ID: 1002559624

View in Genome Browser
Species Human (GRCh38)
Location 5:180072303-180072325
Sequence CTCCCGGGCTCCACGCCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002559624_1002559628 -5 Left 1002559624 5:180072303-180072325 CCGCAGGGCGTGGAGCCCGGGAG 0: 1
1: 0
2: 1
3: 22
4: 227
Right 1002559628 5:180072321-180072343 GGGAGATTTGCGAGGACGTATGG No data
1002559624_1002559629 21 Left 1002559624 5:180072303-180072325 CCGCAGGGCGTGGAGCCCGGGAG 0: 1
1: 0
2: 1
3: 22
4: 227
Right 1002559629 5:180072347-180072369 TGTGTGAGAACAGACTACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002559624 Original CRISPR CTCCCGGGCTCCACGCCCTG CGG (reversed) Intergenic