ID: 1002569340

View in Genome Browser
Species Human (GRCh38)
Location 5:180131142-180131164
Sequence AGACCTCTGTGGCTGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 1, 2: 3, 3: 37, 4: 478}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002569340 Original CRISPR AGACCTCTGTGGCTGCAGGG TGG (reversed) Intronic
900138337 1:1128235-1128257 ACACCTCTCTGGGTGCAGAGCGG - Intergenic
900166739 1:1246962-1246984 AGACCTCGCAGGCTCCAGGGTGG + Intergenic
900487239 1:2928974-2928996 ACACCTTTGGGGCTGCAGTGTGG + Intergenic
900957071 1:5892676-5892698 AGAGGTCTGAGGCTGCAGTGGGG - Intronic
901221709 1:7587161-7587183 AGGCCTCTGTGGCAGGAGGTGGG + Intronic
901393318 1:8962665-8962687 AGCCAACTGTGGCTGCAGGAGGG + Intronic
901739363 1:11332093-11332115 AAACCACTCTGGCTGCTGGGTGG - Intergenic
901746883 1:11379727-11379749 AACCCTCTGGGCCTGCAGGGTGG + Intergenic
902111642 1:14084024-14084046 AGACCCATCTGGCTGCAGTGAGG + Intergenic
902220140 1:14959403-14959425 GGACCAGTGTGGCTGCAGGTGGG + Intronic
902801642 1:18833875-18833897 AGGCCAGTGTGGCTGCAGAGGGG + Intergenic
903250756 1:22051901-22051923 AGACCCATGTGGCTACAGCGAGG + Intergenic
904290527 1:29482861-29482883 AGACTTCTGTGGCTGCTGGGTGG - Intergenic
904619825 1:31768491-31768513 AGAACTCTGTGGCTGCAGCATGG - Intergenic
904956961 1:34292650-34292672 GGACCTCTCTGGCTGCAATGTGG + Intergenic
905256150 1:36686769-36686791 AGAGCTCTGTGGATGCTTGGAGG + Intergenic
905455777 1:38087084-38087106 AGATCACTCTGGCTGCTGGGTGG + Intergenic
906063569 1:42963630-42963652 AGACCAGTGTGGTGGCAGGGAGG - Intergenic
906074385 1:43041395-43041417 AGGTCTCTGGGGCTGTAGGGAGG + Intergenic
906784917 1:48606801-48606823 AGATCACTCTGGCTGCAGGATGG - Intronic
907330064 1:53664933-53664955 AGGCCTCTGTGGCAGGAGGAGGG + Intronic
907417084 1:54322039-54322061 AGACCTCAAAGGCTGCAGGTGGG + Intronic
907844635 1:58192892-58192914 AGACTTCTGTGGATGGAGGGTGG + Intronic
908419267 1:63943604-63943626 AGAGCTCTGTCTCTGCAGGCTGG + Intronic
909187960 1:72513546-72513568 AGACTACTCTGGCTTCAGGGAGG - Intergenic
909565179 1:77045742-77045764 AGCCCCCTGTGGCTGCAGTCAGG + Intronic
910496728 1:87838012-87838034 AGATCTCTTTCGCTGCATGGTGG - Intergenic
910598945 1:89009858-89009880 AGAACTGTGGGGATGCAGGGAGG + Intronic
910694158 1:89994710-89994732 AGACTTCTGTGTCTCCATGGAGG + Intergenic
913271199 1:117095157-117095179 AGAGCTTTCTGGCTGCAGAGAGG + Intronic
914810936 1:151027555-151027577 AGACCACTCTGGCTGCTGCGGGG - Intronic
915020523 1:152775032-152775054 AGACCTATGTGGGTGTCGGGAGG + Intronic
915307224 1:154987545-154987567 AGAGCACTGTGGCTGGAGGCTGG + Intronic
915588001 1:156854814-156854836 AGATCACTCTGGCTGCAGAGTGG - Intronic
916201110 1:162272450-162272472 AGACATCTGAGGCTCCAAGGAGG + Intronic
917752373 1:178065677-178065699 AGATCACTCTGGCTGCAGGATGG + Intergenic
918400623 1:184159090-184159112 AGACCTTTGTGGCTTCAGAAAGG + Intergenic
920512084 1:206558902-206558924 AGAACACCGTGGCTGCAGAGGGG + Intronic
921540680 1:216410963-216410985 AGATCACTTTGGCTGCAGTGAGG - Intronic
922719482 1:227893050-227893072 AGCCTTGGGTGGCTGCAGGGGGG - Intergenic
924330172 1:242933725-242933747 ATACCTCTGTGTTTGCAGAGAGG - Intergenic
924375732 1:243406553-243406575 AGATCACTCTGGCTGCAGTGTGG - Intronic
924802396 1:247336998-247337020 AGGCCTCTGTGACAGCTGGGAGG - Intergenic
1063104112 10:2977730-2977752 AGTCCTCCCTGGCTGCAGTGCGG - Intergenic
1064731149 10:18332013-18332035 ACACCAATGTGGCTGCAGTGTGG + Intronic
1065178779 10:23104566-23104588 AGAACTCTTTGGCTGCAGTGTGG - Intronic
1066225728 10:33381343-33381365 TGACCTCTGTGGCTGTGGGGAGG + Intergenic
1067450657 10:46380118-46380140 AGCCCTCTGTTTCTGCAGTGAGG + Intronic
1067586586 10:47479633-47479655 AGCCCTCTGTTTCTGCAGTGAGG - Intronic
1068316071 10:55344181-55344203 AGTCCACTGTGGCTGCAATGGGG + Intronic
1068942189 10:62691008-62691030 TGACCTCTGTGGCTGAGGGTGGG + Intergenic
1069612187 10:69781581-69781603 CATCCTCTGAGGCTGCAGGGAGG + Intergenic
1070322293 10:75363258-75363280 AGACCTCTGGGGCTGTATTGTGG + Intergenic
1070473764 10:76812150-76812172 AAACCTCAAGGGCTGCAGGGTGG - Intergenic
1070829652 10:79410702-79410724 AGATCTCTTTGGCTGCTGAGTGG + Intronic
1070832570 10:79428494-79428516 AGAGCTCTGTGGCTGGAAGGTGG + Intronic
1071044818 10:81361143-81361165 AAACCTCTGTGGCTCCAGCCTGG - Intergenic
1072186746 10:93047102-93047124 AGATCTCTCTGGCAGCAGTGTGG + Intronic
1072196684 10:93122064-93122086 AGACCTCTCTGGCCACATGGGGG + Intergenic
1072656431 10:97333748-97333770 CGACCACTTTGGCTGCGGGGAGG - Exonic
1073053426 10:100684019-100684041 AAACCTGGGGGGCTGCAGGGGGG + Intergenic
1073127363 10:101159692-101159714 GGATCTCTGTGGGTGCAGTGTGG - Intergenic
1073448050 10:103592696-103592718 AGGCCTCTGAGGCTTCAAGGTGG + Intergenic
1074177679 10:111026465-111026487 AGGCCTGTGTGGCTGGAGTGAGG + Intergenic
1075261456 10:120966776-120966798 AGGCCTCAGTGGGTGCAGGAGGG + Intergenic
1075574693 10:123570063-123570085 AGGCCTCTGTCACTGCAGGTGGG - Intergenic
1075598603 10:123750361-123750383 AGACTTGTGTGGCTGGAGAGAGG - Intronic
1075666380 10:124233838-124233860 AGACTTCCCTGGCTGCAGAGGGG + Intergenic
1075673581 10:124281017-124281039 AACCCTCTGTGGCTCCAGGCTGG + Intergenic
1075700581 10:124467160-124467182 AGATCTCTCTGGCTGCAGTGTGG + Intronic
1075823778 10:125336387-125336409 GGGTCTCTGTGGCTGCAGGCTGG - Intergenic
1076107625 10:127835816-127835838 AGACCTGTGTGGGGACAGGGTGG - Intergenic
1076752306 10:132549671-132549693 GGAGCTCTGCAGCTGCAGGGCGG + Intronic
1077066640 11:643988-644010 AGACCCTCGTGGCTGCTGGGAGG - Intergenic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1077700665 11:4439118-4439140 AGACCAGAGTGGCAGCAGGGAGG + Intergenic
1077837488 11:5937438-5937460 AGTCATCTGTTGCTGTAGGGAGG - Intronic
1078319057 11:10317633-10317655 GGACCTATGAGGTTGCAGGGAGG + Intronic
1078447360 11:11414399-11414421 AGTCCAGTGTGGCTGGAGGGTGG - Intronic
1078536116 11:12175846-12175868 AGACCTATGTAGCTGGAAGGAGG + Intronic
1078581293 11:12541559-12541581 GGAGCTCTGGGGCTGGAGGGAGG - Intergenic
1079129974 11:17741590-17741612 AGACCTCTGTGGTTGCCAGGTGG - Intronic
1079131365 11:17748772-17748794 AGGCCCCTGTGGCTGCAGGAGGG - Intronic
1079388428 11:20000735-20000757 TGACCTCTGTGGCACCAGAGAGG - Intronic
1080605899 11:33864666-33864688 CGACCTCTGTGGCTGCCGGCTGG - Exonic
1081643043 11:44770657-44770679 AGATCACTCTGGCTGCTGGGTGG + Intronic
1081688151 11:45056911-45056933 AGAACTCTGTGCCTGCAGCCAGG - Intergenic
1083662911 11:64260092-64260114 AGACTTCTGAGGCTCCAGGCTGG - Exonic
1083748568 11:64748277-64748299 AGAACCCTCTGGCTGCAGGATGG - Intronic
1083902822 11:65651959-65651981 AGAGCTCTTTGGCTGCAGGGAGG + Intergenic
1084460578 11:69294609-69294631 AAAGCCCTGTGGCTGCTGGGTGG + Intronic
1084685923 11:70695214-70695236 AGACCTCTGGAGCTGGACGGTGG + Intronic
1084952670 11:72675249-72675271 AGTCCTCTTTGGAAGCAGGGTGG - Intergenic
1085022934 11:73220350-73220372 AGCGCTCTCTGGCTGCAGGATGG + Intronic
1085777440 11:79379386-79379408 AGACCTCTCTGGATGCTGTGTGG + Intronic
1087212375 11:95457237-95457259 AGGCCGCTGTGGCTCCAGCGTGG - Intergenic
1088577788 11:111288250-111288272 AGACCTCTATATCTGCAGAGAGG - Intergenic
1088849806 11:113695482-113695504 GGATGTGTGTGGCTGCAGGGCGG - Intronic
1089579649 11:119473451-119473473 AGACTACTCTGGCTGCAGTGTGG + Intergenic
1089687899 11:120168733-120168755 AGATCCCTCTGGCTGCTGGGTGG - Intronic
1089879708 11:121762080-121762102 GGAGCTCTGTGGGTGCAGGGAGG + Intergenic
1089949626 11:122513265-122513287 AGATAGCTGTGGCTGCAGAGTGG - Intergenic
1091443178 12:527419-527441 AAACGGCTGTGGCTGCAGGCAGG - Intronic
1091630932 12:2160404-2160426 AGCCGTCTGAGGATGCAGGGTGG - Intronic
1094301923 12:28974166-28974188 ATACTTCTGTGGCTGGTGGGTGG - Intergenic
1095705000 12:45227498-45227520 AGTCCTGTGTGGTTGCTGGGAGG + Intronic
1095857545 12:46877286-46877308 ATATCTCTGTGGCTCCACGGTGG - Intergenic
1096111815 12:49033351-49033373 AGGCCTTGGTGGCTGCTGGGAGG + Exonic
1096417641 12:51427255-51427277 AGATTTCTTTGGCTGCAGTGGGG + Intronic
1096906437 12:54941098-54941120 AGGCCTCTGAGGCTACTGGGTGG - Intergenic
1098534257 12:71576597-71576619 ACTCCTCTGGGGCTGCTGGGAGG + Intronic
1100308860 12:93376580-93376602 AGGCCAGTGTGGCTGCAGAGCGG - Intergenic
1100664642 12:96738003-96738025 AGATCACTGTGGCTGCTGTGTGG + Intronic
1100739452 12:97575392-97575414 GGATCTCTCTAGCTGCAGGGTGG + Intergenic
1100870253 12:98903373-98903395 AAACCACTGTGGCTGCATGATGG - Intronic
1101250510 12:102929619-102929641 AGACCACTCTGGCTGCAAGGTGG + Intronic
1102046045 12:109831011-109831033 AGGTCCCTGTGGCTGCAGAGTGG - Intronic
1102428183 12:112861118-112861140 CAACCTCTGTGGCAGCATGGTGG - Intronic
1103239722 12:119403248-119403270 CCACCTCCCTGGCTGCAGGGAGG - Intronic
1103830538 12:123775646-123775668 TGGCCACTGTGGCTGGAGGGAGG + Intronic
1103945763 12:124525536-124525558 ACACCAATCTGGCTGCAGGGAGG + Intronic
1103960678 12:124607303-124607325 GGACCCCTCTGGCTGCTGGGGGG - Intergenic
1104984163 12:132587273-132587295 AGAGCAGTGTGGCTGGAGGGAGG + Intergenic
1106544866 13:30721641-30721663 AGAGCACTCTGGCTGCAGTGTGG - Intronic
1106884698 13:34172007-34172029 AGACTACTGTGGCTGCTGTGTGG - Intergenic
1107017176 13:35716871-35716893 AGGCCTCGGTGGCTGCTGGCTGG - Intergenic
1107614142 13:42147094-42147116 AGAGCTGTGTGGCCGAAGGGAGG + Intronic
1107806809 13:44161049-44161071 AAACCTCTGTGGCTGAAGCCTGG + Intronic
1107905798 13:45060192-45060214 AGAGCTCTGTGGGTGGATGGTGG - Intergenic
1108305347 13:49126383-49126405 AGAGTTCTGTGGATGGAGGGTGG - Intronic
1113040668 13:106100873-106100895 AGACAGCTGGGGCGGCAGGGAGG - Intergenic
1115620538 14:35136012-35136034 AGACCTCTCTGGCAGCTGGTTGG + Intronic
1118454101 14:65929587-65929609 AGAGCACTCTGGCTGCAGCGTGG + Intergenic
1119526010 14:75323131-75323153 ACAGCTCTCTGGCTGCAGGTGGG - Intergenic
1119648778 14:76368316-76368338 CGCCCTCTGTGGCTTCAGGAAGG + Intronic
1119886879 14:78150931-78150953 AGACCCCTGGGGGTCCAGGGAGG - Intergenic
1120558842 14:85964359-85964381 AGATCTCTGTGGCTCCAGCATGG + Intergenic
1120901505 14:89579618-89579640 GGACCTGTGTGGCTGGAGGTTGG - Intronic
1120923313 14:89774245-89774267 AGACCTCTGTATCTGCAGATGGG - Intergenic
1121245231 14:92457243-92457265 AGGCCGCTGTGGCTGCAGCAGGG - Intronic
1121408853 14:93735498-93735520 AGCCCGCTGTGGCTGCCCGGAGG - Intronic
1121906881 14:97754047-97754069 AGACTTCTGTGGATGGATGGTGG - Intronic
1123222844 14:106872777-106872799 TGAGCTCTGTGACCGCAGGGAGG - Intergenic
1202875970 14_KI270722v1_random:702-724 AGACCTGTATAGCTTCAGGGTGG + Intergenic
1124027353 15:25978903-25978925 AGACCTTTGTGGGTGCAGTTGGG - Intergenic
1124616995 15:31249078-31249100 CGCCCTCGCTGGCTGCAGGGAGG - Intergenic
1126048098 15:44663285-44663307 CCACCTCTATGGCTGCAGGGAGG + Intronic
1129220885 15:74131079-74131101 CCACCTCTCTGGCTGCAGGTTGG - Intronic
1130332077 15:82930396-82930418 TTACCTCTGAGGCTGCAGGATGG - Intronic
1130906595 15:88244953-88244975 AGATTTCTGGGGCTGCAGAGTGG + Intronic
1131545802 15:93314635-93314657 AAATCACTGTGGCTGCAGTGGGG + Intergenic
1132104290 15:99051521-99051543 AGTCCTCTGTGGCTACAGCCAGG + Intergenic
1132577647 16:671379-671401 AGAGCTCTGTGGATGCTGAGGGG - Intronic
1132684155 16:1155295-1155317 AGGCCTCTGTAGCCTCAGGGTGG + Intronic
1132958083 16:2606963-2606985 AGAACTTTGTGGCAGCAGGTCGG - Intergenic
1132970557 16:2686211-2686233 AGAACTTTGTGGCAGCAGGTCGG - Intronic
1133036294 16:3036092-3036114 GGACCTCTGAGTCTGGAGGGTGG - Intronic
1133196676 16:4175806-4175828 AGATCACTGTGGCTGCAACGTGG - Intergenic
1133507965 16:6430769-6430791 AGGCCACTCTGGCTGCAGTGTGG + Intronic
1135295894 16:21278784-21278806 AGACATCTGGGGGTACAGGGGGG - Intronic
1135743575 16:24997491-24997513 AGATCCCTCTGGCTGCAGTGTGG + Intronic
1136124263 16:28166056-28166078 AGACCTCTCTGCCTGCATAGTGG - Intronic
1136124266 16:28166079-28166101 AGACCTCTCTGCCTGCATAGTGG - Intronic
1136274534 16:29170636-29170658 GGACATCTGTGCCTGTAGGGCGG - Intergenic
1137590427 16:49690032-49690054 ACACCCCTGGGGGTGCAGGGAGG - Intronic
1138393051 16:56683887-56683909 AGGCCTCTGTTGGGGCAGGGAGG + Intronic
1138515585 16:57534017-57534039 AGACCTGTCTGGCTGTTGGGAGG - Intronic
1139296931 16:65909398-65909420 GGGCCTCTGGGGCTGCAGGCAGG - Intergenic
1139706806 16:68746632-68746654 AGAACTCTATGGATGCAAGGAGG + Intronic
1139728855 16:68924995-68925017 AGAACTCTGTGGATGCAAAGAGG + Intronic
1140016548 16:71192363-71192385 AGGTCACTGTGGCTGCAGCGTGG - Intronic
1141000604 16:80303957-80303979 AGACGTCTCTGTCTGCAGTGTGG - Intergenic
1141611723 16:85185442-85185464 TGACTTCTGGGGCTGCTGGGAGG - Intergenic
1141639532 16:85333333-85333355 TGGCCTCTGGGGCTGCTGGGAGG - Intergenic
1142078820 16:88136290-88136312 GGACATCTGTGCCTGTAGGGCGG - Intergenic
1142385068 16:89758854-89758876 AGACCTCACTGTCTGCAGGGTGG + Intronic
1142684953 17:1572261-1572283 GGACCTCTGTGGCGGGGGGGGGG - Intronic
1143352863 17:6301696-6301718 AGACTTCTGTGCCTGCTTGGGGG - Intergenic
1144210967 17:13015138-13015160 TGACCTCTCTGGCTGCTGTGTGG + Intronic
1144384845 17:14739821-14739843 TGTCCTCTGTGGCTACAGAGGGG + Intergenic
1144461342 17:15460898-15460920 AGGACACTGTGGCTGGAGGGTGG - Intronic
1144886595 17:18467268-18467290 AGACCACTGGGGCTACAGTGTGG + Intergenic
1145097345 17:20042232-20042254 GGACCCCTGTTGCTGCTGGGTGG + Intronic
1145145617 17:20477040-20477062 AGACCACTGTGGCTACAGTGTGG - Intergenic
1146273534 17:31499813-31499835 AGATCTTTGTGGCTTCAGGTAGG + Intronic
1146641836 17:34547611-34547633 AGACCTCTGGAGCTGCACTGAGG + Intergenic
1147479950 17:40751053-40751075 AGAGATCTGCTGCTGCAGGGAGG + Exonic
1147629843 17:41922954-41922976 GAACCTCTGTGGGTGCATGGTGG - Intronic
1148069853 17:44902372-44902394 AGACGTCTCGGGCTGGAGGGGGG - Exonic
1148555919 17:48578500-48578522 AAACCTCTTTGGCTGGAGTGGGG - Exonic
1148712112 17:49689471-49689493 AGCTCACTCTGGCTGCAGGGTGG - Intergenic
1148745210 17:49914225-49914247 AGCCCTCTGTTGCTCCAGGCGGG + Intergenic
1148887856 17:50786619-50786641 AGACCTCTGAGGCAGGAGAGAGG + Intergenic
1148966195 17:51438061-51438083 AGATCTCTGGGACTGCACGGTGG + Intergenic
1149510884 17:57240426-57240448 AGACCTCTTTGGCTACTGTGAGG + Intergenic
1149636998 17:58179038-58179060 AGAGCTCTGAGGCTGCAGGAGGG + Intergenic
1151365525 17:73613944-73613966 AGATCTCTCTGGCTGCACTGTGG - Intronic
1152033750 17:77859227-77859249 AGCCCCCTGTGCCAGCAGGGAGG + Intergenic
1152257052 17:79246229-79246251 AGCCCCCTGTGGCATCAGGGAGG - Intronic
1152278405 17:79371438-79371460 AGAGCTCCCTGGCTGCAGAGTGG + Intronic
1152482190 17:80561750-80561772 AGATCCCTGTGGCTGCAGACTGG + Intronic
1152640438 17:81447191-81447213 AGGCTCCTGGGGCTGCAGGGAGG - Exonic
1152678620 17:81654268-81654290 AGGACACAGTGGCTGCAGGGCGG - Intronic
1152790943 17:82279175-82279197 ACACCTCTCTGGCTGCGGTGGGG - Intergenic
1203170054 17_GL000205v2_random:140446-140468 AGTCCCCTGTGGCTGCAAGATGG - Intergenic
1153692640 18:7608825-7608847 AGAGCTCTCTGGGAGCAGGGTGG + Intronic
1153789497 18:8564918-8564940 AGGCCTCAGTGGCTGCAGTGGGG - Intergenic
1154153844 18:11928510-11928532 AGAAATCTGTGGCTGCTGCGCGG - Intergenic
1155246957 18:23919843-23919865 AGACTGCTCTGGCTGTAGGGGGG + Intronic
1158001203 18:52621354-52621376 AGAACTCTGTGTCTGAAGGTTGG + Intronic
1159475603 18:68916907-68916929 AGCCCTGTGTGGCTGGAGAGAGG + Intronic
1159720953 18:71889490-71889512 AGAACTCAGTGGCTGCTGTGTGG - Intergenic
1160227892 18:77025383-77025405 AGGTCCCTGTGGCTGCAGGCGGG - Intronic
1160445061 18:78921397-78921419 AGACCTCTGTGGCTGCTGGGGGG - Intergenic
1160511566 18:79456112-79456134 TAAGCTCTGTGGCTGCTGGGTGG - Intronic
1160851435 19:1194755-1194777 AGACCCCTCTGGCTGCTGCGGGG + Intronic
1161043057 19:2120378-2120400 AGACCCCTGTGCCTCCAGAGGGG + Intronic
1161581909 19:5085768-5085790 AGGCCTCTGTGGCCGTCGGGGGG + Intronic
1161687827 19:5712108-5712130 AGACCTCTGGAGCCACAGGGTGG + Intronic
1161818975 19:6517233-6517255 GGTCCTCTGTGGGTACAGGGTGG + Intergenic
1162150211 19:8639662-8639684 TGTCCTCTCTGGCTGCTGGGTGG + Intergenic
1162935423 19:13979359-13979381 AGGCCCCTGAGGCCGCAGGGAGG - Intronic
1163020246 19:14477739-14477761 GGACCTGTGTGGCTTCGGGGTGG - Intronic
1163152817 19:15425021-15425043 AGGCCTCGGTGGCTGCGGGGCGG + Exonic
1163289569 19:16370524-16370546 AGGCCTGGGGGGCTGCAGGGTGG - Intronic
1163598820 19:18235778-18235800 AGATCAGTGTGGCTGGAGGGTGG - Intronic
1163722824 19:18906370-18906392 AGCCCTCTGTGGATGGAGGTGGG + Intronic
1163765310 19:19160546-19160568 AGACCCCTGAGCCCGCAGGGAGG + Intronic
1164809696 19:31146526-31146548 AGAGCACTTTGGCTGCAGAGAGG + Intergenic
1165110565 19:33499805-33499827 AGCCCTCTTTGACTGCAGGTGGG - Intronic
1165159680 19:33808679-33808701 AGATCTCTCTGGCTGTTGGGTGG + Intronic
1165662677 19:37595251-37595273 TGTCCTCTGTGGGTGCAGAGTGG + Intronic
1165728133 19:38126388-38126410 AGCCCTCTTGGGCTGCAGGTTGG - Intronic
1166000047 19:39872382-39872404 AGACCTTCGGGGCTGCATGGCGG - Exonic
1166070645 19:40385373-40385395 AGACCCTTGTGGCTGGAGGAGGG - Intronic
1166091829 19:40514343-40514365 AGACCTCAGTGGCTGCCATGTGG + Intronic
1166376183 19:42328446-42328468 AGATCTCTCTGGCTGCTGTGTGG + Intronic
1166644153 19:44518816-44518838 AGACTTCTCTGGCTGCTGTGTGG - Intronic
1166762873 19:45235608-45235630 AGGCCTCTGAGGCTGAAGGAGGG + Intronic
1167423140 19:49415397-49415419 TGGCCTGTGTGGCTGCAGGCAGG - Intronic
1167506950 19:49876023-49876045 TGTCCTCTTTGGATGCAGGGAGG + Intronic
1167637891 19:50666188-50666210 TTACCTCTGCCGCTGCAGGGAGG + Exonic
1202674692 1_KI270710v1_random:32108-32130 AGACCTGTATAGCTTCAGGGTGG - Intergenic
926210999 2:10869202-10869224 AGACCTGAGTGGCTGCCCGGAGG - Intergenic
926707478 2:15846956-15846978 AGACCTCACCTGCTGCAGGGTGG + Intergenic
927520324 2:23694452-23694474 AGACCGCTCAGGCTGGAGGGTGG - Intronic
927521477 2:23701356-23701378 AGATCACTGTGTCTGCAGGATGG - Intronic
928171739 2:29008826-29008848 AAACCTCTGTGGCTTCTGTGGGG + Intronic
928253502 2:29702001-29702023 ACATGTCTGTGGCTGCAGTGAGG + Intronic
928528280 2:32164209-32164231 AGATTACTGTGGCTGCAGTGTGG + Intergenic
931551288 2:63449777-63449799 AGACCTAAGTGGCTGCAGCTGGG + Intronic
931717096 2:65037833-65037855 AGGCCACTGTGGCTGAAGTGAGG - Intergenic
931804723 2:65793152-65793174 AGACCTGTGTGACTACAGGTTGG - Intergenic
933218165 2:79654365-79654387 AGACCAGTGTGGCTCTAGGGAGG + Intronic
933833450 2:86228191-86228213 AGACCTCTGTATGTGCAGTGAGG - Intronic
933856581 2:86420050-86420072 AGACCAGAGTGGCTGCAGGAGGG - Intergenic
934902468 2:98171691-98171713 AGATCACTTTGGCTACAGGGTGG + Intronic
936389237 2:112056148-112056170 ACACCCCTGAGGCCGCAGGGAGG + Intronic
937071166 2:119064783-119064805 AGATCACTCTGGCTGCAGAGAGG - Intergenic
937243620 2:120478141-120478163 AGAACTCTGGGGAGGCAGGGAGG - Intergenic
939354934 2:141089187-141089209 AGCCCGCTGTGCCTGAAGGGTGG - Intronic
939428001 2:142065653-142065675 AGATCTTTGTGGCAGCAGGGAGG + Intronic
940680507 2:156779459-156779481 AGACATCTTTGGCTTCAGGAGGG - Intergenic
941630892 2:167883191-167883213 AGGCCTCTCTGGCTGCTGTGTGG - Intergenic
941651111 2:168093751-168093773 AGAGCTCTGAGGCAGCAGTGTGG - Intronic
942218988 2:173750699-173750721 AGAGCTGCGTGGCTGCAGGCTGG - Intergenic
942512991 2:176722672-176722694 AGACTGCTGTGTCTGCAGTGGGG + Intergenic
946450543 2:219775261-219775283 AGATCACTCTGGCTGCAGTGTGG - Intergenic
947593583 2:231397841-231397863 GGCCTTCTGTGGCTCCAGGGTGG - Exonic
948482316 2:238257934-238257956 AGACCAGTGTGGCTGCATGAGGG + Intronic
948571885 2:238922817-238922839 AGACTTCCCTGGCTGGAGGGAGG + Intergenic
948832853 2:240606741-240606763 AGCTCTCTGTGCCTGCAGTGCGG + Intronic
1168862188 20:1053574-1053596 AGGCCTGTCTGGCTGGAGGGAGG - Intergenic
1169265195 20:4163119-4163141 AGACCTCAGTGGCTGTGGGCTGG + Intronic
1169278058 20:4246826-4246848 AGTTCACTGTGGCTGCAGTGTGG + Intronic
1169852968 20:10072897-10072919 AGAGCACTCTGGCTGCAGGAGGG + Intergenic
1170960105 20:21017993-21018015 CCCCCTCTGTAGCTGCAGGGTGG + Intergenic
1170967201 20:21084144-21084166 AGACCAGTGTAGCTGGAGGGAGG + Intergenic
1171297076 20:24027105-24027127 TGACCTCTGTGGCTGGAGTGAGG - Intergenic
1171476775 20:25416024-25416046 AGACCTATGTGGCTGGAGTTTGG + Intronic
1173897058 20:46559168-46559190 AGGCCTCTGTGGCTGCAAGGCGG - Exonic
1173970034 20:47145567-47145589 AGACCTCTCTGGCTGCTGTGTGG + Intronic
1174059256 20:47821067-47821089 AGACCGTGGAGGCTGCAGGGTGG + Intergenic
1174252583 20:49230728-49230750 GGGCCTCTGTGACTGCAGTGGGG + Intronic
1175380659 20:58560207-58560229 AGACCTCTGTGCCTGCACCCAGG - Intergenic
1175461874 20:59157892-59157914 AAACTTCTGGGGCTGCAAGGAGG + Intergenic
1175635807 20:60582066-60582088 AGCACTCTTTTGCTGCAGGGGGG - Intergenic
1176326049 21:5502242-5502264 AGTCCCCTGTGGCTGCAAGATGG - Intergenic
1176331658 21:5553941-5553963 AGTCCCCTGTGGCTGCAAGATGG + Intergenic
1176396099 21:6267010-6267032 AGTCCCCTGTGGCTGCAAGATGG - Intergenic
1176401708 21:6318709-6318731 AGTCCCCTGTGGCTGCAAGATGG + Intergenic
1176435449 21:6670395-6670417 AGTCCCCTGTGGCTGCAAGATGG - Intergenic
1176441058 21:6722094-6722116 AGTCCCCTGTGGCTGCAAGATGG + Intergenic
1176459711 21:6997465-6997487 AGTCCCCTGTGGCTGCAAGATGG - Intergenic
1176465320 21:7049163-7049185 AGTCCCCTGTGGCTGCAAGATGG + Intronic
1176483272 21:7379243-7379265 AGTCCCCTGTGGCTGCAAGATGG - Intergenic
1176488881 21:7430941-7430963 AGTCCCCTGTGGCTGCAAGATGG + Intergenic
1176637246 21:9258072-9258094 AGACCCGTATGGCTTCAGGGTGG + Intergenic
1177075020 21:16561057-16561079 CTAACTCTGTGGCTGCAGGCAGG - Intergenic
1177848728 21:26321625-26321647 AGACCAGTGTGGATGAAGGGAGG + Intergenic
1178534867 21:33403267-33403289 GGGCCTCTGCGGCTGCAGCGCGG - Exonic
1179508147 21:41855460-41855482 AGAGCTCTCTTCCTGCAGGGAGG - Intronic
1179910366 21:44444223-44444245 TGACCTCTGTGGCTGCTGCACGG - Intergenic
1180124412 21:45779173-45779195 AGACCTCAGTGGCTACAGCAAGG - Intronic
1180287172 22:10758887-10758909 AGATTGCTGTGGCAGCAGGGAGG - Intergenic
1181003724 22:19999696-19999718 AGGCCTGGGTGGCTGGAGGGAGG + Intronic
1181744322 22:24945286-24945308 AGACCACTCTGGCTCCTGGGTGG + Intronic
1181964452 22:26646834-26646856 CGGCCTCTGTGTCTGCAGAGAGG + Intergenic
1183002664 22:34874612-34874634 CCACCTCTGGGGGTGCAGGGGGG + Intergenic
1183382816 22:37498882-37498904 TGCCCTCTGTGGGTGCTGGGGGG + Intronic
1183431329 22:37767693-37767715 AGCCCTCAGAGTCTGCAGGGGGG + Intronic
1183731951 22:39623073-39623095 GGACCGCTGAGGCTGCAGGCGGG + Intronic
1184040429 22:41939960-41939982 GGACCCCTCTGGCTGCCGGGAGG - Intronic
1184232744 22:43167476-43167498 AGAGCCCTGTGGGTGCAGTGTGG + Exonic
1184286832 22:43476742-43476764 GGACCTCACTGGCTGCAGGGAGG - Intronic
1184287061 22:43477736-43477758 GGACCTCACTGGCTGCAGGGAGG - Intronic
1184468345 22:44681955-44681977 AGAGCACAGTGGCTGGAGGGAGG + Intronic
1184991285 22:48171619-48171641 AGACCTGTCTGGCTGCAGCCTGG + Intergenic
949575338 3:5333225-5333247 AGATCACTGTGGCTGCTGGGTGG + Intergenic
949899113 3:8795161-8795183 AGATGTCTCTGGCTGCTGGGTGG + Intronic
950304726 3:11909139-11909161 GGACGTCAATGGCTGCAGGGAGG + Intergenic
950472222 3:13193418-13193440 AGAGCTCTCTGGCTACAGAGTGG + Intergenic
950503263 3:13377593-13377615 AGGCCTCAGGGGCAGCAGGGTGG + Intronic
950967595 3:17156675-17156697 GGACCTCAGAGGCTGCTGGGAGG - Intergenic
951219637 3:20055606-20055628 AGACCTGTGTGGCTAGATGGAGG + Intronic
952338843 3:32428294-32428316 CGGACTCTGAGGCTGCAGGGAGG - Intronic
953044364 3:39281624-39281646 AGAGCTCTCTGGCTTCTGGGTGG - Exonic
953408691 3:42675128-42675150 AGAGCTCTGTGGATGGATGGTGG - Intergenic
953566018 3:44032712-44032734 TCACATCTGTGGCTGCAGGCAGG - Intergenic
953811988 3:46120755-46120777 AGCTCTCTGTGCCTGTAGGGTGG + Intergenic
954114684 3:48459889-48459911 AAACCCTGGTGGCTGCAGGGGGG - Exonic
954148451 3:48645864-48645886 ACTGCCCTGTGGCTGCAGGGCGG - Exonic
954292943 3:49659285-49659307 GGACCTCTGTGCCTGCAGCCAGG - Intronic
955031571 3:55226860-55226882 AAACATCTGGGGCTGCACGGTGG + Intergenic
955756569 3:62230798-62230820 AGACATTTGTGGCAGAAGGGAGG + Intronic
958065441 3:88539612-88539634 TGACCTCTCGGGCTGCAGGCTGG - Intergenic
958712297 3:97732033-97732055 AGCTCACTGTGGCTGCAGTGCGG - Intronic
960956237 3:123033515-123033537 GGACCTCTGTGGCTTCACGCTGG - Intergenic
961357205 3:126346652-126346674 AGGACCCTGTGGCAGCAGGGAGG - Intronic
961487631 3:127227735-127227757 AGGCCACTGTGGCTGCAGCTGGG + Intergenic
961657393 3:128450778-128450800 AGACCACTGTGGCTGGCAGGTGG - Intergenic
961661737 3:128472611-128472633 AGACTCCTGCAGCTGCAGGGAGG + Intergenic
961781920 3:129325454-129325476 AGGCCTCAGGGGCAGCAGGGTGG + Intergenic
961961240 3:130857575-130857597 AGACCTCTCTGACTGTAGTGTGG - Intronic
962599001 3:136976383-136976405 TGACCTCTGTGGCTACAGCCTGG + Intronic
963757479 3:149250730-149250752 AGGCCTGTGTGTCTGGAGGGAGG + Intergenic
967480154 3:189963419-189963441 ACAACTCTGTGGCATCAGGGAGG - Intronic
967484287 3:190012331-190012353 AGATCACTCTGGCTGCAGTGTGG - Intronic
1202749648 3_GL000221v1_random:146947-146969 AGACCCGTATGGCTTCAGGGTGG - Intergenic
968517163 4:1020257-1020279 AGACAGCAGTGGCTGCAGTGCGG + Intronic
968612441 4:1563420-1563442 GGGCCTCTAGGGCTGCAGGGAGG - Intergenic
968657193 4:1783706-1783728 AGGCCTCTGTGGGGCCAGGGAGG + Intergenic
969282341 4:6179196-6179218 AGCCCTATGTGGCTGGAGAGAGG + Intronic
970168494 4:13264818-13264840 AGGCCACTGAGGCTGCATGGAGG - Intergenic
971306629 4:25488170-25488192 AGATCCCTCTGGCTGCAGTGTGG + Intergenic
972352150 4:38245735-38245757 ACAGCTGTGTGGCTGCAGGCAGG - Intergenic
975009452 4:69330862-69330884 AGCACACTGTGGCTGCTGGGTGG - Intronic
975096286 4:70460862-70460884 ACACCTATGTGGCTGCAGTAGGG - Intronic
975147163 4:70980894-70980916 AGACCTCTTGAGGTGCAGGGTGG + Intronic
975463688 4:74685282-74685304 AGAGGTCTGTGGCTGCATGGTGG + Intergenic
980137352 4:128871578-128871600 AGACCTGTGTGGTAGAAGGGAGG + Exonic
983641687 4:169949257-169949279 AGATCCCTTTGGCTACAGGGAGG - Intergenic
984655549 4:182313916-182313938 AGATCTCTCTGGCTGAAGGATGG - Intronic
984730068 4:183059929-183059951 AGAGTTCTGTGGCTGGATGGTGG - Intergenic
984962536 4:185111618-185111640 AGACCTCTCTGGCTTCAATGTGG + Intergenic
985558568 5:570071-570093 AGACCCCTGGGGCTGCATGCTGG + Intergenic
985913594 5:2901292-2901314 AGACCTGGGAGGCTCCAGGGTGG + Intergenic
986167581 5:5288887-5288909 CGACCTCTGTGGCTGCAGACAGG + Intronic
986380948 5:7185283-7185305 AGAACTCTGTGACTGAGGGGTGG - Intergenic
986396230 5:7333421-7333443 AGATCCCTGAGGCTACAGGGAGG - Intergenic
987216255 5:15740471-15740493 AGAGCTCTGTGCCTGAATGGGGG - Intronic
988483466 5:31648637-31648659 AGACCCCTCTGGCTGCTCGGAGG - Intronic
989499165 5:42146018-42146040 AGAAGTTTGTGGCTGCAGGCAGG + Intergenic
991381489 5:66032623-66032645 AGGCCTTTTTGGCTGCATGGTGG + Intronic
993075605 5:83226352-83226374 ACCCCTCTGGGGCTGGAGGGAGG + Intronic
994699288 5:103113147-103113169 TGACCTCTGTGACTGCAGTGAGG - Intronic
995446851 5:112254433-112254455 AGCACACTCTGGCTGCAGGGTGG - Intronic
995806992 5:116064121-116064143 AGACCACACTGGCTGCAGTGAGG + Intergenic
996310289 5:122096611-122096633 ATCCCTCTGTCTCTGCAGGGAGG + Intergenic
996873237 5:128215336-128215358 AGACCTCTTGGGCAGCTGGGAGG - Intergenic
997200930 5:132009877-132009899 GATCTTCTGTGGCTGCAGGGAGG - Intronic
997352478 5:133240871-133240893 TGCCCTCTTTGGCTACAGGGAGG + Intronic
998097978 5:139408019-139408041 AGATCTCTTTGGTTGCAGTGAGG + Intergenic
998147867 5:139740501-139740523 AGAACCCTGAGGCTTCAGGGCGG + Intergenic
998623809 5:143823302-143823324 GGACCACTGTGGTTGCAGTGTGG - Intergenic
998916427 5:147017029-147017051 AGATTGCTCTGGCTGCAGGGTGG + Intronic
999247030 5:150160529-150160551 AGACCTCGGTGGCTACAGTCTGG - Intergenic
999906811 5:156150006-156150028 AGACCACTCTAGCTGCTGGGTGG - Intronic
1000214299 5:159139939-159139961 CGACCTCTGAGGCTGCAGCCTGG + Intergenic
1001249454 5:170135567-170135589 AGATATCTGTGGCTGCTGAGAGG + Intergenic
1001860208 5:175047759-175047781 AGACCTCTGGGGCAGGAGGGTGG + Intergenic
1002063507 5:176640626-176640648 AGAACCCTGTGGCTGCAAGAAGG - Intronic
1002569340 5:180131142-180131164 AGACCTCTGTGGCTGCAGGGTGG - Intronic
1002904280 6:1436377-1436399 AGCAATCTGTGGTTGCAGGGTGG + Intergenic
1003344911 6:5257922-5257944 AGACCTGTTTGGCTGGTGGGAGG + Intronic
1003989961 6:11476487-11476509 ACACCTCTCTGGCTGCTGCGTGG + Intergenic
1003994550 6:11525882-11525904 AGCCCTCTTTGGTTGCAGGGAGG + Intergenic
1004010595 6:11682306-11682328 AGATCCCTTTGGCTGAAGGGAGG - Intergenic
1004206040 6:13592489-13592511 AGCTCTCTGAGGCTCCAGGGCGG - Intronic
1004433736 6:15569671-15569693 AGGCCTCTGTGGCTGGAATGTGG - Intronic
1004595123 6:17092426-17092448 AGGCCAATGTGGCTGCATGGGGG - Intergenic
1004863795 6:19834456-19834478 AGACCTCTTTGTCTGGAGGAAGG + Intergenic
1004879614 6:19994902-19994924 AAAACTGTGTGGTTGCAGGGTGG - Intergenic
1004899736 6:20183078-20183100 AGTTCTCTGTGGCTACAGGTTGG - Intronic
1005991101 6:30902684-30902706 AGATAACTGTGGTTGCAGGGTGG - Intergenic
1006282814 6:33069058-33069080 GGACTTCTATGACTGCAGGGTGG - Exonic
1006430881 6:33995047-33995069 GGAGCTCTGGGGCTGCAGGTCGG - Intergenic
1006849001 6:37083793-37083815 AGAGCCCTGTGGCTGGAGCGGGG - Intergenic
1007957889 6:45933781-45933803 ACACGCCTGAGGCTGCAGGGAGG + Intronic
1008103421 6:47417156-47417178 AGACTTCTGGGGATGCATGGTGG - Intergenic
1011342053 6:86327121-86327143 AGACCTCTCTGACTTCAGTGTGG + Intergenic
1012122294 6:95384077-95384099 ACACCTCTGAGCCTGCAGTGGGG - Intergenic
1012239062 6:96851473-96851495 AGACCTGTGTGGCTGGAGAAAGG + Intergenic
1012382789 6:98640261-98640283 AGACCTCAGTGCCTGAAGGCTGG - Intergenic
1013431541 6:110060843-110060865 AGAGCTCTGTGGCAGCAGCCTGG - Intergenic
1013751661 6:113414310-113414332 AGGCCTCTGTGGCTGGAAGCTGG + Intergenic
1013758126 6:113484525-113484547 AGGCCTCTGTGGCTGGAAGCTGG - Intergenic
1013988431 6:116224826-116224848 AGACTACTTTGGCTGCTGGGTGG + Intronic
1015140689 6:129928189-129928211 GGAACTCTGAGGCTCCAGGGGGG - Intergenic
1015207153 6:130652786-130652808 AGATCTTTGTGGCTGGAGGTGGG - Intergenic
1015654373 6:135499981-135500003 AGATAACTCTGGCTGCAGGGTGG + Intergenic
1015828484 6:137341947-137341969 AGTGCGATGTGGCTGCAGGGTGG + Intergenic
1017414801 6:154208235-154208257 AGCCCTCTGTGGCTGACGCGGGG - Intronic
1018095568 6:160384642-160384664 AGACCCCTGGGGCTGCCTGGAGG - Intronic
1018706665 6:166468498-166468520 AGAGGTCTGGGGCTGCAGGTGGG + Intronic
1018786055 6:167108765-167108787 AGTCCTCGAGGGCTGCAGGGTGG + Intergenic
1019752221 7:2738436-2738458 AGAGCTCCGTGGCTGGAAGGAGG + Intronic
1019821468 7:3246329-3246351 TGACTGCTGTGGTTGCAGGGAGG - Intergenic
1020028861 7:4919231-4919253 AGCCCTTGCTGGCTGCAGGGTGG - Intronic
1020848855 7:13323257-13323279 AGACATTTGTGGCTGAAAGGAGG - Intergenic
1020899801 7:13990436-13990458 AGTCCACTGTGGCTGTGGGGAGG + Intronic
1022623259 7:32006883-32006905 AGAGCACTGTAGCTGGAGGGTGG - Intronic
1022958170 7:35400441-35400463 AGGCCGGTGTGGCAGCAGGGAGG + Intergenic
1023526375 7:41107774-41107796 AGGCCTGTCTGGCTGCAGGTAGG + Intergenic
1023559911 7:41463032-41463054 AGCTCACTGTGGCTGGAGGGAGG - Intergenic
1024655573 7:51448725-51448747 AGCTCTCTGTGGCTACAGCGTGG - Intergenic
1024877983 7:54047463-54047485 AGATCTCTCTGGTGGCAGGGTGG - Intergenic
1026093212 7:67318339-67318361 TGGCCTCTGTGGGTGCAGGAAGG - Intergenic
1026269317 7:68822659-68822681 AGACATCTGTGGCAGAAGAGTGG + Intergenic
1026402863 7:70033463-70033485 AGATCTGTGTGGCTCTAGGGTGG + Intronic
1026658110 7:72275111-72275133 AGGCTGCAGTGGCTGCAGGGTGG + Intronic
1028233830 7:88336729-88336751 AGACCTCTGTGGGTGAGGTGTGG + Intergenic
1028894461 7:96025512-96025534 AGAACTCTGGTGCTGCAAGGTGG + Intronic
1030684028 7:112465106-112465128 AGAACTCTGAGGCTGCAGTGAGG - Intronic
1033723198 7:144084125-144084147 AGACCTCTCTGGCCTCAGGTGGG + Intergenic
1034420870 7:150989961-150989983 AGCACTCTGTGGCCACAGGGAGG - Intergenic
1034602877 7:152279790-152279812 AGATTACTGTGGCAGCAGGGAGG - Intronic
1035230489 7:157463029-157463051 TGTCCTCTGTGGCAGCAGCGTGG + Intergenic
1035245893 7:157561774-157561796 AGGAGTCTGTGGCTGCAGGGTGG - Intronic
1035455363 7:159005495-159005517 AGGCCCTTGTGGCTGCAGGGTGG + Intergenic
1035471082 7:159109330-159109352 AAACCTGTGAGGCGGCAGGGAGG + Intronic
1035555631 8:565381-565403 TGAGCTGTGTGGCTGGAGGGAGG - Intergenic
1036039528 8:5060068-5060090 AGACCTCTGTGGCTTGAGAAGGG + Intergenic
1036076428 8:5507381-5507403 GGGCCTCTGTGGCTGCAGAAAGG - Intergenic
1036441946 8:8789445-8789467 AGAGGTCTGGGGCTGAAGGGAGG + Intronic
1037329947 8:17734562-17734584 AGATGTCTGTGGCTTCAGGTGGG + Intronic
1037409634 8:18582795-18582817 AGATCAGTGTGGCTGCAGGTTGG - Intronic
1037940520 8:22947714-22947736 AGTCCTCTGTAGCTCCAGAGGGG + Intronic
1039916892 8:41866561-41866583 AGAGTTCTGTGGCTGGATGGTGG - Intronic
1039997835 8:42549633-42549655 AGAGCTCTGTGGATGGATGGTGG + Intronic
1040034660 8:42858779-42858801 AGAGCAGGGTGGCTGCAGGGTGG + Intronic
1040294785 8:46143558-46143580 AGAAAAATGTGGCTGCAGGGTGG - Intergenic
1040582872 8:48711646-48711668 AGACCCTCGTGGCTGCAGGCTGG - Intronic
1043538972 8:81238021-81238043 AATCCTTTGTGGCTGAAGGGAGG + Intergenic
1043977343 8:86598202-86598224 AGATCCCTCTGGCTGCAGAGTGG + Intronic
1043993854 8:86788658-86788680 TGGCCTCCCTGGCTGCAGGGTGG + Intergenic
1044096850 8:88077425-88077447 AGACCTGTGTGAGTGCAGTGAGG - Intronic
1045977370 8:108145000-108145022 GGACCAGTGTGGCTGCAGTGAGG + Intergenic
1048363347 8:133716606-133716628 AGTCCTCTGTGGCTGCATCATGG + Intergenic
1048863212 8:138739250-138739272 AGGCCACTGTGGCTGGAGGTGGG - Intronic
1049504186 8:142986052-142986074 AGACAGCTGGGGCTGCCGGGTGG - Intergenic
1051566572 9:18505992-18506014 AGACCATTTTGGCTCCAGGGAGG + Intronic
1052827084 9:33185067-33185089 AGACAGCTGTGGCTGGAGGCTGG - Intergenic
1052852868 9:33388377-33388399 AGATCACTCTGGCTGCAAGGAGG - Intronic
1053175273 9:35917877-35917899 AGAGCTCTCTGGCGGCCGGGTGG - Intergenic
1055700605 9:78940985-78941007 TGACCTCTTTGGAGGCAGGGAGG + Intergenic
1056580420 9:87885399-87885421 GGACCTCTATTGCTGGAGGGAGG + Exonic
1056581116 9:87888553-87888575 TGACCCCTGTGGCAGCAGGAAGG - Exonic
1057182989 9:93039860-93039882 AGGCCCCCATGGCTGCAGGGAGG - Intergenic
1057279276 9:93698518-93698540 GGGCCTGTGTGGCTGCATGGAGG - Intergenic
1057434134 9:95023699-95023721 AGACCTCTGTAGTTGCTGGGAGG - Intronic
1057454911 9:95199333-95199355 AGAGGGCTGTGGGTGCAGGGTGG - Intronic
1057902002 9:98956672-98956694 AGATTACTGTGGCTGCAGTGTGG - Intronic
1058103957 9:100949149-100949171 GGACATCTGTGTTTGCAGGGTGG + Intergenic
1058709841 9:107669633-107669655 ATACCCCTGTGGCTGCACAGCGG - Intergenic
1059186576 9:112278346-112278368 AGCTCTCTATGCCTGCAGGGAGG - Intronic
1059465541 9:114466844-114466866 AGACCCCTGGGGAAGCAGGGTGG - Intronic
1059762765 9:117354700-117354722 AGGCCTGTGTTGCTGGAGGGAGG - Intronic
1060224984 9:121785043-121785065 AGGCCTCTGTGCTAGCAGGGAGG - Exonic
1060301319 9:122376078-122376100 AGACCTCTGAGCCAGCACGGGGG + Intronic
1060758595 9:126230057-126230079 AGCCCACTCTGGCTGCAGAGTGG + Intergenic
1061786096 9:133029626-133029648 AGACCTCTCTGGCTGTTGTGTGG - Intergenic
1061847313 9:133394956-133394978 AGGTCACTCTGGCTGCAGGGAGG + Intronic
1062018975 9:134307350-134307372 GGACCCCTGGGGCTGCTGGGTGG - Intergenic
1062107071 9:134761535-134761557 CGAGCTCTGAGGCTGCAGGCAGG + Intronic
1062348857 9:136128936-136128958 AGACTTCTGTGGATGGAGGGAGG + Intergenic
1062363035 9:136196568-136196590 AGACATCTGTGGGTGCAGCCTGG + Exonic
1062394155 9:136346003-136346025 TGACCACTGTGGCCACAGGGTGG + Intronic
1062684370 9:137802717-137802739 AGGCCTGCGTGCCTGCAGGGAGG - Intronic
1203430441 Un_GL000195v1:86393-86415 AGTCCCCTGTGGCTGCAAGATGG - Intergenic
1203436079 Un_GL000195v1:138245-138267 AGTCCCCTGTGGCTGCAAGATGG + Intergenic
1203718291 Un_KI270742v1:177035-177057 AGACCCGTATGGCTTCAGGGTGG - Intergenic
1187206154 X:17183690-17183712 AGTTCCCTCTGGCTGCAGGGTGG - Intergenic
1188163333 X:26829703-26829725 GGACCCCTGTGGCTGCATTGGGG + Intergenic
1189271374 X:39754737-39754759 AGTCCACTCTGGCTGCCGGGTGG + Intergenic
1189985583 X:46550618-46550640 AGAGCTTTGAGGCTGCAGTGAGG + Intergenic
1190248950 X:48707956-48707978 ATACCTTTGGGGCAGCAGGGAGG - Exonic
1191618726 X:63193195-63193217 TGAACTCTGTGGCAGCAGGAGGG - Intergenic
1192198811 X:69050475-69050497 GGACCCCTCTGGCTGCTGGGTGG - Intergenic
1192229413 X:69254883-69254905 AGACCACTCTGACAGCAGGGTGG + Intergenic
1192230165 X:69259088-69259110 AGTCCTCTGTGGGTTGAGGGAGG - Intergenic
1196314007 X:114201811-114201833 AGAGCCCTGAGGCTGAAGGGAGG + Intergenic
1196871716 X:120118730-120118752 AGATCACTCTGGCTGCTGGGTGG - Intergenic
1198422381 X:136480805-136480827 AGTGCTGTGTGGCTGAAGGGTGG - Intergenic
1199601352 X:149543259-149543281 AGGCCTGTGTGGCTTCAGGGTGG + Intronic
1199649025 X:149936225-149936247 AGGCCTGTGTGGCTTCAGGGTGG - Intronic
1199785795 X:151103762-151103784 AGACCTCTGAGGATGCAGTGTGG + Intergenic
1200162176 X:154015239-154015261 AGAGCACTTTGGCTGCAGGGTGG + Intronic
1201080053 Y:10234240-10234262 AGACCTTTGTGGCTGATGGTGGG - Intergenic
1201172444 Y:11281885-11281907 AGACCTGTATAGCTTCAGGGTGG - Intergenic