ID: 1002564011

View in Genome Browser
Species Human (GRCh38)
Location 5:180100002-180100024
Sequence AGGGCTCTGCCCAGGCCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002564002_1002564011 1 Left 1002564002 5:180099978-180100000 CCAAACTCCTGGGGTTTGGCCCC No data
Right 1002564011 5:180100002-180100024 AGGGCTCTGCCCAGGCCCTGCGG No data
1002563999_1002564011 4 Left 1002563999 5:180099975-180099997 CCCCCAAACTCCTGGGGTTTGGC No data
Right 1002564011 5:180100002-180100024 AGGGCTCTGCCCAGGCCCTGCGG No data
1002563993_1002564011 12 Left 1002563993 5:180099967-180099989 CCTGGAACCCCCCAAACTCCTGG No data
Right 1002564011 5:180100002-180100024 AGGGCTCTGCCCAGGCCCTGCGG No data
1002564000_1002564011 3 Left 1002564000 5:180099976-180099998 CCCCAAACTCCTGGGGTTTGGCC No data
Right 1002564011 5:180100002-180100024 AGGGCTCTGCCCAGGCCCTGCGG No data
1002564005_1002564011 -6 Left 1002564005 5:180099985-180100007 CCTGGGGTTTGGCCCCCAGGGCT No data
Right 1002564011 5:180100002-180100024 AGGGCTCTGCCCAGGCCCTGCGG No data
1002563992_1002564011 18 Left 1002563992 5:180099961-180099983 CCAGCTCCTGGAACCCCCCAAAC No data
Right 1002564011 5:180100002-180100024 AGGGCTCTGCCCAGGCCCTGCGG No data
1002564001_1002564011 2 Left 1002564001 5:180099977-180099999 CCCAAACTCCTGGGGTTTGGCCC No data
Right 1002564011 5:180100002-180100024 AGGGCTCTGCCCAGGCCCTGCGG No data
1002563997_1002564011 5 Left 1002563997 5:180099974-180099996 CCCCCCAAACTCCTGGGGTTTGG No data
Right 1002564011 5:180100002-180100024 AGGGCTCTGCCCAGGCCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002564011 Original CRISPR AGGGCTCTGCCCAGGCCCTG CGG Intergenic
No off target data available for this crispr