ID: 1002560268

View in Genome Browser
Species Human (GRCh38)
Location 5:180076917-180076939
Sequence CTGCAGCCACAGCTGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002560268_1002560280 19 Left 1002560268 5:180076917-180076939 CCCACCCCCAGCTGTGGCTGCAG No data
Right 1002560280 5:180076959-180076981 CCAGTCCAACTCCATGGAGCAGG No data
1002560268_1002560277 13 Left 1002560268 5:180076917-180076939 CCCACCCCCAGCTGTGGCTGCAG No data
Right 1002560277 5:180076953-180076975 AGAAACCCAGTCCAACTCCATGG No data
1002560268_1002560282 28 Left 1002560268 5:180076917-180076939 CCCACCCCCAGCTGTGGCTGCAG No data
Right 1002560282 5:180076968-180076990 CTCCATGGAGCAGGCTGTCCAGG No data
1002560268_1002560283 29 Left 1002560268 5:180076917-180076939 CCCACCCCCAGCTGTGGCTGCAG No data
Right 1002560283 5:180076969-180076991 TCCATGGAGCAGGCTGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002560268 Original CRISPR CTGCAGCCACAGCTGGGGGT GGG (reversed) Intergenic
No off target data available for this crispr