ID: 1002559737

View in Genome Browser
Species Human (GRCh38)
Location 5:180072907-180072929
Sequence CGCGCGCGCGTTTCGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002559737_1002559740 14 Left 1002559737 5:180072907-180072929 CCACCTTCCGAAACGCGCGCGCG No data
Right 1002559740 5:180072944-180072966 ACTCTCATTTTCTCTCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002559737 Original CRISPR CGCGCGCGCGTTTCGGAAGG TGG (reversed) Intergenic