ID: 1002567043

View in Genome Browser
Species Human (GRCh38)
Location 5:180118109-180118131
Sequence TATTACGTTTAGAATCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002567040_1002567043 -8 Left 1002567040 5:180118094-180118116 CCACATAAATAAAAGTATTACGT 0: 1
1: 0
2: 1
3: 27
4: 233
Right 1002567043 5:180118109-180118131 TATTACGTTTAGAATCAGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 90
1002567038_1002567043 17 Left 1002567038 5:180118069-180118091 CCAAAAATGTAAATGTGATCTGA 0: 1
1: 0
2: 2
3: 48
4: 364
Right 1002567043 5:180118109-180118131 TATTACGTTTAGAATCAGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002567043 Original CRISPR TATTACGTTTAGAATCAGGG AGG Intronic
902202850 1:14846673-14846695 CATGACCTTGAGAATCAGGGGGG + Intronic
903543564 1:24110119-24110141 TTTTAGCTTTAGCATCAGGGGGG - Intronic
904953558 1:34263969-34263991 TATTAGGTTTTGAATGAGGCTGG - Intergenic
906159177 1:43635120-43635142 CATTACGTTTAAAATCAGTAAGG + Intergenic
911016123 1:93334682-93334704 TGTTACATTTATAATCAGTGAGG - Intergenic
923607486 1:235457657-235457679 TAAGAGTTTTAGAATCAGGGAGG + Intronic
1064515892 10:16147494-16147516 TTTTAACTTTAGATTCAGGGGGG - Intergenic
1065040416 10:21688553-21688575 TATTATGTTTAGAACCATGCTGG - Intronic
1067522925 10:47021701-47021723 TAATACAGTGAGAATCAGGGAGG + Intergenic
1067657750 10:48210107-48210129 GTTTACTTTTATAATCAGGGAGG + Intronic
1068561576 10:58520715-58520737 TATTACTTTTAAAATCGAGGGGG - Intronic
1071528615 10:86372819-86372841 TATTGTGTGTAGAACCAGGGTGG - Intergenic
1076217345 10:128706737-128706759 TATTACTTTTATTATCAGGAGGG + Intergenic
1077712789 11:4553092-4553114 TATCACATATAGCATCAGGGAGG + Intergenic
1082218850 11:49608162-49608184 GATCACTTTTAGAAACAGGGAGG + Intergenic
1086630722 11:89015958-89015980 GATCACTTTTAGAAACAGGGAGG - Intronic
1088745310 11:112799823-112799845 TATTGCCATTAGAAACAGGGAGG + Intergenic
1091508979 12:1102188-1102210 TATTAGGTTTAGAAACAAGGAGG + Intronic
1093899812 12:24618970-24618992 AATTCTGTTTAGAAACAGGGCGG + Intergenic
1094746739 12:33353509-33353531 TATTAGGTTTAGGTTCAGGAAGG - Intergenic
1095227316 12:39693522-39693544 TATTACATTTAGAATGAGAAAGG - Intronic
1096630993 12:52926613-52926635 GATCAGGTTTACAATCAGGGAGG - Intronic
1096986244 12:55760061-55760083 TATAACGTTTGGAATCAGGTAGG - Intronic
1097504819 12:60452901-60452923 CATTGCATTTAGAGTCAGGGAGG - Intergenic
1099436668 12:82654132-82654154 TAAAATGTTTAGAATCAAGGAGG - Intergenic
1101672505 12:106889051-106889073 TATTACTTTTATAATCAGAGGGG - Intronic
1109037998 13:57291004-57291026 TTTTATGTTTAGAATGAGGTAGG - Intergenic
1110767299 13:79295347-79295369 TATCACCTTTAGAACCAGGTGGG + Intergenic
1112194577 13:97212527-97212549 TATTACATTTAGAGCCAGTGAGG + Intergenic
1113604248 13:111594414-111594436 TTTTACGTTTATATTCAGTGAGG + Intronic
1117181041 14:53192088-53192110 CCTTACTTTTAGAACCAGGGAGG - Intergenic
1117766745 14:59091488-59091510 TATTTTGTTTAGAAAAAGGGAGG - Intergenic
1118081063 14:62361505-62361527 CATTACGTTGAGAATTAGGGGGG - Intergenic
1118695782 14:68383766-68383788 TATCAGAGTTAGAATCAGGGTGG + Intronic
1125080015 15:35661273-35661295 TAGTAAATTTAGAATCAAGGTGG - Intergenic
1126832900 15:52627142-52627164 TATCAGGTTTAGAATTTGGGTGG - Intronic
1128885552 15:71283648-71283670 TATTAAGTTTAGGTTTAGGGAGG + Intronic
1129744043 15:78005809-78005831 TATTACTTGTATAGTCAGGGGGG + Intronic
1139037370 16:62963418-62963440 TGGTACCTTTAGAATCAGTGAGG + Intergenic
1139068253 16:63346502-63346524 TATAAGGTTGAGAATCTGGGAGG - Intergenic
1148227675 17:45910319-45910341 TAGGACGTTGAGATTCAGGGAGG + Intronic
1148286502 17:46397730-46397752 TATGAGGTTTAAAATCAGTGTGG + Intergenic
1148308668 17:46615322-46615344 TATGAGGTTTAAAATCAGTGTGG + Intronic
1153225006 18:2893178-2893200 TATTATCTGTAGAATCAGGCTGG + Intronic
1156805878 18:41180462-41180484 TATGAATTTTAGAATCAGGTTGG + Intergenic
927374095 2:22393132-22393154 TATGAGATCTAGAATCAGGGAGG - Intergenic
928546359 2:32332650-32332672 TATGACATTTAGAATCATTGTGG + Intergenic
929072040 2:38040719-38040741 TATAAAATTTAGAATCAGAGGGG + Intronic
933631036 2:84658223-84658245 AATTAAGTTTAGAATTAGGTTGG - Intronic
935826626 2:106958212-106958234 TATTACTTTTATAATCAGAAAGG - Intergenic
944296688 2:198072269-198072291 CATTATGTTTAGAAACAGGTTGG + Intronic
944323416 2:198375822-198375844 CATTAGGTTTAGCATCATGGAGG - Intronic
947543870 2:230996862-230996884 TATATGGTTTAGAATAAGGGAGG + Intronic
1169838718 20:9910050-9910072 TTTTTATTTTAGAATCAGGGAGG + Intergenic
1184868756 22:47219794-47219816 TGTTTCTTTTAGGATCAGGGTGG + Intergenic
1184966785 22:47981102-47981124 TATTAGGCTTAGTATCTGGGTGG - Intergenic
949096678 3:94744-94766 TATCACCTTTAAAATAAGGGTGG + Intergenic
949668372 3:6368111-6368133 TATCACAGTTAGAATCATGGAGG + Intergenic
952560056 3:34581583-34581605 TTTTATGGTTATAATCAGGGAGG - Intergenic
952710059 3:36421122-36421144 TATTACTTCCAGAATCAGAGAGG - Intronic
953636235 3:44667605-44667627 TATTACTTTTATGATCAGGAGGG + Intergenic
956987430 3:74718174-74718196 TATCAAGTTTAGAATCAGTTTGG + Intergenic
960887014 3:122406090-122406112 TATTACTTTTAAAATTGGGGAGG - Intronic
965569363 3:170155942-170155964 TATTAATTTTAGAATCAGAGAGG + Intronic
968107452 3:196012406-196012428 TATAAAGTTTAGAATCAGCTCGG - Intergenic
971820124 4:31541457-31541479 TATAAAGTTTAGAATCAGGTGGG + Intergenic
977889575 4:102293133-102293155 TTCTACTTTTAGAATTAGGGAGG - Intronic
980610387 4:135152755-135152777 TATTTAATTTAGATTCAGGGGGG - Intergenic
987926442 5:24348641-24348663 TATAACTTTTAGAATCAGATTGG + Intergenic
988862406 5:35296785-35296807 TATTAATTTTAGGATCAGGTTGG + Intergenic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
993562384 5:89426567-89426589 CATTACATTTAGATTCAGGGTGG + Intergenic
996325279 5:122266695-122266717 TATTATGATTAGGATCATGGCGG + Intergenic
997681300 5:135753277-135753299 TATTACTGTTAGAATCACCGTGG - Intergenic
1000637233 5:163658238-163658260 TATCACATTTAAAATAAGGGAGG + Intergenic
1002116782 5:176968446-176968468 TATTACTTTAATAATCAAGGAGG + Intronic
1002567043 5:180118109-180118131 TATTACGTTTAGAATCAGGGAGG + Intronic
1006270755 6:32965349-32965371 TGTTAAGTTTGGAATCAGTGGGG - Intronic
1008336699 6:50314766-50314788 TATTTGGTTTAGAATGAAGGGGG - Intergenic
1009331658 6:62429692-62429714 TATTAGGTTGAGAATAAAGGAGG + Intergenic
1010451052 6:76003607-76003629 TGTTTCATTTAGAATCAGGATGG - Intronic
1017955497 6:159174292-159174314 TAGAACATTTGGAATCAGGGAGG + Intronic
1019679483 7:2337921-2337943 TATTCCCTTTAAAATCAGGGGGG + Intronic
1023593323 7:41801880-41801902 TATGATGTTTAAGATCAGGGTGG - Intergenic
1030253840 7:107484044-107484066 TATTATCTTTAGGATAAGGGAGG - Intronic
1035033230 7:155878160-155878182 TATTACTTTTATAATCAGTGGGG + Intergenic
1037233093 8:16684123-16684145 TATTTCTTTTAGAATCACTGAGG - Intergenic
1038204349 8:25450842-25450864 TATTACTTTTGTAATAAGGGGGG + Intronic
1038640678 8:29322900-29322922 TATTACTTCTAAAATCAGAGTGG + Intergenic
1038640857 8:29325084-29325106 TATTACTTCTAGTATCATGGTGG + Intergenic
1039327611 8:36502475-36502497 TATTGCATTTTGAATCAGGTGGG + Intergenic
1040721176 8:50325221-50325243 TCTTAACTTTAGAATCAGTGTGG + Intronic
1041600851 8:59716060-59716082 TAATATGTTAAGAATCAGAGAGG - Intergenic
1045109716 8:98928851-98928873 TAACAGGTTTAGAATGAGGGGGG + Intronic
1047880265 8:129185265-129185287 TATATCGTTTAGCATCATGGCGG - Intergenic
1049098257 8:140561397-140561419 CATTAATTTTATAATCAGGGAGG - Intronic
1186866232 X:13723462-13723484 TAAAACGTTTGGAATCAGGCCGG - Intronic
1188530779 X:31138562-31138584 TTATAAGTTTAGAATCATGGTGG + Intronic
1190471447 X:50783870-50783892 TATAAAGTTTAGAATCTGGCCGG - Intronic
1195317204 X:103690857-103690879 AATTAACTTTGGAATCAGGGTGG + Intergenic