ID: 1002564194

View in Genome Browser
Species Human (GRCh38)
Location 5:180100716-180100738
Sequence CTGTAGCCACAGTTCAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 185}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002564194_1002564201 10 Left 1002564194 5:180100716-180100738 CCATGCCTGAACTGTGGCTACAG 0: 1
1: 0
2: 1
3: 21
4: 185
Right 1002564201 5:180100749-180100771 GCTGAGTTGAAAACCTGCCATGG 0: 1
1: 0
2: 1
3: 9
4: 176
1002564194_1002564202 11 Left 1002564194 5:180100716-180100738 CCATGCCTGAACTGTGGCTACAG 0: 1
1: 0
2: 1
3: 21
4: 185
Right 1002564202 5:180100750-180100772 CTGAGTTGAAAACCTGCCATGGG 0: 1
1: 0
2: 1
3: 18
4: 143
1002564194_1002564208 23 Left 1002564194 5:180100716-180100738 CCATGCCTGAACTGTGGCTACAG 0: 1
1: 0
2: 1
3: 21
4: 185
Right 1002564208 5:180100762-180100784 CCTGCCATGGGGTGGACGTGGGG 0: 1
1: 1
2: 1
3: 28
4: 388
1002564194_1002564204 15 Left 1002564194 5:180100716-180100738 CCATGCCTGAACTGTGGCTACAG 0: 1
1: 0
2: 1
3: 21
4: 185
Right 1002564204 5:180100754-180100776 GTTGAAAACCTGCCATGGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 129
1002564194_1002564206 22 Left 1002564194 5:180100716-180100738 CCATGCCTGAACTGTGGCTACAG 0: 1
1: 0
2: 1
3: 21
4: 185
Right 1002564206 5:180100761-180100783 ACCTGCCATGGGGTGGACGTGGG 0: 1
1: 1
2: 0
3: 14
4: 196
1002564194_1002564203 12 Left 1002564194 5:180100716-180100738 CCATGCCTGAACTGTGGCTACAG 0: 1
1: 0
2: 1
3: 21
4: 185
Right 1002564203 5:180100751-180100773 TGAGTTGAAAACCTGCCATGGGG 0: 1
1: 0
2: 1
3: 17
4: 159
1002564194_1002564205 21 Left 1002564194 5:180100716-180100738 CCATGCCTGAACTGTGGCTACAG 0: 1
1: 0
2: 1
3: 21
4: 185
Right 1002564205 5:180100760-180100782 AACCTGCCATGGGGTGGACGTGG 0: 1
1: 0
2: 2
3: 6
4: 149
1002564194_1002564209 26 Left 1002564194 5:180100716-180100738 CCATGCCTGAACTGTGGCTACAG 0: 1
1: 0
2: 1
3: 21
4: 185
Right 1002564209 5:180100765-180100787 GCCATGGGGTGGACGTGGGGTGG 0: 1
1: 0
2: 1
3: 45
4: 454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002564194 Original CRISPR CTGTAGCCACAGTTCAGGCA TGG (reversed) Intergenic
901071343 1:6520369-6520391 CTTTAGCCACTGTTCAGGCTGGG + Intergenic
903646453 1:24898962-24898984 CTGTGGTCCCAGTTCAGCCATGG + Intergenic
904214074 1:28905608-28905630 CTGGAGTCAGAGATCAGGCATGG - Intronic
905235248 1:36542094-36542116 CTGCATCCACAGCTCAGGCAGGG - Intergenic
905268479 1:36771220-36771242 CTGAAGCCACACTACAGGCTGGG + Intergenic
910196212 1:84642268-84642290 CTGTAGCTACAGTTGGGACACGG + Intergenic
912635143 1:111284920-111284942 CTGGAGCCACAGCTCAGCCTTGG + Intergenic
912892696 1:113551714-113551736 CTTTAGCCTCAGTTCTGTCATGG + Intronic
914957280 1:152174151-152174173 CTGGGCCCTCAGTTCAGGCAAGG + Intergenic
914978519 1:152390490-152390512 CTGAAGCCAAATTTCAGGTATGG - Intergenic
916414322 1:164578519-164578541 CTGTCACAACACTTCAGGCATGG - Intronic
916480816 1:165212834-165212856 CTGTGGCCACACTTCCTGCAGGG - Intronic
916859466 1:168787278-168787300 CAGTTACCACATTTCAGGCAGGG - Intergenic
916949613 1:169766183-169766205 CTTTTGCTACAGTTCAGGCTAGG - Intronic
919301798 1:195779593-195779615 GTGGTGCCACAGCTCAGGCAAGG + Intergenic
920689144 1:208132346-208132368 CTGCAGCCACAGGGCAGCCAGGG + Intronic
921268116 1:213442895-213442917 CTCTGGCCACAGTTCAGGAGTGG + Intergenic
921849963 1:219924487-219924509 TTGGAGCCACAGTTCAGGGAAGG - Intronic
921939887 1:220828420-220828442 GTGGAGCCACAGCTGAGGCATGG - Intergenic
922216524 1:223524447-223524469 ATGTAGCTACTGGTCAGGCATGG - Intergenic
923593055 1:235337704-235337726 CTGTAGTCCCAGCTGAGGCACGG + Intronic
1062902418 10:1156278-1156300 CTGTATCCCCAGTGCAGGCTAGG + Intergenic
1066602834 10:37126017-37126039 CTGCAGCCCCGGCTCAGGCAGGG - Intronic
1067317288 10:45180627-45180649 CTGCAGCCCCAGCTCAGGCAGGG - Intergenic
1067318723 10:45198075-45198097 CTGCAGCCCCGGCTCAGGCAGGG + Intergenic
1067836279 10:49643752-49643774 CTGTGGACCCAGTTCAGACAGGG - Intronic
1068367433 10:56068716-56068738 CTGCCAGCACAGTTCAGGCACGG + Intergenic
1073068765 10:100780358-100780380 CTGTAGCCATAGATGAGGCCCGG + Intronic
1073121444 10:101124684-101124706 CTTCAGCCACAGTTCAGGATTGG + Intronic
1073140652 10:101245254-101245276 GTATTGCCACAGTTCAGGTAAGG + Intergenic
1075471811 10:122696743-122696765 GTGCAGCCACAGGGCAGGCATGG - Intergenic
1076514318 10:131034625-131034647 CTGTAGCCCCAGCTCAGCCCTGG - Intergenic
1076746630 10:132517835-132517857 CTGTACCCACTGCTCACGCAGGG + Intergenic
1076852442 10:133099690-133099712 CTGTAGCCACAGCTCCGGGGCGG + Intronic
1077196090 11:1280882-1280904 CTGAAGGGACAGTGCAGGCAGGG + Intronic
1077391207 11:2301394-2301416 CTGCGGCCCCAGTACAGGCAGGG - Intronic
1077981862 11:7308967-7308989 TTGCAGCCATAGTTCAGGAAAGG - Intronic
1078191239 11:9093812-9093834 CTTTAGCCTCAGTCCAGGGACGG - Intronic
1084950749 11:72664111-72664133 CTGCAGCCACAGCTCCTGCAGGG + Intronic
1090463087 11:126909391-126909413 CTGTAGCTCCACCTCAGGCACGG + Intronic
1091972217 12:4797030-4797052 CAGTAGCCAGAGTCCAGGGAAGG - Intronic
1095245286 12:39912556-39912578 CAGTAGCCACAGATTAGGGATGG + Intronic
1095379074 12:41567563-41567585 CTGTAGTCCCATTTCAGGAAAGG + Intronic
1097181111 12:57172536-57172558 CTGGAGGCACACTCCAGGCAAGG - Intronic
1099170437 12:79357630-79357652 GTGTAACCACATTTCAGTCAAGG - Intronic
1099560905 12:84173470-84173492 CAGTTGCCACATTGCAGGCAAGG - Intergenic
1100726689 12:97416594-97416616 CTGTAGCCACATTCCATGCAGGG - Intergenic
1102028652 12:109727563-109727585 CTCCAGCCACCCTTCAGGCAAGG + Intronic
1102199544 12:111047932-111047954 GTGCAGGCACAGTTCAGGCAGGG + Intronic
1102901961 12:116645965-116645987 CAGAAGCCACTGTTCAAGCAGGG + Intergenic
1104475887 12:129069949-129069971 CTGTAGCCGGAGTCCAGGGAGGG + Intergenic
1105223839 13:18409079-18409101 CTGCAGCCCCGGCTCAGGCAGGG - Intergenic
1105776634 13:23668061-23668083 CTGCAGCCAGTCTTCAGGCAAGG + Exonic
1105993669 13:25649338-25649360 CAGTAGCCTCAGATCAGGCCAGG + Intronic
1106209870 13:27631963-27631985 CTGAAGCCACAGGATAGGCATGG - Intronic
1106234601 13:27851363-27851385 CTGTGACGACAGTTCAGGGAGGG - Intergenic
1108490368 13:50975541-50975563 TTCTACCCACAGTTTAGGCACGG - Intergenic
1113238653 13:108312313-108312335 CTGTAGCCATAATCCAGGCAAGG + Intergenic
1114655542 14:24313343-24313365 CTGAAGTCAGAGTTCAGGAAGGG - Exonic
1116705406 14:48291235-48291257 CTGCAGCCAGCGTTCAGACATGG + Intergenic
1117543314 14:56769679-56769701 CTGTAGCCAGAGATGAGGCCAGG - Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119893612 14:78201505-78201527 CCGTAGACACTGTTCAGGCATGG + Intergenic
1121787983 14:96677102-96677124 CTGCACCCTCAGGTCAGGCAAGG + Intergenic
1122133284 14:99618559-99618581 CTGTACGCACAGTTCAGGGCTGG - Intergenic
1122147744 14:99703294-99703316 CTGTAGCAAGAGTTCTGGCAAGG - Intronic
1122701007 14:103589142-103589164 CTGTTGCCACAGGGAAGGCAGGG - Intronic
1122863564 14:104593462-104593484 ATTTAGGCACAGTGCAGGCAGGG - Exonic
1125577652 15:40766393-40766415 CAGTAGTCACAGTTTAGACATGG - Exonic
1129590528 15:76911025-76911047 CTGTTGCCAAAGTTCAGGAAAGG - Intergenic
1130666444 15:85873659-85873681 CTGCAGACACAATACAGGCAGGG + Intergenic
1138636650 16:58344723-58344745 CTGTAACCACAGGACAGGAAGGG + Intronic
1139403488 16:66699984-66700006 CACTAGGCACAGTTCAGGGAAGG + Intergenic
1141024124 16:80528046-80528068 CTGTAGGCACCGTGCAAGCAAGG + Intergenic
1141538695 16:84700780-84700802 CTTTAGCTACTGTTCAGGCAGGG - Intronic
1143663056 17:8339150-8339172 CTGGAGCCACAGGCCAGGCAAGG + Intergenic
1145939258 17:28733921-28733943 CTCCAGCCACATATCAGGCAGGG - Intronic
1147342210 17:39759777-39759799 CTATATCCAGAGTTCAGACAAGG - Intergenic
1147364748 17:39952656-39952678 CTGAACCCACAGTTCAGTCCGGG + Intergenic
1147445652 17:40473814-40473836 CTGTAGCCTGAGAGCAGGCAGGG + Intergenic
1149367745 17:55962810-55962832 TAATAGCCACTGTTCAGGCAGGG - Intergenic
1151151255 17:72089362-72089384 CTGCAGCCACAGCCCAGGAACGG + Intergenic
1151724670 17:75877230-75877252 CTGCATCCACAGTCCAGGCCTGG + Intronic
1153034926 18:752431-752453 CTGTAGCAACATCTCAGGCTTGG + Intronic
1153914435 18:9733391-9733413 CTGGAGCCACACTGCAGTCAGGG - Intronic
1154475266 18:14748649-14748671 CTGCAGCCCCGGCTCAGGCAGGG - Intronic
1154529466 18:15330035-15330057 CTGCAGCCCCGGCTCAGGCAGGG + Intergenic
1155120843 18:22816926-22816948 CTGCAGCCACAATTCGGGCAGGG + Intronic
1159232468 18:65627223-65627245 CTGTAGACACAGTGCATCCATGG + Intergenic
1162477216 19:10907840-10907862 CAGTCACCACAGTGCAGGCATGG + Intronic
1163114712 19:15181777-15181799 CACGAGCCACCGTTCAGGCATGG + Exonic
1163271349 19:16256098-16256120 CTGAAGCCACGGGGCAGGCAGGG + Intergenic
1164431160 19:28190014-28190036 GAGTAGCCACGGGTCAGGCATGG + Intergenic
1166864048 19:45825597-45825619 CTGAGGCCACAGGGCAGGCATGG - Intronic
1167529981 19:50009107-50009129 CTGGAGTCAGAGTCCAGGCAGGG + Intronic
925287856 2:2727503-2727525 CTGCAGCAACAGTGTAGGCATGG - Intergenic
927662726 2:25006461-25006483 CTGCAACCCCAATTCAGGCAAGG + Intergenic
927895919 2:26781818-26781840 CTGCAGCCAGAGGCCAGGCATGG + Intronic
927981688 2:27378541-27378563 CGGAAGCCACAGGTCGGGCAGGG + Exonic
929174853 2:38966273-38966295 CAGTAGCCACAGTTCCGGCGGGG + Intronic
929639920 2:43567717-43567739 CTGTAGCCACAATATATGCAGGG + Intronic
930683977 2:54288056-54288078 CTGTAGCCACAATTTAGAGAGGG + Intronic
932886106 2:75550488-75550510 CTGAAGCTCCACTTCAGGCATGG - Intronic
933710758 2:85324130-85324152 ATGTAGACACAGGCCAGGCACGG + Intronic
933987771 2:87606889-87606911 CTTTGGCCAAAGTTCAGGAAAGG + Intergenic
934995699 2:98957041-98957063 CAATAGCCATAGTTCATGCAAGG + Intergenic
935785134 2:106541883-106541905 CTGTATCCAGAGCCCAGGCATGG + Intergenic
936306070 2:111343919-111343941 CTTTGGCCAAAGTTCAGGAAAGG - Intergenic
938444527 2:131366924-131366946 CTGGAGCCACAGGCCAGGCTGGG - Intergenic
938528564 2:132161457-132161479 CTGCAGCCCCGGCTCAGGCAGGG + Intronic
943652264 2:190469891-190469913 TTTTAGCCACAGCTCAGGGAAGG - Intronic
945060287 2:205903023-205903045 CTGTAGTTATACTTCAGGCATGG + Intergenic
948807062 2:240457596-240457618 CTGTAGCCCCACTGCAGGCAGGG - Intronic
1170280723 20:14644737-14644759 GTGTAGCCAGAGTTCAGGCAAGG - Intronic
1170579687 20:17688726-17688748 ATGAATCCACAGTTCAGACAGGG - Intergenic
1172745422 20:37204032-37204054 CTGTAGTAACAGATCATGCATGG - Intronic
1173003397 20:39121760-39121782 CTGTACCCACTGCTCAGGCCAGG - Intergenic
1174263298 20:49313177-49313199 CTGTAGCCAAAGTCATGGCAAGG - Intergenic
1174739471 20:52998119-52998141 AAGAAACCACAGTTCAGGCAAGG - Intronic
1176767932 21:13038433-13038455 CTGCAGCCCCGGCTCAGGCAGGG - Intergenic
1178439607 21:32587427-32587449 CCTTAGCCGCATTTCAGGCATGG + Intronic
1178635080 21:34295319-34295341 CTGGAGCCACAGTTCTTCCAGGG - Intergenic
1179941478 21:44641419-44641441 CAGTGACCCCAGTTCAGGCAAGG + Intronic
1180207381 21:46269600-46269622 CTGGAGCCACAGATCAACCAAGG + Intronic
1180591024 22:16937474-16937496 CAGTGGCCACAGTTCAGCCTTGG + Intergenic
1181473405 22:23154319-23154341 CTGAAGGCTCAGTCCAGGCAGGG - Intronic
1182410003 22:30176702-30176724 CTGGGGCCAGAGTTGAGGCAGGG - Exonic
1184413439 22:44338668-44338690 CTGTAGCCACAGGGAAGCCATGG - Intergenic
949543879 3:5055476-5055498 CTGTAGCCACAGAAGAGGAAGGG - Intergenic
950628388 3:14265151-14265173 ATGAATCCACAGTTCAGGCAGGG - Intergenic
952276440 3:31881925-31881947 CTGTGTCCAAAGTTCAGGCTCGG + Intronic
953896221 3:46804877-46804899 CTGTAGTTACACTTCAAGCATGG - Intronic
954107363 3:48416452-48416474 CTGTAGGCACAGGGCAGGCTAGG + Intronic
954380019 3:50214379-50214401 CTGTAGGCACAGGTCAGGGTGGG - Intronic
955376334 3:58400408-58400430 ATGTAGCCAGAGTTCAGAGAAGG + Intronic
955548468 3:60057327-60057349 CTGAAGCAACAGACCAGGCAGGG - Intronic
955748259 3:62161702-62161724 CTGTAGCCACAGGAGGGGCATGG + Intronic
959261933 3:104093285-104093307 TTGTAGCAACAGGTCAGTCAGGG + Intergenic
960885754 3:122392606-122392628 CTGCATCCACAGTTCTGGAATGG - Intronic
961662532 3:128477321-128477343 CTGTTGCCACAGTGAGGGCAGGG - Intergenic
961899461 3:130196877-130196899 CTGCAGCCACAGTCCAGAAATGG + Intergenic
962275313 3:134008887-134008909 CTGTTGTCACAGTTGAGTCATGG - Intronic
962349295 3:134644932-134644954 CTGGAGCCCCAGATCAGGCGAGG + Intronic
963919818 3:150894539-150894561 CTGTAGACACAGAGCAGCCACGG - Intronic
965492405 3:169354791-169354813 CTGAAGCCCCAGCTCAGGAAGGG - Intronic
966801535 3:183768626-183768648 CTGTAGCCACAGAGCAGGGCAGG - Intronic
968291349 3:197542123-197542145 CTCCAGCCTCAGTCCAGGCAGGG - Intronic
969152894 4:5185657-5185679 CTATAGCAACAGTTCAGGCTAGG - Intronic
970005323 4:11405357-11405379 CAGTAGCCACATGCCAGGCATGG + Intronic
970286505 4:14522738-14522760 CTATATTCACAGTTTAGGCAGGG + Intergenic
971392318 4:26197698-26197720 CTGGAGGAACAGTTCAGGCCAGG - Intronic
976212476 4:82685378-82685400 CTGTAGCCCAAGTTCAATCAAGG - Intronic
977662851 4:99610857-99610879 TAGTAGACACATTTCAGGCATGG - Intronic
979106318 4:116692942-116692964 TTGTAGCCACTGCTGAGGCATGG + Intergenic
981786039 4:148480765-148480787 CTGAAGGCTCAGCTCAGGCAAGG - Intergenic
984879086 4:184394778-184394800 CTGATGCCACAGATCAGGCAAGG + Intronic
987720194 5:21623556-21623578 TTGTAGGTAAAGTTCAGGCAAGG + Intergenic
991422948 5:66460011-66460033 CTGAGGCCACAGTTCATGGAAGG - Intergenic
993869896 5:93240284-93240306 CTGTAACCACAGTTTAGGTGGGG + Intergenic
994691354 5:103023693-103023715 CTTTAGCCATAGTACAGGGAAGG + Intronic
998222918 5:140302666-140302688 CGGATGCCACAGCTCAGGCAAGG + Intronic
999362795 5:150999892-150999914 CTGCAGCCTCAATCCAGGCAAGG + Intergenic
1000047792 5:157535827-157535849 CTGTACCCACAGCTCAAGAATGG - Intronic
1001317359 5:170653269-170653291 CTGAAGCCTCAGTCCAGCCAGGG - Intronic
1002564194 5:180100716-180100738 CTGTAGCCACAGTTCAGGCATGG - Intergenic
1003065303 6:2900018-2900040 CTGTACCAACAGCTCAGGGAGGG - Intronic
1005154548 6:22789481-22789503 GTCTGGCCACAGTTCAGGAATGG + Intergenic
1008873273 6:56298200-56298222 ATGTGGCCACAGTTCAGGAGAGG + Intronic
1010196181 6:73242024-73242046 CTAAAACCACAGTTCAGCCAAGG + Intronic
1012990605 6:105922131-105922153 CTGTAGCCACAGAAAAGTCAAGG + Intergenic
1014330238 6:120055407-120055429 CTGTCATCTCAGTTCAGGCACGG - Intergenic
1018185868 6:161264905-161264927 CTGAAGCCTAACTTCAGGCAGGG + Intronic
1020890397 7:13870902-13870924 CCTCAGCTACAGTTCAGGCAGGG - Intergenic
1022260104 7:28695689-28695711 GTGTAGCCAGGGCTCAGGCATGG - Intronic
1026963699 7:74425919-74425941 ATGAAGCCACAGTCCAGGGAGGG + Intergenic
1028255165 7:88586405-88586427 CTGTAACCACAAGTCAGTCATGG + Intergenic
1030048513 7:105518644-105518666 CTGTAATCCCAGTTGAGGCAGGG - Intronic
1035157722 7:156927928-156927950 CTCCAGGCACAGATCAGGCATGG - Intergenic
1035485665 7:159223213-159223235 CAGTAGGCACAGTTAGGGCAGGG + Intergenic
1035901532 8:3462302-3462324 CTGTAGCATCATTTAAGGCAAGG + Intronic
1036224074 8:6943565-6943587 CTGTGGCCCCAGTTAAGACATGG + Intergenic
1036760424 8:11504885-11504907 CTGTGGCCATGTTTCAGGCAAGG + Intronic
1037516633 8:19638269-19638291 CAGCAGACACAGTTGAGGCAGGG - Intronic
1041081127 8:54215876-54215898 CCGGAGCCCCAGCTCAGGCAGGG - Intergenic
1043110429 8:76172921-76172943 GTGTAGCCACAGGAGAGGCAGGG - Intergenic
1043774410 8:84246739-84246761 CTGTTGCCACAGTCCAGGTGTGG + Intronic
1046554814 8:115761612-115761634 CTGCAGCCACTGTTGTGGCACGG + Intronic
1047478183 8:125255868-125255890 CCGTTGCAGCAGTTCAGGCAAGG + Intronic
1048216341 8:132499025-132499047 GTTTAGACACAGTTCAGGGATGG - Intergenic
1049168519 8:141142189-141142211 CTGTAGCCCAAGTTCAGACATGG + Intronic
1049587906 8:143440484-143440506 CTGGAGGCACAGGTCAGGCCTGG + Intronic
1049980999 9:903577-903599 CTGGAGCCAAAGCTCAGGGAGGG + Intronic
1053095482 9:35323812-35323834 CTGTAGAAACAGGTTAGGCAAGG - Intronic
1053232339 9:36421058-36421080 ATGGAACCACAGTTCAGGCAAGG - Intronic
1053275691 9:36781613-36781635 TTGTCGCCACAGTTCCGGGATGG - Intergenic
1053707181 9:40767797-40767819 CTGCAGCCCCGGCTCAGGCACGG + Intergenic
1054417094 9:64888565-64888587 CTGCAGCCCCGGCTCAGGCACGG + Intergenic
1060859069 9:126939029-126939051 CTGTAGGTACAGCTCAGCCAAGG - Intronic
1187026039 X:15436437-15436459 CTGTAACCCAAATTCAGGCAAGG - Intronic
1187233024 X:17440708-17440730 CTCTGGCCTCAGTTCAGGAAGGG + Intronic
1192140373 X:68642328-68642350 CTTACACCACAGTTCAGGCAGGG - Intergenic
1192367862 X:70489730-70489752 CTGTTGCCAAAGGTCAAGCATGG + Intronic
1193583608 X:83294251-83294273 CTCTAGCCACAGGTGAGGCCTGG + Intergenic
1194942979 X:100034630-100034652 CTGTTTCCACAATTCAGTCATGG + Intergenic
1195777839 X:108427252-108427274 CTGTAGCCAGAGCACAGGGAAGG - Intronic
1199853605 X:151742222-151742244 CTGTTGCCCTAGGTCAGGCATGG + Intronic
1200087003 X:153611832-153611854 CTGTGTCCACAGCTCTGGCAGGG + Intergenic
1200897006 Y:8386330-8386352 CTGGAGGCACAGTACAGGCAGGG + Intergenic