ID: 1002569163

View in Genome Browser
Species Human (GRCh38)
Location 5:180130265-180130287
Sequence GCCTGCTTCCTCTGCGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002569159_1002569163 -2 Left 1002569159 5:180130244-180130266 CCACGCTGGGTAATTGAAGTGGC 0: 1
1: 1
2: 0
3: 2
4: 41
Right 1002569163 5:180130265-180130287 GCCTGCTTCCTCTGCGGGGTAGG No data
1002569155_1002569163 14 Left 1002569155 5:180130228-180130250 CCAGGGAAACTAGGCTCCACGCT 0: 1
1: 0
2: 1
3: 9
4: 70
Right 1002569163 5:180130265-180130287 GCCTGCTTCCTCTGCGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002569163 Original CRISPR GCCTGCTTCCTCTGCGGGGT AGG Intronic
No off target data available for this crispr