ID: 1002566186

View in Genome Browser
Species Human (GRCh38)
Location 5:180113725-180113747
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 3, 1: 5, 2: 14, 3: 31, 4: 244}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900190116 1:1349615-1349637 CGGGTCGGGCGGAGGGACCCCGG + Intergenic
900987149 1:6079703-6079725 GGGGCTGGAGGCAGGGAGCGGGG + Intronic
901700503 1:11042686-11042708 CTGGCTGGAGGGAGGGACAGCGG + Intronic
902250886 1:15153713-15153735 CGTGCGGGAGGGAGGGACCGCGG - Intronic
902479068 1:16702229-16702251 AGGGCTGGAAGGAGGGAGGGAGG - Intergenic
903376636 1:22870495-22870517 GGGGCAGGAGGGAGGGACAGAGG + Intronic
904498878 1:30902710-30902732 TGGGCAGGACCGAGGGACTGTGG - Intronic
905035050 1:34912767-34912789 AGGGCTGGACAGAGAAACCGAGG - Intronic
905617197 1:39409206-39409228 CGGGGAGGACGGCGGGGCCGCGG + Intronic
907237524 1:53062327-53062349 CGGGGTGGGCCGAGGGGCCGGGG + Intronic
914200037 1:145476208-145476230 GGGGCTGGAGGGCGGGAGCGGGG + Intergenic
914479155 1:148049343-148049365 GGGGCTGGAGGGCGGGAGCGGGG + Intergenic
914883270 1:151564379-151564401 CAGGATGGAGGGAGGGACCTTGG - Intronic
915355883 1:155255054-155255076 GGGGCGTCACGGAGGGACCGCGG + Exonic
918066521 1:181105360-181105382 CGGGCTGGAGGGCGGGGGCGGGG + Intergenic
919857354 1:201714869-201714891 CCGGCTTAACGGAGGGACTGGGG - Intronic
919935250 1:202246420-202246442 AGGGATGGATGGAGGGACAGGGG - Intronic
921181697 1:212636590-212636612 CAAGCTGGAAGGAGGGACCCTGG - Intergenic
1062822959 10:548437-548459 CGGGATGGAGGGAGGGAGGGAGG + Intronic
1064121456 10:12623180-12623202 AGGGAGGGACGGAGGGACGGAGG - Intronic
1066236517 10:33490154-33490176 CAGGGTGGAGGGAGGGACGGAGG + Intergenic
1067293270 10:44959657-44959679 GGGGCGGGACGGAGAGACCGGGG + Intronic
1073097178 10:100987050-100987072 CGGGCTGGAGGGCGGGATCAGGG - Intronic
1074869870 10:117568061-117568083 AGGGCTGGACAGAGGGCCCTAGG + Intergenic
1076546886 10:131251307-131251329 TGGGCTGGGAGGAGGGGCCGGGG - Intronic
1076694186 10:132239236-132239258 CCGGCTGGACCGAGGGCCCCAGG - Intronic
1076878781 10:133230182-133230204 CGGCTGGGACGGAGGGACGGCGG + Intergenic
1077247921 11:1548143-1548165 GGGGCTTGACGGAGGGAGTGGGG + Intergenic
1077554853 11:3220962-3220984 CTGGCTGGACGGAGGGCACCCGG + Intergenic
1077811389 11:5641483-5641505 AGGGCTGGATGCAGGGACAGAGG - Intronic
1077898802 11:6473939-6473961 CAGGCCGGAGGGAGGGGCCGGGG + Intronic
1082024995 11:47565418-47565440 CGGCCTCGGAGGAGGGACCGAGG - Intronic
1082935921 11:58656588-58656610 GGGGCTGGAGGGAGGGAATGCGG - Intronic
1083876186 11:65525406-65525428 CGTGGCGGGCGGAGGGACCGAGG + Intronic
1083922259 11:65787279-65787301 CGGGCTGAACGCCGGGAACGGGG - Exonic
1084128952 11:67118980-67119002 CGGGCTGGCGGGAGGGAGGGAGG + Intergenic
1085050325 11:73376879-73376901 CGGGCTGGACGGCGGCGCCTCGG + Intronic
1085474851 11:76783332-76783354 AGCGCTGGCCGGAGGGCCCGCGG + Intronic
1088823498 11:113475325-113475347 CGGGCGGGCAGGAGGGAGCGCGG + Exonic
1091446503 12:546746-546768 CGGGCTCCACCGAGGCACCGAGG - Intronic
1091916291 12:4273532-4273554 AGGGCTGGATGGAGGGAGAGGGG + Intergenic
1096221002 12:49828140-49828162 GCGGCTGGAGGGAGGGACGGAGG + Intronic
1096413194 12:51391663-51391685 CGGCCGGGAGGGTGGGACCGGGG + Intronic
1096460722 12:51820404-51820426 CGGCGGGGACGGAGGGACTGCGG + Intergenic
1096693026 12:53332854-53332876 CGGGCTGGGCAGAGGGAGAGGGG - Intronic
1097046188 12:56189295-56189317 GGGGCGGGACAAAGGGACCGCGG - Intronic
1097921979 12:65085727-65085749 TGGGCTGGACTGAGGGAGTGAGG + Intronic
1098973491 12:76878984-76879006 TGGGCTGGAGGGAGGGTCCAGGG + Exonic
1102031165 12:109740989-109741011 CTGGCTGGAAGGAGGGCCAGGGG + Intronic
1102887644 12:116533837-116533859 GGGGCGGGGCGGAGGGAGCGAGG + Intergenic
1104940279 12:132391972-132391994 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940318 12:132392058-132392080 CGGGGTGGCCGGAGGGTCCCTGG - Intergenic
1104940343 12:132392115-132392137 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940370 12:132392172-132392194 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940396 12:132392229-132392251 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940423 12:132392286-132392308 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940450 12:132392343-132392365 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940477 12:132392400-132392422 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940504 12:132392457-132392479 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940543 12:132392543-132392565 CAGGGTGGCCGGAGGGTCCGGGG - Intergenic
1104945772 12:132414330-132414352 CGGGCTGCAGGGAGGGCCCTTGG - Intergenic
1104966003 12:132509097-132509119 CGGGCTGGACGGGGGTTCCGCGG + Intronic
1105512449 13:21061659-21061681 GGGGCTGGGCGGAGCGGCCGCGG - Intergenic
1106252366 13:27992200-27992222 CGGGCTGGCCTGTGGGACCAGGG + Intergenic
1108332677 13:49405752-49405774 AGGGAGGGACGGAGGGACAGAGG + Intronic
1112490493 13:99858988-99859010 CAGGCTGGAAGGAAGGACCCGGG - Exonic
1112506830 13:99980751-99980773 CGAGCTGGAGGGAGGGAGGGAGG + Intergenic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1115636276 14:35292715-35292737 CCGTCTGGACGCAGGGATCGGGG + Intronic
1117513164 14:56473004-56473026 CAGGCTGGATGGAAGGACTGTGG + Intergenic
1119759489 14:77140973-77140995 CAGCCTGGACGGAGGCCCCGTGG - Intronic
1122081483 14:99270606-99270628 TGGGCCGGGCGCAGGGACCGGGG + Intronic
1122092776 14:99350969-99350991 CTGTCTGGACAGAGGGCCCGTGG + Intergenic
1122130979 14:99604404-99604426 CGGCCGGGAGGGCGGGACCGCGG - Intergenic
1122354014 14:101112692-101112714 CGGCCTGGAGGGAGGGCCCCCGG + Intergenic
1122550610 14:102547195-102547217 AGGGAGGGACGGAGGGACGGAGG + Intergenic
1122890858 14:104731643-104731665 CCGGCTGGACGTGGGGACCCTGG + Intronic
1124208680 15:27744382-27744404 TGGGCTGGATGGGGGAACCGTGG + Intergenic
1125557068 15:40594625-40594647 CCGGGTGGCCGGAGGGGCCGAGG - Intronic
1127426837 15:58865817-58865839 CGGGCTGGCCTGAGGGCCCCAGG + Intronic
1129294459 15:74592228-74592250 CGGGCTGGACAGTGGGACTCAGG + Intronic
1130282922 15:82533038-82533060 CTGGCTGGACGCAGGTACCAGGG - Intergenic
1130610332 15:85355173-85355195 AGGGAGGGACGGAGGGACGGAGG - Intergenic
1132527782 16:426068-426090 CGGGCGGGCCGGACGGGCCGGGG + Exonic
1132566408 16:625545-625567 CAGGCTGGATGGAGGTACCTGGG + Intronic
1132583246 16:694789-694811 CGGGGGGGACGGAGGAACCCCGG - Intronic
1132828938 16:1918287-1918309 CGGCCTGGGCGGCGGGGCCGGGG - Exonic
1132915352 16:2340826-2340848 TGGGCTGGCCGGAGCGGCCGAGG - Intergenic
1135303490 16:21350202-21350224 CGTGCTGTACTGAGTGACCGTGG + Intergenic
1136716401 16:32286904-32286926 CGGGCAAGACGGAGGGGACGGGG - Intergenic
1136834787 16:33493182-33493204 CGGGCAAGACGGAGGGGACGGGG - Intergenic
1138413614 16:56858634-56858656 CGGGCCGGACGCAAGGACCTGGG + Intergenic
1142156190 16:88533824-88533846 CGGGCTGGCCGGGGGGCGCGCGG - Exonic
1142228705 16:88889402-88889424 GGGGCGGGAGGGAGGGAGCGAGG + Intronic
1142356225 16:89603473-89603495 GGGGCTGGAGGGAGGCACTGGGG + Intergenic
1203010016 16_KI270728v1_random:230850-230872 CGGGCAAGACGGAGGGGACGGGG + Intergenic
1142805550 17:2369484-2369506 CAGGCTGGACGGGGGGAGGGGGG - Intronic
1143446451 17:7012846-7012868 CAGGCAGGCCGGAGGGGCCGGGG + Intronic
1143668863 17:8382964-8382986 GGAGATGGATGGAGGGACCGGGG - Exonic
1143751588 17:9032139-9032161 CGGGGTGCAGGGAGGGGCCGAGG + Intronic
1144548009 17:16215537-16215559 CGGGCTGGGGGGAGGGAGAGGGG - Exonic
1144781098 17:17809084-17809106 CGGGAGGGAGGGAGGGACTGAGG + Intronic
1145274859 17:21423232-21423254 AGGCCTGGCTGGAGGGACCGGGG + Intergenic
1145312711 17:21709131-21709153 AGGCCTGGCTGGAGGGACCGGGG + Intergenic
1147168207 17:38604496-38604518 GAGGCTGGACCGAGGGACCCTGG - Intronic
1148125877 17:45236517-45236539 AGGGCTGGCCGGAGGGCCAGGGG + Intronic
1148862582 17:50612386-50612408 CCAGATGGAGGGAGGGACCGGGG + Intronic
1150136285 17:62697055-62697077 CAGGCTGGAGGGAGGGAGGGCGG + Intergenic
1151696728 17:75721709-75721731 CAGCGTGGACAGAGGGACCGGGG - Intronic
1151874107 17:76856784-76856806 CGGGCTGGGCTTAGGGACTGGGG + Intergenic
1152870621 17:82751548-82751570 CGGGTGGGACCGGGGGACCGCGG - Intergenic
1152912409 17:83012911-83012933 CGGGTGGGACGGGGGGCCCGGGG - Intronic
1154169245 18:12038696-12038718 CGGGCTGGACTGAGGGGCTGGGG + Intergenic
1155493184 18:26419412-26419434 CCGGCTGCAGGGAGGGACCCTGG + Intergenic
1159512647 18:69416107-69416129 AGGGATGGAGGGAGGGACGGAGG + Intronic
1159516541 18:69466167-69466189 AGGGCTGGAGGGAGGGGCGGAGG - Intronic
1160014843 18:75132774-75132796 CGGGCTGGCCCTGGGGACCGCGG + Intergenic
1161012462 19:1967333-1967355 CCGGCAGGACGTAGGGGCCGCGG - Intronic
1161329311 19:3678732-3678754 CAGGATGGAGGGAGGGACAGAGG + Intronic
1161808901 19:6460246-6460268 CGGGCGGGAAGAAGGGACAGTGG - Intronic
1161895241 19:7074947-7074969 CGGGCTGGAGGGGGTGACCGAGG + Intronic
1162419860 19:10559911-10559933 CCAGCTGGACTGGGGGACCGTGG + Exonic
1162572446 19:11481004-11481026 CGGGCCGGAGGGAGGGAGGGAGG - Exonic
1162940440 19:14006046-14006068 CGGGGTGGGCGGCGGGGCCGGGG - Intronic
1163288149 19:16362111-16362133 CAGGCTGGACGGGGGTACCCTGG + Intronic
1163421868 19:17218145-17218167 TAGGCTGGAGGGAGGGACCTGGG + Intronic
1163427206 19:17246064-17246086 CGGGCCGGCGGGAGGGACGGGGG + Intronic
1163481549 19:17559515-17559537 TGGGCTGGAGGCAGGGACTGAGG - Intronic
1163507992 19:17719623-17719645 CGGGCTGGCCTGGGGGCCCGCGG + Intronic
1163596184 19:18222263-18222285 AGGGCTGGACTGAGGGTCCAGGG + Exonic
1164089892 19:21940640-21940662 CGGGGAGGACAGAGGGACCCAGG - Intronic
1164222053 19:23203827-23203849 CGGGAAGGACAGAGGGACCCAGG - Intergenic
1164753154 19:30670784-30670806 CGGGCTGAAGGGATGGACCCGGG - Intronic
1165119911 19:33552324-33552346 CAGGCTGGAAGGAGGGAGAGGGG - Intergenic
1168503814 19:56916067-56916089 TGGGCTGGACGGAGTGAGTGTGG + Intergenic
1168580114 19:57548193-57548215 CAGGCTGGACCGGGGGACAGAGG + Intronic
1202713109 1_KI270714v1_random:28136-28158 AGGGCTGGAAGGAGGGAGGGAGG - Intergenic
926229073 2:10989290-10989312 TGGGCTGGACAGATGGACCAAGG - Intergenic
928249208 2:29660157-29660179 CATGCTGGACAGAGGGACTGTGG - Intronic
929501563 2:42494571-42494593 CGGGCTGGCAGGCGGCACCGAGG - Exonic
929793873 2:45043528-45043550 AGGGAGGGACGGAGGGACAGAGG - Intergenic
931241769 2:60460778-60460800 GGAGCTGGACGGAGGGATCTCGG - Exonic
932616226 2:73233279-73233301 CGGGCTGGACGACGGGAACGAGG + Intergenic
933688820 2:85163444-85163466 CGGGCAGGAGGGATGGTCCGAGG - Intronic
934880456 2:97972469-97972491 CGGGCGGGAGGGAGGGAAGGCGG + Intronic
935706498 2:105861920-105861942 CGGGCAGGAGGGAGGGAGGGAGG - Intronic
937308516 2:120886938-120886960 AGGGCTGGACGGAGAGATCCAGG + Intronic
938823712 2:134983611-134983633 AGGGGTGGAGGGAGGGACTGTGG + Intronic
941579731 2:167280088-167280110 TAGGCTGGACGGAGGGACAATGG + Intergenic
944060132 2:195563267-195563289 CGGGGGGGGCGGAGGGGCCGGGG - Intergenic
947156046 2:227164144-227164166 CGGGCTGGAGGCGGGGAACGCGG + Intergenic
948650401 2:239440115-239440137 TGGGGTGGAGGGAGGGGCCGTGG - Intergenic
948805890 2:240453358-240453380 CGGGGCGGGCGGAGGGAGCGGGG - Intronic
948805898 2:240453376-240453398 CGGGGCGGGCGGAGGGAGCGGGG - Intronic
948805906 2:240453394-240453416 CGGGGCGGGCGGAGGGAGCGGGG - Intronic
948805914 2:240453412-240453434 CGGGGCGGGCGGAGGGAGCGGGG - Intronic
948805922 2:240453430-240453452 CGGGGCGGGCGGAGGGAGCGGGG - Intronic
1168750606 20:278937-278959 AGGGCGGGACGGAGGGAGGGAGG + Intronic
1168750615 20:278957-278979 AGGGCGGGACGGAGGGAGGGAGG + Intronic
1168750635 20:279005-279027 AGGGCGGGACGGAGGGACGGAGG + Intronic
1168750655 20:279049-279071 AGGGCGGGACGGAGGGAGGGAGG + Intronic
1168750670 20:279085-279107 AGGGCGGGACGGAGGGACGGAGG + Intronic
1170677608 20:18497015-18497037 CAGCCTGGAGGGAGGGACGGCGG - Intronic
1170889538 20:20366798-20366820 CGTGCTGGACGGGGGGAGGGGGG - Intergenic
1171784131 20:29447938-29447960 ACGGATGGACGGAGGGACCTTGG - Intergenic
1171813412 20:29763065-29763087 CGGGAGGGACGGAGGGAAAGAGG + Intergenic
1172488402 20:35314403-35314425 GGTGCTGGATGGAGGGACAGAGG - Intronic
1172890565 20:38260876-38260898 GGGGGTGGACGGAGGGAAGGGGG - Intronic
1174612197 20:51807142-51807164 GGGGCTGGAGGGAGGGAGAGTGG + Intergenic
1175349922 20:58310132-58310154 CGAGCTGGAGGGAGGGTCCACGG - Intronic
1175561543 20:59934107-59934129 CGAGCTGGACCGGGGGACCAGGG + Intronic
1176050458 20:63116627-63116649 CTGGCTGGCCGGATGGGCCGCGG - Intergenic
1176414678 21:6467698-6467720 CGGGCAGGCCGGAGGGTCCCAGG - Intergenic
1177046876 21:16182498-16182520 AGGGAGGGACGGAGGGACGGAGG - Intergenic
1179690178 21:43076020-43076042 CGGGCAGGCCGGAGGGTCCCAGG - Intronic
1180042743 21:45288332-45288354 AGGGCTGGACGGCGGGGGCGGGG + Intergenic
1180168118 21:46040516-46040538 CAGGCTGGGCGCAGGGACCAGGG + Intergenic
1180184316 21:46131912-46131934 CGGGCTGGGCGGAGGGGAGGTGG - Intronic
1180338504 22:11599977-11599999 AGGGATGGAGGGAGGGACAGAGG - Intergenic
1183702222 22:39457257-39457279 CGGGCGCGGGGGAGGGACCGCGG - Intergenic
1184481792 22:44752514-44752536 GGGGCTGGGCGGAGGGGCGGGGG + Intronic
1185070862 22:48654911-48654933 AGGGCTGGGAGGAGGGGCCGTGG + Intronic
951719385 3:25681531-25681553 AGGGCTGGACCGAGGGACACAGG + Intergenic
954882568 3:53845971-53845993 CGGGCTGGACGCCGAGACCCGGG - Intronic
956643427 3:71435345-71435367 AGGGAGGGACGGAGGGACGGAGG + Intronic
957085151 3:75670779-75670801 ATGGATGGACGGAGGGACCCTGG + Intergenic
963196963 3:142543379-142543401 AGGGATGGACGGAGGGAGGGAGG - Intronic
965186866 3:165476405-165476427 AGGGCGGGAGGGAGGGACGGAGG + Intergenic
966418403 3:179713912-179713934 TGGCCTGGACTGAGGGACCAGGG - Intronic
966912813 3:184568944-184568966 CGGGAAGGAGGGAGGGAGCGAGG - Intronic
968035315 3:195543403-195543425 CGGGCGGGACGGAGGGGGCGGGG - Intergenic
968443392 4:636006-636028 CGAGATGGGCGGAGGGACCCTGG - Intronic
968454207 4:688935-688957 CCGGCTGGTCCGAGGGACTGAGG + Intronic
968659616 4:1793651-1793673 GGGGGAGGAGGGAGGGACCGCGG + Intronic
968740884 4:2331129-2331151 TGGGCTGGAAGGAGGGGCTGGGG + Intronic
971100346 4:23459457-23459479 AGGGATGGAGGGAGGGACGGAGG - Intergenic
976374114 4:84324864-84324886 CGGGGTGGGGGGAGGGGCCGAGG + Intergenic
976708493 4:88043377-88043399 CTGGCTGGACCGAGGAACCAGGG + Exonic
983966584 4:173820203-173820225 AGGGAGGGACGGAGGGACGGAGG - Intergenic
984946431 4:184972198-184972220 GGGGCTGGAGGGAGGGAGAGAGG - Intergenic
985445792 4:190020787-190020809 ATGGATGGACGGAGGGACCCTGG - Intergenic
986382989 5:7205440-7205462 AGGGCTGGAAGGAGTGACCAAGG + Intergenic
988856103 5:35229625-35229647 GGAGCTGGACGGAGGCACCTAGG - Intronic
997955348 5:138274611-138274633 AGCGCTGGTCCGAGGGACCGCGG + Exonic
999199630 5:149806479-149806501 CTGGCTGGCAGGAGAGACCGAGG - Intronic
999868603 5:155728194-155728216 GGGGCTGGAGGGAGGGAGCGAGG - Intergenic
1000052693 5:157575896-157575918 GGGGCTGGAGGGAGGGGCCGGGG + Intergenic
1002139745 5:177131978-177132000 CGGGCTGGGGGAAGGGCCCGAGG + Intergenic
1002565856 5:180112850-180112872 AAGGATGGACGGAGGGACCGAGG + Intronic
1002565864 5:180112869-180112891 GAGGATGGACGGAGGGACCGGGG + Intronic
1002565870 5:180112888-180112910 GGGGATGGACGGAGGGACCGTGG + Intronic
1002565884 5:180112926-180112948 CGGGATGGACGGAGGGACCGGGG + Intronic
1002565892 5:180112945-180112967 GGGGATGGACGGAGGGACCGGGG + Intronic
1002565900 5:180112964-180112986 GGGGATGGACGGAGGGACCGGGG + Intronic
1002565907 5:180112983-180113005 GGGGATGGACGGAGGGATCCGGG + Intronic
1002565915 5:180113002-180113024 CGGGCTGGACGGAGGGACCGGGG + Intronic
1002565923 5:180113021-180113043 GGGGATGGACGGAGGGACCGGGG + Intronic
1002565930 5:180113040-180113062 GGGGATGGACGGAGGGATCCGGG + Intronic
1002565938 5:180113059-180113081 CGGGCTGGACGGAGGGACCGGGG + Intronic
1002565945 5:180113078-180113100 GGGGATGGACAGAGGGACTGGGG + Intronic
1002565952 5:180113097-180113119 GGGGATGGACGGAGGGACCGGGG + Intronic
1002565958 5:180113116-180113138 GGGGATGGACGGAGGGATCGAGG + Intronic
1002565971 5:180113154-180113176 TGGGCTGGACGGAGGGACCGGGG + Intronic
1002565977 5:180113173-180113195 GGGGATGGACGGAGGGATCCAGG + Intronic
1002565984 5:180113192-180113214 CAGGATGGACAGAGGGACCGGGG + Intronic
1002565992 5:180113211-180113233 GGGGATGGACGGAGGGACAGGGG + Intronic
1002565997 5:180113230-180113252 GGGGATGGACGGAGGGACCGAGG + Intronic
1002566003 5:180113249-180113271 GAGGATGGACGGAGGGACCGAGG + Intronic
1002566017 5:180113287-180113309 CAGGATGGACGGAGGGACCGGGG + Intronic
1002566025 5:180113306-180113328 GGGGATGGACGGAGGGACCGGGG + Intronic
1002566033 5:180113325-180113347 GGGGATGGACGGAGGGACCGGGG + Intronic
1002566047 5:180113363-180113385 CGGGATGGACGGAGGGACCGGGG + Intronic
1002566055 5:180113382-180113404 GGGGATGGACGGAGGGACCGGGG + Intronic
1002566063 5:180113401-180113423 GGGGATGGACGGAGGGATCGGGG + Intronic
1002566077 5:180113439-180113461 CGGGATGGACGGAGGGACCGGGG + Intronic
1002566083 5:180113458-180113480 GGGGATGGACGGAGTGACCGGGG + Intronic
1002566091 5:180113477-180113499 GGGGATGGACGGAGGGACCGGGG + Intronic
1002566099 5:180113496-180113518 GGGGATGGACGGAGGGATCGGGG + Intronic
1002566106 5:180113515-180113537 GGGGATGGACGGAGGGACCGGGG + Intronic
1002566113 5:180113534-180113556 GGGGATGGACGGAGGGATCCGGG + Intronic
1002566121 5:180113553-180113575 CGGGATGGACGGAGGGACCGGGG + Intronic
1002566129 5:180113572-180113594 GGGGATGGACGGAGGGATCGGGG + Intronic
1002566136 5:180113591-180113613 GGGGATGGACGGAGGGATCGGGG + Intronic
1002566142 5:180113610-180113632 GGGGATGGACGGAGGGATCCGGG + Intronic
1002566149 5:180113630-180113652 GGGGATGGACGGAGTGACCGGGG + Intronic
1002566157 5:180113649-180113671 GGGGATGGACGGAGGGACCGGGG + Intronic
1002566165 5:180113668-180113690 GGGGATGGATGGAGGGATCGGGG + Intronic
1002566172 5:180113687-180113709 GGGGATGGACGGAGGGATCGGGG + Intronic
1002566186 5:180113725-180113747 CGGGCTGGACGGAGGGACCGGGG + Intronic
1002566194 5:180113744-180113766 GGGGATGGACGGAGGGACCGGGG + Intronic
1002566202 5:180113763-180113785 GGGGATGGACGGAGGGATTGGGG + Intronic
1002566207 5:180113782-180113804 GGGGATGGATGGAGGGACCGAGG + Intronic
1002566213 5:180113801-180113823 GAGGATGGATGGAGGGACCGAGG + Intronic
1002566219 5:180113820-180113842 GAGGATGGATGGAGGGACCGAGG + Intronic
1005450050 6:25963386-25963408 CGGGCGGGGGGGAGGGATCGGGG + Intronic
1019404581 7:876913-876935 CGAGCTGGACCCAGGGGCCGCGG + Intronic
1019407498 7:891420-891442 CGAGCTGGCGGGAGGGGCCGCGG - Intronic
1019416709 7:931020-931042 AGGGAGGGACGGAGGGACTGAGG + Intronic
1019474081 7:1235767-1235789 CGGGCTGGCCGCCGGGGCCGAGG - Intronic
1020014038 7:4820751-4820773 CAGGCTGGACTGAGGGCGCGTGG - Intronic
1024260934 7:47573363-47573385 CGGGCTGGTGGGAGGCAGCGTGG - Intronic
1026234614 7:68515837-68515859 GGAGCTGGAGGGAGGGACAGTGG + Intergenic
1028121410 7:87059696-87059718 CACGCCGGAGGGAGGGACCGCGG + Exonic
1029506052 7:100964851-100964873 CAGGCTGGAGGGAGGGGCCAGGG + Intronic
1029745027 7:102512005-102512027 GGGGCTGGAGGGCGGGATCGGGG + Intronic
1029763019 7:102611166-102611188 GGGGCTGGAGGGCGGGATCGGGG + Intronic
1030302353 7:107987288-107987310 GGGGCTGGGCAGAGGGACAGTGG + Intronic
1032388894 7:131542974-131542996 CGGGCTGGACGCAGGGGCCAGGG + Intronic
1033654226 7:143362401-143362423 CGGGCAGGAAGGAGGGACAGAGG + Intronic
1035677745 8:1467245-1467267 GGGGCTGGGGGGAGGGACCGTGG - Intergenic
1037985822 8:23289984-23290006 CGGGCTGGCCGGTGGTATCGTGG + Exonic
1039467947 8:37797202-37797224 CGCGCCGGCCGGAGGGACCCAGG - Intronic
1040338244 8:46427013-46427035 TGGGCTGGACGCAGGGACTAAGG + Intergenic
1042235857 8:66612984-66613006 AGGGCAGGACGGAGGGACAGCGG + Exonic
1043428427 8:80171433-80171455 CGGGCTGGAGACATGGACCGCGG - Intronic
1043873782 8:85463648-85463670 CGGGTTGGACGGAGGAGCCCAGG + Intergenic
1048336085 8:133503512-133503534 GGGGCTGGACGGAGGGAGGAAGG - Intronic
1049620894 8:143597911-143597933 CGGGCCGGCCGGGGGGCCCGCGG - Exonic
1055654139 9:78436780-78436802 AGGGCTGGCCGGTGGGACCCGGG + Intergenic
1062538897 9:137032837-137032859 CAGGCTGGAGGAAGGGACCCTGG - Exonic
1062544110 9:137054063-137054085 CGGGCGGGGCCGCGGGACCGCGG + Intergenic
1203761158 EBV:13420-13442 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203762087 EBV:16492-16514 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203763016 EBV:19564-19586 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203763945 EBV:22636-22658 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203764874 EBV:25708-25730 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203765803 EBV:28780-28802 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203766732 EBV:31852-31874 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203767661 EBV:34924-34946 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203444740 Un_GL000219v1:44789-44811 ACGGATGGACGGAGGGACCTTGG - Intergenic
1185574919 X:1163674-1163696 AGGGAGGGACGGAGGGACGGAGG + Intergenic
1186467842 X:9797788-9797810 GGGGCTGGCCGGAGGCACAGTGG + Intronic
1192584058 X:72306428-72306450 CGGGCTGGGCGGCGGGGCCGAGG - Intronic
1194977383 X:100408860-100408882 CGGGCTGGAGGGAGGGGGCTCGG - Exonic
1195338326 X:103878885-103878907 GGGGCTGGAAGGAGGTCCCGAGG - Intergenic
1195581844 X:106513143-106513165 AGGGCTGGATGAGGGGACCGGGG - Intergenic
1200107741 X:153724292-153724314 CGGGCTGGGCTCCGGGACCGCGG - Intronic