic
991405024 5:66293324-66293346 GGTGACATGCAGCCTGAGGACGG + Intergenic
991996367 5:72391060-72391082 GCTGACCTCCAGCCTCTTCCTGG - Intergenic
996302792 5:122008158-122008180 GCTGCCCTGAAGCCTAGGGCTGG + Intronic
998137340 5:139681094-139681116 CCTGACATGGAGGCTGTGGCAGG + Exonic
998209830 5:140187012-140187034 GCTGCCCTGGAGGCTGAGGCAGG + Intronic
998333741 5:141352062-141352084 GCTGGCCTGCAGCACGTGGTAGG - Exonic
998334814 5:141361949-141361971 GCTGGCCTGCAGCACGTGGTAGG - Exonic
998343731 5:141441932-141441954 GCTGGCCTGCAGCACGTGGTAGG - Intronic
998349456 5:141491474-141491496 GCTCACCTGCAGGTTGGGGCTGG - Exonic
999416967 5:151406685-151406707 GCTGACCTTCATCCTTTGGTGGG + Intergenic
1000334071 5:160228994-160229016 GCTGACCTGGAGCATGGGGAAGG - Intronic
1001482558 5:172098556-172098578 GCTGCACTGCAGCCTGTTGGTGG - Intronic
1001571565 5:172733600-172733622 GCTGATCTGCTGCTTCTGGCTGG - Intergenic
1001919300 5:175587858-175587880 TCTGACTTGCAGGCAGTGGCAGG + Intergenic
1001995438 5:176153737-176153759 GCTGACTTGCAGCCAGGGGTCGG + Intergenic
1002559427 5:180071630-180071652 GCTGACCTGCAGCCTGTGGCCGG - Exonic
1002895862 6:1379772-1379794 GCAGACCGGCTGTCTGTGGCTGG + Intergenic
1002897202 6:1386307-1386329 GCTGGCCAGCAGCCTGGGCCTGG - Intergenic
1003056665 6:2826911-2826933 GCTGCCCTGGAGTCTGAGGCAGG + Intergenic
1003494470 6:6652256-6652278 GCTGACCTGCAGCCGGTGTAGGG - Intronic
1004216119 6:13705823-13705845 ACTGCCCTGCAGCCTGGGCCTGG + Intronic
1004755064 6:18601898-18601920 GCAGACCTGCAGGCTGGAGCTGG - Intergenic
1005056352 6:21732459-21732481 GCTGCTCCGCAGCCTGAGGCAGG + Intergenic
1006020327 6:31114133-31114155 CCTGATCTGCAGCCAATGGCAGG - Intergenic
1006129511 6:31860836-31860858 GCTCTCATGCACCCTGTGGCTGG - Intronic
1006452013 6:34110786-34110808 GATGGCCTGCAGCCTGGGCCAGG - Intronic
1011029733 6:82908909-82908931 ACTCACCTGCAGCCTGAGCCAGG - Intronic
1012307432 6:97675586-97675608 GCTGATCTGGAGCCTGGGGTAGG + Intergenic
1013591939 6:111626204-111626226 TCTGACTTGCAGCTTCTGGCTGG + Intergenic
1018733856 6:166672989-166673011 CCTGACCTGCAGGCTCTGGGTGG + Intronic
1019319833 7:410585-410607 GCGGACCTGCGGCAGGTGGCAGG + Intergenic
1019325961 7:438387-438409 GGTGACCTGGATCCTGAGGCCGG - Intergenic
1019599491 7:1874153-1874175 GCTGCCCAGCAGACAGTGGCTGG + Intronic
1019976724 7:4588791-4588813 GCTGCACTGCCGCTTGTGGCGGG + Intergenic
1019977660 7:4597294-4597316 GCTGCACTGCCGCTTGTGGCGGG + Intergenic
1020101646 7:5397322-5397344 GCTTCCGTGCAGCCTGCGGCAGG - Intronic
1020118236 7:5488240-5488262 ATTCACCTGCTGCCTGTGGCCGG - Intronic
1024468697 7:49742832-49742854 GCAGGCCTGCAGCATGAGGCAGG - Intergenic
1025109025 7:56197203-56197225 GCTGACCCACAGCCTGGAGCAGG + Intergenic
1025996416 7:66530195-66530217 GCTGTTCTGCAGCCTGAGCCTGG + Intergenic
1026539927 7:71270813-71270835 GCTGAACTTCAGACTGTGGGAGG - Intronic
1027764243 7:82319981-82320003 GTTGGCATGCTGCCTGTGGCTGG + Intronic
1029192927 7:98784660-98784682 GCTGCCCTGGAGGCTGAGGCAGG + Intergenic
1029507244 7:100969750-100969772 GCAGCCCTGCTGCCTGAGGCAGG - Intronic
1029649061 7:101878371-101878393 GCTAAGCTGCAGCCTGTTGCTGG - Intronic
1029905362 7:104087510-104087532 GCTAACCTGGAGGCTGAGGCAGG + Intergenic
1029967012 7:104750682-104750704 GCTGCACTGCTGCTTGTGGCGGG + Intronic
1030153293 7:106427060-106427082 GCTGACCTGCAGCCTGTGCGAGG - Intergenic
1031437893 7:121755421-121755443 GCTGGCCTGCAACATGTTGCTGG - Intergenic
1032252527 7:130270479-130270501 GCACACCTGCAGCATCTGGCTGG + Intronic
1033281129 7:140007234-140007256 CCTGACCTGCAGGCTGGGGCAGG - Intronic
1034423513 7:151001316-151001338 GCTGCCCTGCAGACTGGGCCTGG + Exonic
1034501295 7:151452527-151452549 GCTGACCTCCTGCCTGGGGAAGG - Intergenic
1034949610 7:155288089-155288111 CCTGATCTCCAGTCTGTGGCTGG + Intergenic
1035259213 7:157650791-157650813 GGTGACTTGCAGCCTTGGGCAGG + Intronic
1036292267 8:7504240-7504262 GCTGCACTGCCGCTTGTGGCGGG + Intronic
1036788854 8:11704672-11704694 GCTGCCGTGCAGCCTGTCCCGGG - Intronic
1037510102 8:19574030-19574052 GCTTATCTGGAGGCTGTGGCGGG - Intronic
1038576800 8:28711592-28711614 GCTGAGCTGCATCCTGAGCCGGG + Intronic
1040053840 8:43040813-43040835 GCTGATCGGCAGCCTGAGGCAGG - Intronic
1041437557 8:57859196-57859218 CCTGACCTGCAGCTGCTGGCAGG + Intergenic
1043454600 8:80400959-80400981 GCTGACCTGCATCCTGTGGTGGG + Intergenic
1044608696 8:94071036-94071058 GCTCACCTGCAGCCTGTGGCTGG + Intergenic
1045795280 8:106036704-106036726 TCTGAGTTGCAGCCTGAGGCAGG + Intergenic
1045866057 8:106866878-106866900 TCTGTCCTGCACCCTTTGGCCGG - Intergenic
1048445279 8:134488681-134488703 CCTGAACTGCAGCCTGTTGGTGG - Intronic
1049031866 8:140043973-140043995 GCTTACCTGCAGGCTGTGGCTGG - Intronic
1049059902 8:140268625-140268647 GCTGACCTGTGACCTGAGGCTGG + Intronic
1049338525 8:142099490-142099512 GCTGAGGAGCTGCCTGTGGCCGG - Intergenic
1049404367 8:142445143-142445165 GAGGCCCTTCAGCCTGTGGCTGG + Intergenic
1050556550 9:6794360-6794382 GCTGACCTGTACTTTGTGGCTGG + Intronic
1050589701 9:7148958-7148980 GATGGCCTGAAGCCTGGGGCTGG - Intergenic
1050600595 9:7246368-7246390 TCTGACCTGCAGCCTGAGCTGGG + Intergenic
1052897232 9:33759234-33759256 GCTAACCAGCAGCCTGTGGAGGG - Intronic
1053169337 9:35867728-35867750 GCTTACCTGTAGCCGGGGGCAGG + Intergenic
1055574286 9:77646917-77646939 GCTGCCCTGGTGCCTCTGGCAGG - Intronic
1056414377 9:86362205-86362227 GCTGCCATGCAGCCTATGCCTGG + Intergenic
1056492068 9:87118129-87118151 GCTGCTCTGCAGGCTGAGGCAGG - Intergenic
1056896146 9:90552523-90552545 GCTGACCTCCAGCCTGAGCTAGG - Intergenic
1057600377 9:96451357-96451379 GGTGTCCTGCTGCCTGTGGACGG + Intronic
1057782978 9:98064992-98065014 ACTGCCCTGCAACCTGGGGCAGG + Intronic
1059978187 9:119740512-119740534 GCTGAGATGAAGTCTGTGGCTGG + Intergenic
1060864245 9:126982262-126982284 TCTGACCTGAGGCCTGTGGTAGG - Intronic
1061481099 9:130898109-130898131 GCTGACCGGCAGCCCCTGCCTGG + Intergenic
1061931403 9:133834852-133834874 CCTGACCTCAAGCCAGTGGCTGG - Intronic
1062175229 9:135158321-135158343 CCGGACCTGCAGCCTGAGGCTGG - Intergenic
1062454739 9:136630128-136630150 GCTGAGGGGCAGCCTGGGGCTGG - Intergenic
1062487438 9:136786588-136786610 GCTGCACTGCCGCTTGTGGCGGG + Intergenic
1062612499 9:137381451-137381473 ACTGCCCAGCAGCCTGTGGTGGG - Intronic
1203777429 EBV:81590-81612 CCTGCCCCGCAGCCTGTGTCAGG - Intergenic
1185453463 X:295356-295378 TCGGTCCTGCAGCCTGCGGCTGG + Intronic
1185662815 X:1740664-1740686 GCTGATCAGCAGGCTGAGGCAGG - Intergenic
1185662856 X:1740979-1741001 GCTGATCAGCAGGCTGAGGCAGG - Intergenic
1187123248 X:16429541-16429563 GCTGGCCAGCAGCTGGTGGCTGG + Intergenic
1188791908 X:34415310-34415332 ACTGACCTGCACCCAGTGTCTGG - Intergenic
1189956283 X:46278086-46278108 GCTGCCCTGGAGGCTGAGGCAGG - Intergenic
1190081864 X:47362926-47362948 GCTGACCTGAAGCCTGAATCAGG + Intergenic
1191167605 X:57406736-57406758 GCTGGTCTGCACTCTGTGGCAGG + Intronic
1191927472 X:66329159-66329181 GCTCACCTGGAACCTGGGGCTGG - Intergenic
1192510635 X:71718728-71718750 GCTCTCCTGCTGCCTCTGGCTGG - Intergenic
1192516062 X:71762825-71762847 GCTCTCCTGCTGCCTCTGGCTGG + Intergenic
1197375573 X:125678302-125678324 GCTGACCTGAAGCCTGGATCTGG + Intergenic
1199671658 X:150152741-150152763 ACTGACCGGCAGCCTGCAGCAGG - Intergenic
1200118350 X:153778979-153779001 GCTGGCCTGCCGCCTGCAGCAGG + Exonic
1201930856 Y:19345342-19345364 GCTGACCTCTAGCCAGTGGGTGG + Intergenic