ID: 1002559624

View in Genome Browser
Species Human (GRCh38)
Location 5:180072303-180072325
Sequence CTCCCGGGCTCCACGCCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002559624_1002559629 21 Left 1002559624 5:180072303-180072325 CCGCAGGGCGTGGAGCCCGGGAG 0: 1
1: 0
2: 1
3: 22
4: 227
Right 1002559629 5:180072347-180072369 TGTGTGAGAACAGACTACAAAGG No data
1002559624_1002559628 -5 Left 1002559624 5:180072303-180072325 CCGCAGGGCGTGGAGCCCGGGAG 0: 1
1: 0
2: 1
3: 22
4: 227
Right 1002559628 5:180072321-180072343 GGGAGATTTGCGAGGACGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002559624 Original CRISPR CTCCCGGGCTCCACGCCCTG CGG (reversed) Intergenic
900095393 1:938097-938119 GCCCCTGACTCCACGCCCTGGGG - Intronic
901056119 1:6449284-6449306 CGACCGGGCTGCACGGCCTGGGG + Intronic
901084778 1:6603619-6603641 CTCCGGGGCTGCCCGCCCTAGGG + Intronic
902290889 1:15433893-15433915 GTCATGGGCTCCAGGCCCTGTGG - Intergenic
902628642 1:17691460-17691482 CTGCCGGTCTCCATGCCCTGGGG + Intronic
903466409 1:23555023-23555045 CTGCCGGGCTCCAGGCCACGTGG + Intergenic
904015081 1:27413558-27413580 CTCCAGGGCTCCAGGCCTTGGGG - Intronic
905178356 1:36151926-36151948 CTCCCAGGGCCCACTCCCTGTGG - Intronic
905548827 1:38819682-38819704 CTCCAGGTCTCCTGGCCCTGAGG - Intergenic
905692862 1:39955587-39955609 CACCCGCACTCCACGCTCTGCGG + Intronic
906551751 1:46671336-46671358 TTCCCAGGCCCCAGGCCCTGTGG - Intronic
907501906 1:54887207-54887229 ATCCCGGGCTCCCCGGGCTGTGG - Exonic
908459849 1:64338778-64338800 CTCCAGGGCTCCAAGCCCTCAGG + Intergenic
912554117 1:110503893-110503915 CACCCTTCCTCCACGCCCTGTGG - Intergenic
913098201 1:115539632-115539654 CTCACGGGCTCCAAACCTTGGGG - Intergenic
913104178 1:115596268-115596290 TTCCTGGGCTCCAGACCCTGAGG + Intergenic
916070668 1:161167929-161167951 CTCCCCAGCTCCAGGCGCTGGGG - Intronic
917542947 1:175933254-175933276 ATCCCGTGATCCACTCCCTGTGG + Intergenic
919835664 1:201571455-201571477 CTGCCAGGCTCCAGGCACTGGGG + Intergenic
920531596 1:206706497-206706519 CTCCCAGGCTCCAGGCTCTCTGG + Intronic
920612472 1:207454761-207454783 CTGCCGGGCTCCCCGCCCCCAGG + Intronic
921923077 1:220690268-220690290 ATCCCGGGCCCCACGGCCAGGGG + Exonic
923357636 1:233176368-233176390 CTCCCGTGCTCCACCCAGTGTGG + Intronic
924957630 1:248944758-248944780 CCCCCGCGCTCCCCGCCCGGCGG + Intergenic
1064433939 10:15294366-15294388 CTCCCGGGGTCCACGACCTTGGG - Intronic
1067440659 10:46307699-46307721 CTCCAGGGCTCCTGGGCCTGAGG - Intronic
1067497426 10:46773461-46773483 GTCCAGGGCTCCCCGCCCAGTGG + Intergenic
1067597226 10:47566954-47566976 GTCCAGGGCTCCCCGCCCAGTGG - Intergenic
1070140575 10:73734564-73734586 GTCCAGGGCTCCCCGCCCAGTGG - Intergenic
1072188064 10:93060901-93060923 CTCCCGGGCTCAGCACCCTTTGG - Intergenic
1073295313 10:102435158-102435180 CTCCCGGGATCCCTGCCCTGAGG + Intergenic
1075728316 10:124622028-124622050 CACCCTGGCTCCTCACCCTGGGG - Exonic
1076096094 10:127736244-127736266 CTCCCCTGCTCCCCGCGCTGTGG - Intergenic
1076698714 10:132259172-132259194 ATCCCAGCCTCCAAGCCCTGGGG + Intronic
1076963473 10:133786276-133786298 CCCCCGCGCTCCCCGCCCGGCGG + Intergenic
1077517176 11:3008989-3009011 CTCCCGGGCCACACTCCCTGGGG + Intronic
1077628810 11:3797223-3797245 CTCCCGGGCTCCGGGCCCCCGGG + Intronic
1077892727 11:6431209-6431231 CTCCTGGGCTGCACTCACTGAGG - Exonic
1081911788 11:46704665-46704687 CTGCTGGGCTCCAGGCTCTGGGG - Exonic
1083272711 11:61580380-61580402 CTGCCGGGATCCTCGCCCTGGGG + Intronic
1083571520 11:63764217-63764239 CACCCGGGCTCCACGCGCCTCGG - Exonic
1083933951 11:65860714-65860736 CTCCGGCGCTCCACGCCCGCGGG - Exonic
1084215635 11:67645557-67645579 CCCCTGGGCTCCAGTCCCTGGGG - Intronic
1084483367 11:69434594-69434616 CTTCCAGGCCCCAGGCCCTGGGG + Intergenic
1084690110 11:70720161-70720183 CTCCCAGGTACCAGGCCCTGGGG - Intronic
1085517832 11:77121763-77121785 GTCCCCAGCTCCAAGCCCTGTGG - Intronic
1088823519 11:113475421-113475443 CTCCCGCGCTCCCCGCGCTCGGG - Intronic
1089398195 11:118149462-118149484 CTCCTGGGGTGCAGGCCCTGGGG + Intronic
1090267741 11:125364133-125364155 CTCCTGGCCCCCAAGCCCTGTGG + Intronic
1090333399 11:125947822-125947844 CTCCCTGGTTCCCCGGCCTGTGG + Intergenic
1090360084 11:126165984-126166006 CTCCCGGGCTCCCTGCCATGAGG - Intergenic
1090908302 11:131096425-131096447 CTGCCGGGCTCCAGGCCCCTAGG - Intergenic
1091227693 11:133967417-133967439 CGCCCGGGCTACAGGCGCTGGGG + Intergenic
1091252611 11:134156212-134156234 CTCCCAGGTTCCAGGCACTGTGG + Intronic
1091790132 12:3267446-3267468 CCCCTGGGCTCCAAGTCCTGAGG + Intronic
1094477650 12:30853711-30853733 CTCCAGCGCTCCTGGCCCTGCGG - Intergenic
1096178687 12:49539159-49539181 ATCCCGGGCTCCAGGCCCCGCGG - Exonic
1096403194 12:51324126-51324148 CGCCCTGGCCCCGCGCCCTGTGG + Exonic
1096491328 12:52014768-52014790 CTCCCGGGCTCGCTGCCCTTCGG + Exonic
1098897825 12:76083986-76084008 CTCCCGGGCTCTCCGCCCATTGG - Intronic
1100315615 12:93441952-93441974 GTCCCGGGCTCCACTTCCGGGGG + Exonic
1101439409 12:104692211-104692233 CTCGTGGGCTGCACGCTCTGAGG - Intronic
1102873791 12:116434336-116434358 ATGCCGGGCTCCAGGCCTTGCGG - Intergenic
1102956712 12:117063644-117063666 CTCCAGGGCTCCCTGCACTGAGG + Intronic
1103647241 12:122403995-122404017 CTCCCTGCCTTCATGCCCTGTGG - Intronic
1104639881 12:130460765-130460787 GTCCCCGGCGCCAGGCCCTGGGG - Intronic
1104692673 12:130838864-130838886 CTCCCGGGACCCCCGCCCTGGGG + Intronic
1105701917 13:22940469-22940491 GTCCCGGGCTCCCCAGCCTGTGG + Intergenic
1108408447 13:50125926-50125948 ATCTCGGGCTCCGCGACCTGTGG + Intronic
1110318548 13:74135430-74135452 CTCCCCGCCTCCGCGCCCCGGGG + Intergenic
1113088804 13:106595872-106595894 CTCCCAGGCACCAGGCCCAGTGG + Intergenic
1113737621 13:112689864-112689886 CGCCCGGGCCCCAGACCCTGGGG - Intergenic
1113989908 13:114353117-114353139 CCCCCGCGCTCCCCGCCCGGCGG + Intergenic
1115094943 14:29622962-29622984 CTTCCAGTCTCCACGCACTGTGG - Intronic
1119060814 14:71471914-71471936 CTACCTGACTCCAAGCCCTGGGG + Intronic
1119390956 14:74290568-74290590 CTCCCGGGAGCCACCACCTGTGG + Intronic
1119872654 14:78030200-78030222 TTCCCTGGCTCCACTCCGTGGGG - Intergenic
1122207747 14:100156661-100156683 CTCCATGGCTCCAAGCCCTCTGG - Intronic
1122399239 14:101457714-101457736 CTCCCGGGCTCCAGGCGCGTCGG - Intergenic
1122812086 14:104294059-104294081 CTCCCGTGCTCCCTGTCCTGAGG + Intergenic
1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG + Intronic
1125722568 15:41852270-41852292 CTCCCGGGCTTCAGCTCCTGTGG + Exonic
1128423933 15:67521073-67521095 CCCCCGGACTCCACCCCCAGCGG + Exonic
1128562321 15:68677112-68677134 CTCCGGGGCTCCAGGCCTGGCGG - Intronic
1130382018 15:83379384-83379406 CACCCTGCCTCCAAGCCCTGCGG + Intergenic
1130981357 15:88813890-88813912 CTCTCCAGCTCCATGCCCTGGGG + Intronic
1132703584 16:1231816-1231838 CTTCCGGGCTGCACCCCCCGGGG + Intergenic
1132704925 16:1239545-1239567 CTTCCGGGCTGCACCCCCCGGGG - Intergenic
1132707934 16:1254579-1254601 CTTCCGGGCTGCACCCCCCGGGG - Intergenic
1132758931 16:1499679-1499701 CCTCCGGGCTCCAGGCCATGGGG - Intronic
1133017502 16:2951016-2951038 CTGCCGGGCTGCACGCTCCGCGG - Exonic
1133758319 16:8778963-8778985 CTCCCAGTCTCAAAGCCCTGAGG + Intronic
1134630215 16:15750761-15750783 CTTCTGTGCTCCAGGCCCTGGGG + Intronic
1137334524 16:47534129-47534151 CACCCGGGCTGCATGCTCTGTGG - Intronic
1137734921 16:50716720-50716742 TTCCCAGGCTGCACGACCTGGGG - Intronic
1137787988 16:51152639-51152661 CCCCTGGGCACCCCGCCCTGGGG + Intergenic
1138108897 16:54307634-54307656 CTCCAGGGCTCCAACCACTGGGG - Intergenic
1138516951 16:57541430-57541452 CTCCTGGGCTACACTCCCTCTGG - Intergenic
1139431307 16:66912390-66912412 GTCCCGGGCTCCACATCCTCAGG + Exonic
1139597045 16:67964119-67964141 CTTCCGCTCTCCACGGCCTGGGG - Intronic
1141600616 16:85123978-85124000 CTCCCGGCCTTCCCTCCCTGCGG - Intergenic
1142299255 16:89247224-89247246 CTCCTGGGCTCCCCGCTCGGGGG - Intergenic
1142338811 16:89507860-89507882 CTCCGGGGCTGCCCTCCCTGCGG + Intronic
1143731411 17:8884935-8884957 CTCTCTGGCTCCACGTTCTGGGG + Intronic
1146995204 17:37314570-37314592 TTCCTGGGCTCCACGACCAGAGG + Intronic
1152347465 17:79762094-79762116 CTGCCAGGCTCCACTCCCTCTGG + Intergenic
1152357415 17:79813752-79813774 CACCCGGGCTGCGCGGCCTGGGG + Intergenic
1152608778 17:81305698-81305720 TTCCCGTGCTCCTCGGCCTGTGG - Intergenic
1152718289 17:81910423-81910445 CTGCCGGGCTCCGCGCACTGTGG - Intronic
1152727795 17:81956245-81956267 CTCCCCAGCCCCACGCTCTGAGG - Intronic
1152865041 17:82717224-82717246 CTCCCGGGGTTCCTGCCCTGCGG + Intronic
1152888750 17:82867934-82867956 CTCCCGGAGTCCTCCCCCTGGGG - Intronic
1154151424 18:11909011-11909033 CTCCCGGGTTCCGCGCGCGGTGG + Exonic
1157428111 18:47601445-47601467 CTCCCTGTCTACACGCTCTGAGG + Intergenic
1157496717 18:48161843-48161865 CTCCCGGGCGCCCCTCCCCGCGG + Intronic
1157544725 18:48539570-48539592 CTGCCGGGTTCCCCGCCCCGCGG + Intronic
1160592125 18:79950951-79950973 GTCACGGGCTCCGCGCCCCGCGG + Exonic
1160653462 19:246734-246756 TTCCCGCGCTCCCCGCCCAGCGG - Intergenic
1160679342 19:405660-405682 CTCCCCGCCTCCCCGGCCTGAGG + Exonic
1160958988 19:1709116-1709138 CTACCAGTCTCCACCCCCTGGGG + Intergenic
1161001195 19:1912126-1912148 CTCCCGGCCTCCAAGCACTTGGG - Exonic
1161104518 19:2436784-2436806 CTCCAGGACTCCGCACCCTGTGG + Intronic
1161127692 19:2567876-2567898 TTCCCGGGCACCACGCGCTCAGG + Intronic
1162027812 19:7904228-7904250 CTCGCCGGCTCCACGCCCCCCGG - Intronic
1163036427 19:14571842-14571864 CACCCGCGCCCCACGCCCTCTGG + Intronic
1163111167 19:15161508-15161530 CCCCCGGTCCCCACGGCCTGGGG - Exonic
1163519179 19:17781716-17781738 CTCCCGGGGTCCGAGCCCTGTGG + Exonic
1165160384 19:33812506-33812528 CTCCCGGAATCAAGGCCCTGAGG + Intronic
1165329107 19:35131584-35131606 GACCCGGCTTCCACGCCCTGGGG + Intronic
1165408361 19:35643816-35643838 CTCCCGGGCCCCGCCCCCTTAGG - Intronic
1167329370 19:48845405-48845427 CTCCCGGGCTTCCAGCCCTGAGG - Exonic
1167504420 19:49863613-49863635 CTCCTGGGCTCCCCGGCCTCCGG - Intronic
925019132 2:554646-554668 GGCCCGGTCTCCACGCCCCGCGG - Intergenic
925060251 2:885384-885406 TTCCCAGGCTCCATGTCCTGGGG - Intergenic
925182309 2:1825178-1825200 CTTCCCGGCTCCCAGCCCTGAGG - Intronic
925839607 2:7979271-7979293 CTCCCTGGCTACACACACTGAGG - Intergenic
927713925 2:25341170-25341192 CTCCCGGGTCCCCCGCCCCGCGG + Intronic
929532614 2:42762260-42762282 CACCAGGGCTCCAGGCCCTCGGG - Intergenic
931517521 2:63058835-63058857 CTCCCGCGTTCCGCGCCCAGCGG + Intergenic
932570109 2:72934078-72934100 GCCCCGGGCTTCAAGCCCTGTGG - Exonic
935142980 2:100370789-100370811 CCCCCGGGGTTCACGCCATGAGG + Intergenic
936569895 2:113603974-113603996 CCCCCGCGCTCCCCGCCCGGCGG - Intergenic
937992514 2:127672529-127672551 CTCCCGAGCCCCACCCTCTGTGG + Intronic
941318415 2:164024155-164024177 CTCCCGGGCTCCAGGCCCACTGG - Intergenic
943060452 2:183037800-183037822 GTCCCGGGCGCCTCTCCCTGTGG - Intronic
945119597 2:206443835-206443857 CTCCCGGGCGCCGCTCCGTGTGG - Exonic
946690578 2:222305877-222305899 CTACCGGGCCGCACTCCCTGGGG - Intergenic
947605612 2:231483571-231483593 GTCCCGGGCTGCAGGCCCCGTGG + Intronic
948132089 2:235608430-235608452 CTCCAGGTCTCCATGGCCTGGGG - Intronic
948356834 2:237384814-237384836 CCCACAGGCTCCACTCCCTGTGG + Intronic
948404801 2:237709339-237709361 CTCCCGTGGGCCATGCCCTGTGG + Intronic
948751516 2:240136079-240136101 CTCCCAGGCTCCCTGCCCCGCGG - Intronic
949088869 2:242182367-242182389 CCCCCGCGCTCCCCGCCCGGCGG + Intergenic
1169897746 20:10522532-10522554 CTCCCGGTCTCCTGGGCCTGCGG + Intronic
1172601604 20:36187670-36187692 CTCCCGGGGTCATCCCCCTGAGG - Exonic
1172611375 20:36255317-36255339 TACCCTGGCTCCACCCCCTGGGG - Intronic
1173851450 20:46220904-46220926 CTTCCGGTATCCACGCCCTTGGG + Intronic
1174085904 20:48006934-48006956 CTCCGGGGCTCCCTGCCCTCTGG - Intergenic
1174130344 20:48339995-48340017 CTCCTGGGCTCCCTGCCCTCTGG + Intergenic
1174419840 20:50392211-50392233 CTCCCTGGCTATATGCCCTGGGG + Intergenic
1174456488 20:50652255-50652277 CTCCCAGGCTCCAAACCCTGAGG + Intronic
1174635610 20:51997002-51997024 CTCCCTAGTTCCGCGCCCTGCGG + Intergenic
1176033852 20:63026916-63026938 GTGCGGGGCTCCACGCGCTGGGG - Intergenic
1176222784 20:63978046-63978068 GTCCCGGGCTGCAGGCCCTGTGG - Intronic
1179198083 21:39183946-39183968 CTCCCGGACGCCACGGCCAGCGG - Intergenic
1179674718 21:42974032-42974054 CACCCGGGCTCCAGAGCCTGGGG + Intergenic
1180264092 21:46698649-46698671 CCCCCGCGCTCCCCGCCCGGCGG + Intergenic
1181187645 22:21118340-21118362 CTCCAGGTCTCCAGGCCGTGGGG + Intergenic
1181211553 22:21292153-21292175 CTCCAGGTCTCCAGGCCGTGGGG - Intergenic
1181974253 22:26717613-26717635 CTCATGGGCCCCTCGCCCTGAGG - Intergenic
1184116774 22:42426898-42426920 GTCCCAGGTGCCACGCCCTGAGG + Intronic
1184759635 22:46537260-46537282 CTCCCGGGCGCCCGGCCCTCGGG + Intergenic
1185325536 22:50224111-50224133 AGCCCGGGCTCCAGGCCCAGGGG - Intronic
1185330461 22:50249940-50249962 CTCCCGGGCACCATGGCCAGAGG - Exonic
1185430330 22:50807030-50807052 CCCCCGCGCTCCCCGCCCGGCGG + Intergenic
1203215397 22_KI270731v1_random:3279-3301 CTCCAGGTCTCCAGGCCGTGGGG + Intergenic
1203275230 22_KI270734v1_random:82113-82135 CTCCAGGTCTCCAGGCCGTGGGG - Intergenic
950518377 3:13481592-13481614 CTCCCTGGCTCCCCATCCTGTGG + Intronic
950646986 3:14383156-14383178 CTCCCTGGCTCCAAGCTCTGGGG + Intergenic
954399960 3:50314197-50314219 CTCCCAGGCTCAAAGCACTGGGG - Intergenic
961360903 3:126366477-126366499 CACACGGGCTCCAGCCCCTGGGG + Intergenic
962722361 3:138187681-138187703 CTCCTGGGCACCACCCCCTGGGG + Intronic
963603642 3:147396841-147396863 CTCCGGGGCACGATGCCCTGCGG + Intronic
963870664 3:150410290-150410312 CCCCCGGGCCCCGCTCCCTGGGG - Exonic
968282137 3:197485074-197485096 CTCCCGGGCTCCGCTCCCTGTGG + Intergenic
968478982 4:825731-825753 CTCCCGGGCTCCGCGCGCGCGGG - Intronic
968611964 4:1561272-1561294 CTCCCCGGCTCCCAGGCCTGTGG - Intergenic
968834958 4:2956622-2956644 CTCCCTGACTCCACGCCCACAGG + Intronic
968979036 4:3836850-3836872 CTCCCAGGCTCCGCCTCCTGAGG + Intergenic
969353677 4:6612896-6612918 CACGAGGGCTCCAGGCCCTGAGG - Intronic
971273652 4:25174838-25174860 CTCCCAGCATCCACGCCCTTAGG + Intronic
976167902 4:82274855-82274877 CACCCTGGCCCCATGCCCTGTGG - Intergenic
978106227 4:104904783-104904805 CTACCTGGCTCCAAGCCCAGTGG - Intergenic
980990593 4:139735496-139735518 CTCCCGGGCTGTCGGCCCTGGGG - Intronic
985005914 4:185535394-185535416 CTCCCGGGCCCTGCGCCCTGGGG - Exonic
985466698 4:190203574-190203596 CCCCCGCGCTCCCCGCCCGGCGG + Intergenic
985537599 5:473654-473676 CTCCCGCGCTGCAGGGCCTGGGG - Intronic
985851521 5:2391980-2392002 CTTCCGTGCTCCTGGCCCTGTGG + Intergenic
989492506 5:42074104-42074126 GTCCCGGGCTTCACCCACTGGGG + Intergenic
992052779 5:72956304-72956326 CTCCCGGGCTCGCAGCCCTATGG + Intronic
993898799 5:93570849-93570871 CTTCCGGGATCCGCTCCCTGCGG + Intergenic
994171477 5:96662877-96662899 CTCCAGGCAGCCACGCCCTGCGG - Intronic
994755636 5:103790491-103790513 CTCACGGGCTCAACACCATGTGG + Intergenic
996415157 5:123202784-123202806 CTCCTGGGATCCTCACCCTGGGG - Intergenic
996837912 5:127814395-127814417 CTCCTGAGCTCCACACTCTGGGG - Intergenic
997114582 5:131112511-131112533 CCCCCGGGCCCCACACCTTGAGG + Intergenic
997293301 5:132753213-132753235 CTCCCTGGCTTCAGGCCCAGAGG - Exonic
999375713 5:151085388-151085410 CTCCCCAGCTCCAGGCCTTGGGG - Intronic
1002020506 5:176361413-176361435 CTCCCTGGCTCCGCTCTCTGGGG - Intronic
1002559624 5:180072303-180072325 CTCCCGGGCTCCACGCCCTGCGG - Intergenic
1002762248 6:210989-211011 CTCCAGGGCTGCACGCCCTCTGG + Intergenic
1004562013 6:16760681-16760703 CGCCCGGCCTCGGCGCCCTGGGG - Intronic
1005104209 6:22205755-22205777 CTCCCGTGTTCAAGGCCCTGGGG + Intergenic
1006022411 6:31125219-31125241 CTCTGGGGCTCCAGGGCCTGTGG + Intronic
1006911100 6:37564151-37564173 CTCCCCTGTTCCAAGCCCTGGGG + Intergenic
1006932784 6:37697692-37697714 CTCCCGGGCTCCGAGCTCTCGGG + Exonic
1006941780 6:37756422-37756444 ATCCCGGGCTGCAGGGCCTGGGG + Intergenic
1008404243 6:51100961-51100983 CTCCATGGCTCCACTCACTGGGG + Intergenic
1008868811 6:56247584-56247606 CTCCCGGGCTCCGCCTCCAGGGG - Exonic
1011633766 6:89352362-89352384 CACCCGGCCACCTCGCCCTGCGG + Intronic
1013231439 6:108165062-108165084 CTGGCCGGGTCCACGCCCTGAGG + Intronic
1015799342 6:137044699-137044721 CTCCCGGCCGCCCGGCCCTGCGG - Exonic
1018906693 6:168079839-168079861 CTCAGGGGTTCCAGGCCCTGCGG - Intronic
1019504550 7:1384237-1384259 CGCCCGGGCTCCTCGGCCTCTGG - Intergenic
1019504579 7:1384312-1384334 CGCCCGGGCTCCTCGGCCTCTGG - Intergenic
1019692702 7:2425520-2425542 CTCTGGGGATCCATGCCCTGTGG + Intronic
1019739542 7:2665866-2665888 TTCCCGTGCTCCCCGGCCTGGGG + Intergenic
1024942261 7:54775277-54775299 CACCCAGGTTCCACGCACTGTGG + Intergenic
1027269019 7:76510332-76510354 CTCCCAGTCTCTCCGCCCTGGGG - Intergenic
1033654103 7:143361961-143361983 AGCCCGGGTTCCACGCCCGGAGG - Intronic
1034798282 7:154033180-154033202 CACCAGGGCTCCAGGGCCTGAGG + Intronic
1035512982 8:206468-206490 TTCCCGCGCTCCCCGCCCGGCGG - Intergenic
1035593671 8:837152-837174 CTCCCGGGATCCCCGCCAGGAGG - Intergenic
1036722796 8:11192727-11192749 CTCCCTGGCCCAACTCCCTGAGG + Intronic
1037902449 8:22695599-22695621 CTGCCGGGCTCTACGGCCAGAGG - Intergenic
1038128042 8:24696406-24696428 CTCACGGTCTCCACCTCCTGGGG + Intergenic
1040397201 8:47011269-47011291 CTCACAGGCTCCACACCATGTGG + Intergenic
1048478923 8:134769848-134769870 CTCACAGGCTCAACGCCATGTGG + Intergenic
1049267112 8:141674075-141674097 ATGCCGGGCTCCACACCCGGAGG - Intergenic
1049350341 8:142160928-142160950 CTCCCGCCCGCCATGCCCTGTGG + Intergenic
1049602957 8:143516379-143516401 CCCTCTGGCCCCACGCCCTGAGG + Intronic
1055730813 9:79277865-79277887 CTCCCCGGCCCCGTGCCCTGTGG - Intergenic
1060849332 9:126861089-126861111 CTTCCGGGCCCCTAGCCCTGGGG + Intronic
1062390303 9:136331210-136331232 CTCCCAAGCCCCACGACCTGGGG + Intronic
1062480144 9:136747325-136747347 CTCCCGGGCACCGCGGCCTGGGG - Intronic
1062574381 9:137199673-137199695 CTCCGGGGCTCCTCCTCCTGAGG - Exonic
1186239059 X:7546791-7546813 CCCCCGGGCTCCAACCCTTGTGG - Intergenic
1187419639 X:19122796-19122818 CTCCTGGGCTCCAGGCACTGCGG + Intergenic
1190279317 X:48918878-48918900 CCCCGGGCGTCCACGCCCTGCGG - Exonic
1200287210 X:154834768-154834790 CTACAGGGCCCCACACCCTGAGG + Intergenic
1202604524 Y:26627314-26627336 CTGCTGGCCTCCACACCCTGGGG - Intergenic