ID: 1002567055

View in Genome Browser
Species Human (GRCh38)
Location 5:180118204-180118226
Sequence GGGACCAAAGGGCCCCAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002567048_1002567055 26 Left 1002567048 5:180118155-180118177 CCTCAATTTTATCTGAAACAGAA 0: 1
1: 0
2: 1
3: 44
4: 493
Right 1002567055 5:180118204-180118226 GGGACCAAAGGGCCCCAAGTGGG 0: 1
1: 0
2: 1
3: 13
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002567055 Original CRISPR GGGACCAAAGGGCCCCAAGT GGG Intronic
900234874 1:1583648-1583670 TGGATCAAAGGGACCCAGGTTGG - Intergenic
903672048 1:25042203-25042225 GGAACCACAGGGACCCAAGGAGG + Intergenic
905448444 1:38042604-38042626 GTGTCCCCAGGGCCCCAAGTTGG - Intergenic
910948907 1:92623670-92623692 GGGACAAAATTGCCCCAATTGGG - Intronic
915185015 1:154098234-154098256 GGAACCACAGGGCCCCAAAGTGG + Intronic
920617981 1:207513303-207513325 GGGACCAAAGGACCTCAGGGTGG - Intronic
921172281 1:212560193-212560215 GGGACGAAGGGGAGCCAAGTGGG - Intergenic
921654526 1:217719093-217719115 TGGACCAATAGGCCCCTAGTGGG + Intronic
922041591 1:221903318-221903340 GGAACCACAGGGCCCCAATGAGG + Intergenic
923391447 1:233516695-233516717 GGAACCACAGGGCCCCAAAGAGG - Intergenic
1062769961 10:91666-91688 GGAACCATAGGGCCCCAAAGAGG + Intergenic
1063205832 10:3829934-3829956 GGCACAAAAGGGGCTCAAGTTGG + Intergenic
1067535797 10:47109001-47109023 AAGGCCACAGGGCCCCAAGTGGG + Intergenic
1069049796 10:63780509-63780531 GGGACCAAAGGGCCTGAGTTTGG + Intergenic
1071746069 10:88420941-88420963 GGGCCCAAAGGGCCCCTTCTTGG + Intronic
1072881480 10:99233339-99233361 GGTTCCAAACGGCCCCAAGTGGG - Intronic
1074153923 10:110782142-110782164 GGGAGCAAAGGACCCCACCTGGG + Intronic
1074991456 10:118712335-118712357 GGCCCCAAAGGGCCCCAAAGAGG + Intronic
1075025100 10:118978539-118978561 GGGATCAAAGTGCCCCAGGGCGG - Intergenic
1076076831 10:127540096-127540118 GCCACCAAAGGGCCACAAGCAGG - Intergenic
1076655076 10:132018676-132018698 GGAACCACAGGGCCCCAAAGAGG + Intergenic
1077231436 11:1459697-1459719 GTGAGCACAGGGCCCCAAGAAGG + Intronic
1077844623 11:6011979-6012001 GGAACCATAGGGCCCCAAAGAGG + Intergenic
1078668327 11:13343999-13344021 GGTACCCAAGGGCCACAAATGGG + Intronic
1080758977 11:35229579-35229601 GGGATGAAAGGCCTCCAAGTGGG - Exonic
1080966912 11:37224207-37224229 GGAACCACAGAGCCCCAAGGAGG + Intergenic
1083562125 11:63681429-63681451 GCGCACAAAGGGCCCCAAGCGGG - Intronic
1086268155 11:85027779-85027801 GGAACCAAAGAGCCCCAAAGAGG + Intronic
1090514533 11:127411564-127411586 GGAACCACAGGGCCCCAAGGAGG + Intergenic
1091217926 11:133914906-133914928 ATGACCAAAGGGCCCCAGGTGGG - Intronic
1093492909 12:19725448-19725470 GGAACCACAGGGCCCCAAAGAGG + Intergenic
1094473903 12:30826784-30826806 GGGACCCAGGAGCCCCAGGTTGG - Intergenic
1096616640 12:52836766-52836788 GGGACAAAGGAGCCCCAAGAGGG + Intergenic
1098597749 12:72294070-72294092 GGAACCACAGGGCCCCAAAGAGG + Intronic
1105443976 13:20436848-20436870 TGAAACAAAGGGCCCCAAGCAGG + Intronic
1108233031 13:48370465-48370487 CTGACCAAAGGGCTTCAAGTTGG + Intronic
1108741050 13:53338764-53338786 GAAACCAAAGGGACCCAAGTTGG - Intergenic
1109633622 13:65085298-65085320 GGAACCACAGGGCCCAAAGAAGG + Intergenic
1112525763 13:100145422-100145444 GGGACAAAATTGCTCCAAGTTGG + Intronic
1119543761 14:75457322-75457344 GGGACGAAGGAGCCCCAAGAAGG + Intronic
1121341951 14:93110700-93110722 GGGACAAAAGGGTCCCTGGTGGG + Intronic
1121527946 14:94632569-94632591 GGAACCAAAGAGCCCCAAAGAGG + Intergenic
1122114852 14:99522583-99522605 GGGACCCAAGGGCAGGAAGTTGG - Intronic
1202842176 14_GL000009v2_random:131820-131842 GGAACCACAGGGCCCCAAAGAGG + Intergenic
1202911565 14_GL000194v1_random:122053-122075 GGAACCACAGGGCCCCAAAGAGG + Intergenic
1128481868 15:68046443-68046465 GGAACCGAAGGGCTCCAAGGAGG - Intergenic
1129800060 15:78406719-78406741 GGAACCACAGGGCCTCAAGGAGG - Intergenic
1132555514 16:570238-570260 GGGTCCACAGGGGCCCAGGTCGG - Intronic
1133482737 16:6186870-6186892 GTGAACAAAGGCCCCCGAGTTGG + Intronic
1134078340 16:11308034-11308056 GGAACCACAGGGCCCCAAAGAGG + Intronic
1135056985 16:19240044-19240066 GGAACCACAGGGCCCCAAAGGGG + Intronic
1135947461 16:26877531-26877553 GGGACCAGAGGGACCCATCTGGG - Intergenic
1138352611 16:56353916-56353938 GGGGACAGAGGGCCCCCAGTTGG + Intronic
1142229181 16:88891706-88891728 GGTACCACAGGGTCCCAGGTTGG + Intronic
1142669206 17:1479741-1479763 GGGGCCAGAGAGCCCCAAGAGGG + Intronic
1143089100 17:4438199-4438221 GGGAGCAGAAGCCCCCAAGTGGG - Intronic
1144560261 17:16315465-16315487 GGGACCAAGGGGCCACTGGTGGG - Intronic
1145792686 17:27637784-27637806 GGGACCAAAGGGACCCATCAAGG - Intronic
1146359271 17:32160579-32160601 GGAACCACAGGGCCCCAAAGAGG - Intronic
1146889776 17:36499007-36499029 GGGACCAGATGGACCCGAGTGGG - Intronic
1153565406 18:6414053-6414075 GGGACCAAGCGGGCCCAAGAAGG + Intronic
1153925765 18:9833361-9833383 GGGACGACAGGGCCCCCAGAAGG + Intronic
1157281988 18:46352175-46352197 AGGACCCAAGGCCCCCAAGGAGG - Intronic
1159549177 18:69877181-69877203 CGGACCAATGGGCCTCAAGCTGG + Intronic
1161314251 19:3610495-3610517 GGGACCACCGGGCCCCAGTTGGG + Intergenic
1161619765 19:5291914-5291936 GGGAGCCAGGGGCCACAAGTGGG - Intronic
1161946592 19:7441029-7441051 GGATCCCAGGGGCCCCAAGTGGG + Intronic
1165251035 19:34534461-34534483 GGGACTAAGGGGTCCCAAGTTGG - Intergenic
1168474461 19:56665851-56665873 GGGACAAAATTGCCCCCAGTTGG + Intronic
1202656659 1_KI270708v1_random:29677-29699 GGAACCACAGGGCCCCAAAGAGG - Intergenic
927743084 2:25590122-25590144 GGAACCACAGAGCCCCAAGGAGG + Intronic
928022711 2:27716281-27716303 GGGAGGAAAGGGCCCCAGGAGGG - Intergenic
931500175 2:62856312-62856334 GGAACCACAGGGCCCCAAAGCGG - Intronic
932501556 2:72187209-72187231 GGAACCACAGGGCCCCAAAGAGG + Intronic
935518675 2:104077813-104077835 GGAACCACAGGGCCCCAAAGAGG + Intergenic
937048335 2:118865242-118865264 GGAACCAAAAGGCCCAGAGTAGG + Intergenic
940210217 2:151249119-151249141 GGGTTCAAAGGGCCCCAACATGG + Exonic
940612121 2:156005903-156005925 GGAACCATAGGGCCCCAAAGAGG + Intergenic
941051112 2:160735094-160735116 GGGAAAAAAGGGCACCAAGGAGG + Intergenic
943562818 2:189483774-189483796 GAGACCAAACGGCCTCCAGTGGG - Intergenic
943820310 2:192314076-192314098 GGAACCACAGGGCCCCAAAGAGG + Intergenic
944285398 2:197943900-197943922 GGAAGCAAAGGGCTCCAAGGAGG - Intronic
945034806 2:205695786-205695808 AGGACCAACGGGCCTCAATTTGG + Intronic
946168532 2:217879845-217879867 GGGACCCAGGGGCCCCAGGATGG + Intronic
948728073 2:239946831-239946853 GGGGCCAGAGGGCCCCATGCTGG + Intronic
1169632276 20:7647115-7647137 GGAACCACAGGGCCCCAAAGAGG + Intergenic
1170501121 20:16975718-16975740 GGAACCATAGGGCCCCAAAGAGG - Intergenic
1170740479 20:19051565-19051587 GGGCCCACAGGGCCTCAGGTTGG + Intergenic
1170791426 20:19512371-19512393 GGACCCAAAGGGCCCCATGCTGG - Intronic
1172359640 20:34303144-34303166 GGGTCCAGAGAGCCCCGAGTCGG + Intronic
1172765996 20:37351176-37351198 AGGACCAAATGGACCAAAGTTGG - Intronic
1176630924 21:9136722-9136744 GGAACCACAGGGCCCCAAAGAGG + Intergenic
1176642368 21:9318103-9318125 GGAACCAAAGGCCCCAAAGAAGG - Intergenic
1177037306 21:16060268-16060290 GGAACCACAGAGCCCCAAATAGG + Intergenic
1178277625 21:31253296-31253318 GAGACTAAAGGCCCCCAAATTGG - Intronic
1178815396 21:35924691-35924713 GGGACAACATGGCACCAAGTTGG - Intronic
1178896417 21:36562324-36562346 GGGACCCAAGGGCAGGAAGTAGG + Intronic
1179408203 21:41142602-41142624 GGAACCAAAAGGCCCCAGGAGGG - Intergenic
1180351382 22:11807457-11807479 GGAACCAAAGGCCCCAAAGAAGG - Intergenic
1180375666 22:12090884-12090906 GGAACCACAGGGCCCCAAAGAGG - Intergenic
1180386820 22:12184620-12184642 GGAACCAAAGGCCCCAAAGAAGG + Intergenic
1184054174 22:42033309-42033331 GGAACCATAGGGCCCCAAAGAGG + Intronic
1184597381 22:45522468-45522490 GGGTCCATAGGGCCCAAAGGAGG + Intronic
1185140039 22:49095088-49095110 GGGACCAGAGGGGCGCATGTGGG + Intergenic
953905845 3:46867916-46867938 GGGACCTAGGGGCCCCGCGTGGG - Intronic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
954291053 3:49650246-49650268 GGGAGCAAACGGCTCCTAGTGGG - Intronic
956749788 3:72336522-72336544 GGAACAAATGAGCCCCAAGTCGG + Intergenic
957638230 3:82815057-82815079 GGAACCACAGGGCCCCAAATAGG + Intergenic
961046020 3:123708577-123708599 GGGACGAGAGGGCCCTCAGTGGG + Intronic
961211389 3:125128728-125128750 AGGACTAGAGAGCCCCAAGTAGG - Intronic
965272806 3:166639391-166639413 GGAACCACAGGGCCCCAAAAAGG - Intergenic
966849518 3:184155926-184155948 GGAACCAAAGGGGCCCAAATGGG - Intronic
1202744518 3_GL000221v1_random:86915-86937 GGAACCAAAGGCCCCAAAGAAGG + Intergenic
968511051 4:996139-996161 GGGACCACTGGGGCCCAGGTTGG - Intronic
968538536 4:1150413-1150435 GGAACCACAGGGCCCCAAAGAGG + Intergenic
968920774 4:3521250-3521272 GGGCCGAGAGGGCCCCGAGTAGG + Intronic
977343397 4:95788850-95788872 GGGAGAAAAGGAACCCAAGTTGG + Intergenic
979462952 4:121004043-121004065 GGAACCACAGGGCCCCAAAGAGG - Intergenic
980980822 4:139653364-139653386 GAGACCACAGGGCCCCAAGAAGG - Intergenic
983784649 4:171716037-171716059 GGGACCATGGGGCCCCAAACAGG - Intergenic
1202757264 4_GL000008v2_random:76325-76347 GGAACCACAGGGCCCCAAAGAGG - Intergenic
994901168 5:105771471-105771493 GGGAGCAAGGGACCACAAGTAGG - Intergenic
996679209 5:126212449-126212471 GGGCCCCAAGAGCACCAAGTTGG - Intergenic
997480114 5:134178291-134178313 GGGAGCAAAGGGGCTCCAGTGGG - Intronic
999653293 5:153788355-153788377 GGGACTAAAGGGAGGCAAGTGGG - Intronic
1001120619 5:168977052-168977074 GGGAACAAAGGGGCCCAGGAGGG + Intronic
1002567055 5:180118204-180118226 GGGACCAAAGGGCCCCAAGTGGG + Intronic
1003961489 6:11213288-11213310 GGAACCAGTGGGCCCCACGTGGG - Exonic
1004352716 6:14904274-14904296 GGGTCCAAAGGGTCACAATTGGG + Intergenic
1007214873 6:40229062-40229084 GGAACCACAGAGCCCCAAGATGG - Intergenic
1008611551 6:53188874-53188896 GGGACCGTAGGGTCCCAAGTAGG + Intergenic
1008953180 6:57183026-57183048 GGCACCAAAGGAGCCCAAGTAGG - Intronic
1008958839 6:57245149-57245171 GGCACCATAGGGCTCCAAGGTGG - Intergenic
1011497001 6:87946686-87946708 GGGAGCAAATTGCCCCCAGTTGG + Intergenic
1014074889 6:117224534-117224556 GGGACCAAAGAGCTCATAGTAGG - Intergenic
1019417585 7:934500-934522 GGGACCGAAGGGCCGCATGGAGG - Intronic
1020144342 7:5631272-5631294 GGGACCAGAGGCCGACAAGTGGG - Intronic
1021500683 7:21329464-21329486 GGAACCACAGGGCCCCAAAGAGG + Intergenic
1023700523 7:42888210-42888232 CGCCCCAAAGGGCCCCAAGCAGG + Intergenic
1026792929 7:73346485-73346507 GGGCCCAAGGGGCCCCAGGAGGG + Intronic
1029236018 7:99119714-99119736 GTGCCCAAAGGCCCCCAACTGGG - Intronic
1029798942 7:102925602-102925624 GGGACAAAAGTGCTCAAAGTTGG + Intronic
1031921878 7:127608422-127608444 GGAACCACAGGGCCCCAAAGAGG + Intergenic
1034481344 7:151322196-151322218 GGAACCACAGGGCCCCAAAGAGG - Intergenic
1034523367 7:151638251-151638273 GGGAACAGAGGGACCCAAGTTGG + Intronic
1037750578 8:21679516-21679538 GTGACCACAGGGCCCCGACTGGG - Intergenic
1041357172 8:57013608-57013630 GGAACCATAGGGCCCCAAAGAGG + Intergenic
1043745659 8:83870238-83870260 GGAACCACAGGGCCCAAAATTGG - Intergenic
1044920163 8:97161879-97161901 GCTACCAAAGGGCTCCAAGTAGG - Intergenic
1045888125 8:107123529-107123551 GGAACCACAGAGCCCCAAGAGGG - Intergenic
1049659026 8:143811511-143811533 GGGAGCAGAGGGCACGAAGTGGG - Intronic
1053034321 9:34810855-34810877 GAGAGCACAGGGCCCCAAGCGGG + Intergenic
1057468658 9:95338375-95338397 GGGACCGCAGGGCCCCAAAGAGG - Intergenic
1058727006 9:107813982-107814004 GCGGCCCATGGGCCCCAAGTTGG + Intergenic
1060812716 9:126619047-126619069 GAGCCCAAAGGGCCCCCAGCGGG - Intronic
1062130762 9:134891867-134891889 GGGACCAAAGGGCCCCAGGCAGG - Intergenic
1203753754 Un_GL000218v1:104424-104446 GGAACCACAGGGCCCCAAATAGG + Intergenic
1203538054 Un_KI270743v1:61186-61208 GGAACCACAGGGCCCCAAAGAGG - Intergenic
1186741398 X:12522174-12522196 GGGACAAAATGGCCCCAAAGGGG - Intronic
1187715167 X:22095517-22095539 GAGGCCAAAGGGCTCCAACTTGG + Intronic
1188989475 X:36800348-36800370 GATACCAAAGGGCCCAAACTGGG - Intergenic
1195655117 X:107325480-107325502 GGAACCACAGGGCCCCAAAGAGG - Intergenic
1197501175 X:127244036-127244058 GGAACCACAGGGCCCCAAAGAGG + Intergenic
1200058920 X:153475342-153475364 GGGAACACAGGACCCCAAATGGG - Intronic
1200136341 X:153876640-153876662 GGGAGGAAAGGGGCCCAAGATGG + Intronic