ID: 1002566017

View in Genome Browser
Species Human (GRCh38)
Location 5:180113287-180113309
Sequence CAGGATGGACGGAGGGACCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002566008_1002566017 -2 Left 1002566008 5:180113266-180113288 CCGAGGATGGACGGAGGGATCCA 0: 1
1: 1
2: 8
3: 19
4: 139
Right 1002566017 5:180113287-180113309 CAGGATGGACGGAGGGACCGGGG No data
1002566002_1002566017 17 Left 1002566002 5:180113247-180113269 CCGAGGATGGACGGAGGGACCGA 0: 2
1: 3
2: 13
3: 20
4: 92
Right 1002566017 5:180113287-180113309 CAGGATGGACGGAGGGACCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002566017 Original CRISPR CAGGATGGACGGAGGGACCG GGG Intronic
No off target data available for this crispr