ID: 1002570122

View in Genome Browser
Species Human (GRCh38)
Location 5:180135474-180135496
Sequence CTGGAAGGGGGAAACGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 1, 2: 1, 3: 33, 4: 352}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002570122_1002570133 15 Left 1002570122 5:180135474-180135496 CCGCCCACGTTTCCCCCTTCCAG 0: 1
1: 1
2: 1
3: 33
4: 352
Right 1002570133 5:180135512-180135534 TGCTGCCCACAGTGGCGCCCTGG 0: 1
1: 0
2: 1
3: 15
4: 211
1002570122_1002570131 7 Left 1002570122 5:180135474-180135496 CCGCCCACGTTTCCCCCTTCCAG 0: 1
1: 1
2: 1
3: 33
4: 352
Right 1002570131 5:180135504-180135526 TACACCAGTGCTGCCCACAGTGG 0: 1
1: 0
2: 1
3: 17
4: 202
1002570122_1002570134 16 Left 1002570122 5:180135474-180135496 CCGCCCACGTTTCCCCCTTCCAG 0: 1
1: 1
2: 1
3: 33
4: 352
Right 1002570134 5:180135513-180135535 GCTGCCCACAGTGGCGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002570122 Original CRISPR CTGGAAGGGGGAAACGTGGG CGG (reversed) Intronic
902373642 1:16019918-16019940 CGGGAAGGGGGAAAAAGGGGAGG - Intronic
902438688 1:16415227-16415249 CTTGAAGGGGCTAAGGTGGGAGG + Intronic
902519850 1:17010084-17010106 GGGGAAGGGGGGAACGGGGGGGG - Intronic
902770739 1:18644074-18644096 CTGGAAGAGGGGAAAGTGGCCGG - Intronic
903012937 1:20343586-20343608 CTGGAAGGGGAAGAGGTGGGCGG - Intronic
903147069 1:21381200-21381222 GTGGAAGGGGGAATAGAGGGTGG - Intergenic
904022529 1:27478542-27478564 CTGGAAGGAGGGAACTTTGGAGG + Intronic
904409779 1:30318592-30318614 CTGACAGGGAGAAAGGTGGGCGG - Intergenic
905353716 1:37366105-37366127 TTGGAATGGGGACACGTGGGAGG + Intergenic
905680939 1:39870063-39870085 GTGGAAGGGGGGAAAGTGTGGGG + Intronic
907324358 1:53627201-53627223 CTGGGAGGGGGAGGTGTGGGCGG + Intronic
907673666 1:56499079-56499101 CTTGAAGGGGGGAAGGTGGGGGG - Intronic
910427194 1:87129790-87129812 CGGGAAGGGAGAAGAGTGGGAGG + Intronic
910587853 1:88899057-88899079 TTGGAATGGGGACATGTGGGAGG + Intergenic
910948059 1:92615493-92615515 TTGGAATGGGGACATGTGGGAGG + Intronic
912252193 1:108022473-108022495 TTGGAATGGGGACATGTGGGAGG - Intergenic
915003333 1:152613602-152613624 CTGGAAGAGGGAAAAATGGAAGG + Intergenic
915463062 1:156081281-156081303 CTGGAAGAGGGAAAGGGGAGGGG - Intronic
915668020 1:157462325-157462347 TTGGAATGGGTATACGTGGGAGG - Intergenic
916988264 1:170214713-170214735 GTGGAAAGGGGAAACGTGGGTGG + Intergenic
917735976 1:177920882-177920904 CTGGAAAGGGGAGAGGTGGTGGG - Intergenic
922738331 1:228001797-228001819 CTGTGAGGGGGAAACGGGGATGG + Intergenic
922849038 1:228716264-228716286 CAGGAAGGGGGCAAGGTGTGGGG - Intergenic
923013088 1:230104527-230104549 CTGGGTGGGGGAAATGCGGGAGG + Intronic
923477239 1:234345604-234345626 CTGGTAGGGGGAATCCTGAGAGG - Intergenic
923703170 1:236319091-236319113 CTGAAAGGGGGAAAGGTAAGGGG + Intergenic
1063059149 10:2532813-2532835 CTGGAAGGGAGCAACGTTGCAGG + Intergenic
1063208431 10:3856415-3856437 CTGGAGGGAGGAAAGGTTGGAGG - Intergenic
1063922450 10:10945898-10945920 CAGCAGGGGGAAAACGTGGGAGG - Intergenic
1064518012 10:16170907-16170929 TTGGAATGGGGACATGTGGGAGG - Intergenic
1065384235 10:25117709-25117731 CAGGAAAGGGGAAATGTGGAGGG + Intergenic
1065655920 10:27949751-27949773 CTGGAGGGGGCAAGCGTGGATGG + Intronic
1066086336 10:31975315-31975337 TTAGAGAGGGGAAACGTGGGTGG + Intergenic
1066221571 10:33339810-33339832 CTGGAAGGAGGAGATGTGGAGGG + Intergenic
1067332788 10:45337543-45337565 TTGGAAAGGGGACATGTGGGAGG + Intergenic
1068838706 10:61586273-61586295 CCAAAAGGGGGAAACGTGAGTGG + Intergenic
1069580090 10:69559909-69559931 CTGGAAAGGGGAAAAGACGGAGG + Intergenic
1071267456 10:83976665-83976687 TTGGAATGGGGATATGTGGGAGG - Intergenic
1071629224 10:87204403-87204425 GTGGGAGGGGGGAAGGTGGGGGG + Intergenic
1072209619 10:93234364-93234386 CTGGAATGGGGATGTGTGGGAGG - Intergenic
1076648049 10:131967212-131967234 CTGTGAGGGGGACACGTGGTTGG + Exonic
1076893395 10:133296208-133296230 CCTGAATGGGGAAACATGGGGGG + Intronic
1077036388 11:496860-496882 CCGCAAGGGAGAAAGGTGGGCGG + Intronic
1078210220 11:9264788-9264810 CTGGAGGGGGGAAACGGATGAGG - Intronic
1078415404 11:11160734-11160756 GTGGAAAGGGGACACGGGGGTGG - Intergenic
1078495755 11:11814748-11814770 CAGAAAGGGGAAAATGTGGGAGG + Intergenic
1078746036 11:14115072-14115094 CTGTAAGAGGCAAAGGTGGGAGG - Intronic
1079293398 11:19209503-19209525 AGGGAAGTGGGAAACCTGGGTGG - Intronic
1081590021 11:44416119-44416141 TTGGAATGGGGACATGTGGGAGG + Intergenic
1081608677 11:44545163-44545185 TTGGAATGGGGACATGTGGGGGG + Intergenic
1082162502 11:48900583-48900605 CTGGCAGCGGGACAGGTGGGAGG + Intergenic
1083257501 11:61505739-61505761 CTGGGAGGGGGAAGCAGGGGAGG - Intergenic
1083332469 11:61905349-61905371 CTGGGAGGGGGCAAAGTGGGAGG + Intronic
1083334100 11:61912876-61912898 TGGGAAGGGGGAATTGTGGGAGG + Intronic
1083952542 11:65965008-65965030 CTGGAAGGGGGCAGGGTGAGTGG + Intronic
1084723956 11:70928298-70928320 CTTGAAGGGGGAAAACTGGAAGG + Intronic
1085396558 11:76209692-76209714 TTGGAAGTGGGAAGGGTGGGTGG + Intronic
1086342120 11:85857385-85857407 CTGGAAGGGCGAAACAGAGGAGG + Intronic
1087607549 11:100394941-100394963 GAGGAAGGGGGAAAGGTTGGGGG - Intergenic
1088397359 11:109383146-109383168 CTAGAAGGGGATAAAGTGGGTGG - Intergenic
1089397204 11:118144204-118144226 CTGGAAGAGGAAACCATGGGGGG - Intronic
1090187201 11:124746331-124746353 CTGAAAGGGGGAAGGGTGGGGGG + Intronic
1091848636 12:3677692-3677714 GTGGAAGGGGCACAGGTGGGTGG - Intronic
1092096790 12:5849608-5849630 CTGGGAGGGGGAATCTTGGAAGG - Intronic
1092917671 12:13203102-13203124 CTGGAAGGCGGCAAGCTGGGAGG - Intronic
1093371404 12:18370223-18370245 CTGGATGGGGTATACGTAGGTGG - Intronic
1093453669 12:19342927-19342949 CTGGGAGGGGGAGATGTGGCAGG - Intronic
1095603721 12:44043413-44043435 TTGGAATGGGGACATGTGGGAGG + Intronic
1095844834 12:46733178-46733200 TTGGAATGGGGACATGTGGGAGG - Intergenic
1096014925 12:48261956-48261978 CTTGAAGGGTGAAGGGTGGGAGG - Intergenic
1096037176 12:48482634-48482656 GTGGGAGTGGGAAAAGTGGGAGG + Intronic
1097019196 12:56007819-56007841 AAGGAGGGGGGAGACGTGGGCGG + Intronic
1097431863 12:59518907-59518929 TTGGAATGGTGAAATGTGGGAGG - Intergenic
1097509353 12:60517671-60517693 CTGGATGTGGGAAAGGCGGGAGG - Intergenic
1099335567 12:81352339-81352361 CAGGAAAAGGGAAAGGTGGGTGG + Intronic
1099375292 12:81891281-81891303 TTGGAATGGGGACATGTGGGAGG + Intergenic
1100082967 12:90875551-90875573 CTGGAATGGGGACATGTAGGAGG + Intergenic
1101263765 12:103063421-103063443 TTGGAATGGGGACATGTGGGAGG + Intergenic
1103004392 12:117409503-117409525 GTGGAAGGGGGATAGATGGGTGG + Intronic
1103638622 12:122330185-122330207 ATGCAAGAGGGAAACTTGGGGGG + Intronic
1105683362 13:22752324-22752346 TTGGAGGGGGGAAAAGAGGGTGG - Intergenic
1106132687 13:26952878-26952900 CTGCAAGGGGGCACCCTGGGTGG - Intergenic
1106552892 13:30787087-30787109 CTGGCAGGGGGAGAGGTTGGTGG + Intergenic
1107490112 13:40873665-40873687 TTGGAATGGGGACATGTGGGAGG + Intergenic
1109713031 13:66183669-66183691 TTGGAATGGGGACACGTGGGAGG - Intergenic
1110014784 13:70386862-70386884 CTGGAGGGGGGCAAGGTGGCAGG + Intergenic
1110281177 13:73696069-73696091 TTGGTAGGGGGAAGCGTGGGGGG - Intronic
1111933499 13:94535887-94535909 CTCGAAGAGGGAAACCTGGGAGG - Intergenic
1112231496 13:97592844-97592866 TTGGAATGGGGACATGTGGGAGG - Intergenic
1113663066 13:112120202-112120224 AAAGAAGAGGGAAACGTGGGAGG + Intergenic
1114980421 14:28157649-28157671 CTGGATGAGGGGAACGTGGTGGG + Intergenic
1117633757 14:57721690-57721712 TTGGAATGGGGACATGTGGGAGG + Intronic
1118128366 14:62935062-62935084 ATGAAAGGTGGAAAAGTGGGGGG + Intronic
1121371012 14:93358597-93358619 TTGGAATGGGGACATGTGGGAGG + Intronic
1122217841 14:100215552-100215574 CTGGATGGGCCACACGTGGGCGG + Intergenic
1122346226 14:101062198-101062220 ATGGACGGGGTAGACGTGGGTGG + Intergenic
1122877051 14:104672439-104672461 GAGGAAGGAGGGAACGTGGGAGG + Intergenic
1123961765 15:25410442-25410464 CTGGATAGGGGAATCGTGAGGGG - Intronic
1127956022 15:63854211-63854233 CTAGAGGGGGGAAAAGGGGGAGG + Intergenic
1128148221 15:65344516-65344538 CTGGATGGGGGAGAGGTGGGGGG + Intronic
1128166851 15:65473081-65473103 CTGGGAGGTGGCAAGGTGGGAGG + Intronic
1128783038 15:70375448-70375470 TTGGAAGGGGGCAAGGTGAGAGG - Intergenic
1129161810 15:73751949-73751971 CTGGCTGGGGGGAAGGTGGGGGG - Intronic
1129376823 15:75138737-75138759 CTGGAAGGGGGACACAGGGAAGG + Intergenic
1130034069 15:80341892-80341914 GGGCAAGGGGAAAACGTGGGTGG + Intergenic
1130395155 15:83494965-83494987 CTGGAAGGGGGAGAGGGAGGAGG - Intronic
1130553340 15:84905716-84905738 TTGGCAGGGGGAAAAGTGGGTGG + Intronic
1130924600 15:88375616-88375638 CTGGAAGAGGGAAATGAGTGAGG - Intergenic
1131241411 15:90747007-90747029 CTGGAAGGGAGCGAGGTGGGAGG - Intronic
1132299950 15:100769131-100769153 CTGGGAGGGCGAGACGTGTGGGG - Intergenic
1132569433 16:637626-637648 TTGGAAGGGGTAAACCAGGGAGG + Intronic
1132571419 16:646016-646038 CTGGAAGTGGGAGAGGTTGGCGG + Intronic
1133322599 16:4923495-4923517 CTGGAAGGGGGCTCCCTGGGTGG + Intronic
1134145815 16:11760630-11760652 CTGGATGGAGGAAATGTGGAGGG - Intronic
1134411848 16:14009901-14009923 GTGGAAGGGGGAGTCGTGGCAGG - Intergenic
1136271813 16:29153032-29153054 GTGCAAAGGGGAAACGTGGCAGG + Intergenic
1136576874 16:31130381-31130403 CTGGGAGGGGGAGACCTGTGGGG + Intronic
1137056479 16:35748738-35748760 CTGGAAAGGGCAAAGGTGGGCGG - Intergenic
1137665794 16:50248223-50248245 CAGGAAGAGGGAGAGGTGGGCGG - Intronic
1139301319 16:65947658-65947680 CAGGAAGGCTGAAATGTGGGAGG + Intergenic
1139470927 16:67177880-67177902 GTGGTAGGGGGGAGCGTGGGTGG - Intronic
1140118198 16:72060935-72060957 CTGGAAGAGGGCAAAGTGGACGG + Exonic
1140120231 16:72077126-72077148 CTGGAAGAGGGCAAAGTGGACGG + Exonic
1141125555 16:81398205-81398227 CTGGCAGGTGCACACGTGGGAGG + Intergenic
1141619032 16:85226994-85227016 ATGGAAAGGGGATGCGTGGGTGG - Intergenic
1141908661 16:87043833-87043855 AAGGGAGGGGGAAACGAGGGTGG + Intergenic
1142127328 16:88416761-88416783 CTGGAAGGGCGAAGGGTGCGTGG - Intergenic
1142131443 16:88433288-88433310 CTGGAAGGGGGCACTGTGGAAGG + Exonic
1142290461 16:89191811-89191833 GTGGAAGGGGGCCCCGTGGGGGG - Exonic
1142352985 16:89588311-89588333 CAGCAAGTGGGAAACGTGGGGGG + Intronic
1142659280 17:1416555-1416577 CTGGAAGGCTGAGAGGTGGGAGG + Intergenic
1143204114 17:5131153-5131175 GGGGAAGGGGGAAAGGTGTGGGG + Intronic
1143519560 17:7437668-7437690 CTGGAATGGGGCAACTTGTGCGG - Exonic
1143598534 17:7929628-7929650 CGGGAGGGAAGAAACGTGGGGGG + Intronic
1144875295 17:18394262-18394284 GGGGAAGGGGGAAAGGTGTGGGG + Intergenic
1144959967 17:19039458-19039480 CTGGCAGGGGGATGTGTGGGGGG - Intronic
1144975193 17:19135066-19135088 CTGGCAGGGGGATGTGTGGGGGG + Intronic
1145156929 17:20550159-20550181 GGGGAAGGGGGAAAGGTGTGGGG - Intergenic
1145261219 17:21355869-21355891 CGGGGAGCGGGAGACGTGGGTGG - Intergenic
1146030447 17:29361689-29361711 CAGAAAAGGGGAAATGTGGGGGG - Intergenic
1146463484 17:33066555-33066577 CAGGAAAGGGGAAACTTGGCAGG + Intronic
1146810998 17:35903188-35903210 CTTCAAGGGAGAAAGGTGGGAGG - Intergenic
1147139491 17:38453472-38453494 CTGGAAGGGTGCAAGGTGTGCGG + Intronic
1147337800 17:39737873-39737895 CTGGGAGGAGGAAACCTGGGAGG - Intergenic
1147660136 17:42112946-42112968 CTGGAGGAGGGAGAGGTGGGGGG + Intergenic
1147911895 17:43861038-43861060 CAAGATGAGGGAAACGTGGGAGG - Intronic
1147981944 17:44280192-44280214 CTGGAAGGGTCAGAAGTGGGAGG - Intergenic
1148059856 17:44829476-44829498 CTGGAAGCGGGAAAGCGGGGCGG - Intronic
1148353536 17:46958394-46958416 CTGGGGGTGGGAAACGTGTGTGG + Intronic
1150611872 17:66739766-66739788 GGGGAAGGGGGGAACGTGGTAGG + Intronic
1151724051 17:75874618-75874640 CTGGAAGGGGTCAATGGGGGAGG + Exonic
1152834569 17:82520526-82520548 CAGGAAGGGGGAAAGACGGGGGG - Intronic
1153814643 18:8782037-8782059 GTGGAAGGAGGAAAGTTGGGAGG + Intronic
1154277920 18:12978182-12978204 ATTAAAGGAGGAAACGTGGGAGG + Intronic
1154465721 18:14641607-14641629 CAGGAATGGGGAAAAGAGGGTGG - Intergenic
1157341045 18:46778887-46778909 TTGGAATGGGGACATGTGGGAGG + Intergenic
1157633360 18:49123569-49123591 CTGGAAGGAGGAGAAGTGGTTGG - Intronic
1160695165 19:480367-480389 CTGGGAGAGCAAAACGTGGGCGG + Intergenic
1161101410 19:2423794-2423816 CTGGAAGACGGAGATGTGGGAGG + Intronic
1161466395 19:4433047-4433069 CTGGCAGGAGGGAACATGGGTGG - Intronic
1161846343 19:6713736-6713758 CTGGGAGTGGGGAAGGTGGGGGG - Intronic
1162392067 19:10395764-10395786 ATGGACGGGGGCCACGTGGGAGG - Intronic
1162570049 19:11466362-11466384 CAGGAAGGTGGAAACTTGGTGGG - Intronic
1162914978 19:13869723-13869745 CTGGAAGGGGGACACGGGGTGGG - Intronic
1163586872 19:18169022-18169044 CTGGAACGGGGAAAGCTTGGCGG + Intronic
1165324686 19:35107649-35107671 CTGGAAGGGGGTGGAGTGGGAGG - Intergenic
1166855929 19:45782591-45782613 CTGGAAGGAGGGAGCTTGGGGGG - Intronic
1167624751 19:50580167-50580189 CTGGAGTGGGGAGAGGTGGGAGG - Intergenic
1168112152 19:54199171-54199193 CTGGAAGGGGGAAACGTGGAAGG - Intergenic
1168240077 19:55084468-55084490 CTGGAGGGAAGCAACGTGGGAGG + Intronic
1168513019 19:56988463-56988485 CTGGAGGGCGGAAAGGTGGGGGG - Intergenic
925056655 2:861984-862006 CGAGAAGGGGGAGGCGTGGGGGG - Intergenic
925293742 2:2764641-2764663 CTGGAAGGAGGGAAGGAGGGAGG + Intergenic
925460366 2:4057784-4057806 TTGGAATGGGGACATGTGGGAGG + Intergenic
925785525 2:7428887-7428909 CTGGGAGGGTGAGAAGTGGGAGG + Intergenic
926627223 2:15102299-15102321 CAAGAAGGTGGAAAGGTGGGAGG + Intergenic
926825946 2:16905045-16905067 TTGGAATGGGGACATGTGGGAGG - Intergenic
928671610 2:33608924-33608946 CTTGAAGGGGGAATAGGGGGTGG - Intergenic
929090556 2:38213129-38213151 ATGGAAGGGGTAAAGATGGGAGG + Intergenic
929114862 2:38435453-38435475 CAGCTATGGGGAAACGTGGGTGG - Intergenic
929266387 2:39923310-39923332 GTGGAAGCAGGAAATGTGGGGGG + Intergenic
929457854 2:42078592-42078614 CTGGATGGGGGTAACTTGGTTGG - Intergenic
930909797 2:56618141-56618163 TTGGAATGGGGACATGTGGGAGG + Intergenic
931576741 2:63725195-63725217 CTGGAGGGTGGAAGGGTGGGAGG - Intronic
932243343 2:70175340-70175362 ATTGGAGGGTGAAACGTGGGAGG - Intronic
932446862 2:71786831-71786853 GTGGAAGGGGGACATGAGGGAGG - Intergenic
933751203 2:85602832-85602854 CGTCACGGGGGAAACGTGGGCGG + Intronic
933916323 2:86997454-86997476 AGGGAAGGGGGAAATTTGGGGGG + Intronic
934006670 2:87772451-87772473 AGGGAAGGGGGAAATTTGGGGGG - Intronic
935770318 2:106413372-106413394 AGGGAAGGGGGAAATTTGGGGGG - Intronic
935909770 2:107882563-107882585 AGGGAAGGGGGAAATTTGGGGGG + Intronic
935967894 2:108499444-108499466 AGGGAAGGGGGAAATTTGGGGGG + Intronic
936095866 2:109529654-109529676 CAGGAAGGGGGAACTGTGGAAGG + Intergenic
936118816 2:109724514-109724536 ATGGAAGGGGGACAGGTAGGTGG + Intergenic
936131554 2:109847701-109847723 AGGGAAGGGGGAAATTTGGGGGG + Intronic
936213143 2:110523784-110523806 AGGGAAGGGGGAAATTTGGGGGG - Intronic
936422282 2:112378341-112378363 AGGGAAGGGGGAAATTTGGGGGG - Intronic
936578108 2:113672097-113672119 CTGGGAAGGGGACACGTGGTTGG - Intergenic
936751716 2:115650397-115650419 CTGGCATGGGGAAAGGGGGGGGG + Intronic
937279444 2:120707325-120707347 CTGGGAGGGGGAAAGGTGGAGGG + Intergenic
937536231 2:122891398-122891420 GTGGTGTGGGGAAACGTGGGTGG - Intergenic
937740004 2:125339944-125339966 CTGGACGGGGAAAAGTTGGGCGG - Intergenic
937852914 2:126651386-126651408 TTGGAATGGGGACATGTGGGAGG - Intergenic
937967664 2:127526248-127526270 CTGGAAGGAGGTGACGGGGGCGG - Exonic
939789032 2:146548771-146548793 TTGGAATGGGGACATGTGGGAGG - Intergenic
940994208 2:160129433-160129455 CTGGAAGAGCAAAACTTGGGAGG - Intronic
944131576 2:196353101-196353123 CTGGAAGGGGGTAAGGAGCGAGG - Intronic
945976629 2:216276213-216276235 ATGGAAGGGGGAAACAGTGGAGG - Intronic
946175850 2:217921565-217921587 CTGGAAGGGGCAGAGGTGGCTGG + Intronic
948899000 2:240946706-240946728 CTGGAAGGGGGACCCTGGGGTGG - Intronic
1168948242 20:1778901-1778923 CTGGGAGAGGGAAGCATGGGTGG - Intergenic
1170259837 20:14391815-14391837 CTAGATGGGGGAAAGGAGGGAGG + Intronic
1171010939 20:21509117-21509139 GAGGAAGGGGGAAGCGTGGAAGG - Intergenic
1172144163 20:32744433-32744455 CTGGAGCAGGGAAATGTGGGGGG + Intergenic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1173709495 20:45141939-45141961 TTGGAATGGGGACATGTGGGAGG - Intergenic
1174186369 20:48709021-48709043 CTGGCAGTGGGAAACGGTGGGGG - Intronic
1174395932 20:50246915-50246937 CTGAAAGGGGGACCTGTGGGCGG + Intergenic
1174413097 20:50348760-50348782 CTGGAGGGGTGAGACCTGGGTGG + Intergenic
1174561760 20:51435649-51435671 ATGAAAGAGGGAAACGTGAGGGG + Intronic
1175065053 20:56277289-56277311 CTGGAAGGGGCCAAGGTGGCAGG - Intergenic
1175409576 20:58757756-58757778 TTGGAATGGGGACATGTGGGAGG - Intergenic
1176108268 20:63399550-63399572 CAGGAAGGGGGCAACGTGGATGG + Intergenic
1176808868 21:13516983-13517005 CAGGAATGGGGAAAAGAGGGTGG + Intergenic
1177051259 21:16237763-16237785 GTGGGAAGGGGAAAAGTGGGAGG + Intergenic
1177237330 21:18409833-18409855 AAGGAAGGGGGAAAGGAGGGAGG - Intronic
1177363366 21:20103159-20103181 TTGGAATGGGAACACGTGGGAGG + Intergenic
1181728709 22:24829377-24829399 ATGGAAGGGTGGAAGGTGGGAGG + Intronic
1181788586 22:25245503-25245525 CTGGAAGGGAGGAATGGGGGTGG - Intergenic
1181820275 22:25470192-25470214 CTGGAAGGGAGGAATGGGGGTGG - Intergenic
1183227313 22:36559289-36559311 CTGGAAGTGGGAAAGGAGGAGGG + Intergenic
1183734128 22:39634542-39634564 CTGGGAGGGGAAAAGGTGGAGGG - Intronic
1184261938 22:43322641-43322663 CTTGAAGGAGGAAAGGAGGGAGG - Intronic
1184284821 22:43464613-43464635 CTGGATGGGTGCAAGGTGGGAGG + Intronic
1184603929 22:45561087-45561109 TTGGAATGGGGACATGTGGGAGG - Intronic
1184729766 22:46365945-46365967 CTGGGTGGGGGAAAGGTGGTGGG + Intronic
1184865327 22:47199025-47199047 CAGGAAGGGGGACACGGGAGGGG - Intergenic
1185325312 22:50222701-50222723 CTGGTAGGGGGAGACGGGGGCGG - Intronic
949512893 3:4782237-4782259 CTGGGAGTGGGAAATGTTGGTGG + Intronic
950416321 3:12870830-12870852 CAGGAAGGTGGAAACTTCGGTGG - Intronic
950709624 3:14805035-14805057 CTGGAGGTGGGAAACCTGGAAGG - Intergenic
951384185 3:22025069-22025091 TTGGAATGGGGACATGTGGGAGG + Intronic
951971100 3:28444516-28444538 GTGGAATGGGGACATGTGGGAGG - Intronic
953160655 3:40416263-40416285 CTGGAAGTGGGCAACATGAGAGG - Intronic
953353053 3:42230340-42230362 GTGGAGGGGGGAAAGGCGGGTGG + Intergenic
956750023 3:72337823-72337845 AAGGAAGGGGGAAGCGAGGGAGG + Intergenic
957086048 3:75678142-75678164 CTTGAGGGGGGGAAGGTGGGAGG - Intergenic
957410691 3:79835847-79835869 CAGGAAGGGGGAAACATGCAAGG - Intergenic
959544477 3:107578242-107578264 CTGTAAGAGGGAGACATGGGGGG + Intronic
960255427 3:115506176-115506198 CAGGAAGGGGGGAATGTGGAGGG + Intergenic
962754115 3:138455390-138455412 CTGGGTGGGAGAAAGGTGGGAGG - Intronic
962859952 3:139390005-139390027 CTGGAGGGGGGAAACGGCGAGGG + Intergenic
962968678 3:140378921-140378943 CAGGAAGGAGGAAAGGTGGGAGG - Intronic
963851647 3:150215970-150215992 ATGGGAGGGGGAAAGGAGGGAGG + Intergenic
964490909 3:157235134-157235156 CTGGTATGTGGAAACGTGGCAGG - Intergenic
965554767 3:170007664-170007686 CTGGAAGGGGGTGAAGTGGAAGG - Intergenic
967969160 3:194986478-194986500 CTGGGACGGGGAGCCGTGGGAGG - Intergenic
968016754 3:195341986-195342008 CAGAAAGGGGGGAAGGTGGGAGG + Intronic
968525822 4:1056368-1056390 CTGGAAGGGGGCAGAGCGGGTGG + Intronic
968536023 4:1130236-1130258 CCAGAAAGGGTAAACGTGGGGGG - Intergenic
968816576 4:2824642-2824664 CTTGAAGGGGAAAACGTTGTTGG - Exonic
969308647 4:6339708-6339730 GTGGAGGTGGGAAACATGGGAGG + Intronic
969684581 4:8663992-8664014 CTGGAAGTTGGGAACCTGGGTGG + Intergenic
971002771 4:22341172-22341194 TTGGAATGGGGACATGTGGGAGG + Intergenic
972714215 4:41629748-41629770 CTGCCAGGGGGAAACTGGGGGGG - Intronic
973399612 4:49627559-49627581 ATGGATGGATGAAACGTGGGAGG - Intergenic
973927038 4:55749081-55749103 CTGGAAGGGGGAAAGGGGGAGGG + Intergenic
974273333 4:59680890-59680912 CTGGGAGGGGGAAAAGATGGTGG + Intergenic
975882310 4:78924977-78924999 CTGGAAGGGTTAATCTTGGGAGG - Intronic
976079573 4:81340325-81340347 CTGGAAGGGGGAGAGTGGGGAGG - Intergenic
976299814 4:83507036-83507058 CTGGAGGAGGGATACGTGGTCGG + Intronic
976368517 4:84259261-84259283 CTGGAGGGGGCAAAGCTGGGTGG - Intergenic
976443723 4:85106616-85106638 CTGGAAGTGGGAAAAGAGGGAGG - Intergenic
976883209 4:89955532-89955554 GTGGAAGGGGGAGAGGTAGGAGG + Intergenic
979764770 4:124451058-124451080 CTGGAAGCAGGAAAGCTGGGTGG + Intergenic
983785307 4:171722226-171722248 TTGGAATGGGGATATGTGGGAGG - Intergenic
985676651 5:1234902-1234924 CTTGACTGGGGAAATGTGGGGGG - Intronic
987578712 5:19761027-19761049 TTGGAATGGGGACATGTGGGAGG - Intronic
987657463 5:20824335-20824357 TTGGAATGGGGACATGTGGGAGG - Intergenic
987872138 5:23634003-23634025 TTGGAAGTGGGGAAAGTGGGAGG + Intergenic
988766080 5:34379611-34379633 TTGGAATGGGGACATGTGGGAGG + Intergenic
988796674 5:34657664-34657686 CTGGGATGGGGAAACGTTGCCGG + Intronic
990969261 5:61485079-61485101 GAGGAAGGGGGAAAAGAGGGAGG - Intronic
991033183 5:62103221-62103243 CTGGAATGGGGACATGTGGGAGG + Intergenic
991146824 5:63316781-63316803 CTTGATGGGGGAAGAGTGGGAGG + Intergenic
991335743 5:65545119-65545141 CAGGAAAGGAGAAAGGTGGGGGG + Intronic
991513154 5:67402757-67402779 CTGGTTGAGAGAAACGTGGGAGG + Intergenic
992242544 5:74786877-74786899 TTGGAATGGGGACACGTGGGAGG + Intronic
993651652 5:90529571-90529593 CCGGAAGGCGGAGACGTTGGCGG - Exonic
995236120 5:109832615-109832637 GTGGAAGGGGGGGACGTGTGGGG - Intronic
995717003 5:115090385-115090407 CTAAAAAGGGGAAACCTGGGAGG + Intergenic
996409315 5:123139870-123139892 CTGGAAGGAGGAAGGATGGGTGG + Intronic
998774696 5:145586191-145586213 CTGGCAGGGGAATTCGTGGGAGG - Intronic
999518425 5:152324383-152324405 CTGGAAGAGGGCCAAGTGGGTGG + Intergenic
1001085781 5:168699218-168699240 TTGGCAGGTGGACACGTGGGCGG + Intronic
1001554019 5:172624177-172624199 GTGGGGGTGGGAAACGTGGGGGG - Intergenic
1001925883 5:175636826-175636848 TTGGAAGGGTGGAAGGTGGGAGG + Intergenic
1002570122 5:180135474-180135496 CTGGAAGGGGGAAACGTGGGCGG - Intronic
1002762002 6:209590-209612 GTGGAAGGTGGAGAGGTGGGCGG + Intergenic
1002874995 6:1202729-1202751 CTGGCTGGGGGAAACTGGGGCGG - Intergenic
1005594665 6:27368040-27368062 CTGGAGGGGGGAAAGGTGGCAGG - Intergenic
1006061991 6:31430460-31430482 TTGGAATGGGGATATGTGGGAGG + Intergenic
1006177162 6:32129309-32129331 ATGGAGGGAGGAAACTTGGGGGG - Exonic
1007745157 6:44039140-44039162 CTGGAATGGGGAAAGGTGTGCGG + Intergenic
1009308291 6:62119606-62119628 TTGGAATGGGGAAATGTGGGAGG + Intronic
1012627238 6:101419228-101419250 CTGGAAAGGTGAAAGGTGTGAGG - Intronic
1012637938 6:101570474-101570496 CTGGCAGGGGGAGAAGGGGGAGG - Intronic
1013369084 6:109455012-109455034 CAGGGAGGGGGGAACCTGGGAGG - Intronic
1014398236 6:120953285-120953307 CTGGAAGGAGGAAACGGAGTGGG + Intergenic
1015908110 6:138138255-138138277 CTAGAAGGGAGAAACATGGGTGG - Intergenic
1016147653 6:140695406-140695428 TTGGAATGGGGACATGTGGGAGG - Intergenic
1016753974 6:147663314-147663336 TTTGGAGGGGGAAAGGTGGGAGG + Intronic
1016870169 6:148808474-148808496 CTGGGATGGGGATAGGTGGGTGG + Intronic
1017650345 6:156575919-156575941 CTGGAAGGGGGAAATCTGACAGG - Intergenic
1018653147 6:166007849-166007871 CTGCAAGGGGGAAGCGGGGGCGG + Intergenic
1019133002 6:169891031-169891053 ATGCAAGGGGGAGACGTGCGGGG + Intergenic
1019523626 7:1471225-1471247 CTGACCGGGGGAAAGGTGGGAGG + Intronic
1021801534 7:24311595-24311617 CTGGAAGGGAGGAAGCTGGGGGG + Intergenic
1022470200 7:30677360-30677382 GTGGAATGGGGAGAGGTGGGAGG + Intronic
1023105265 7:36757682-36757704 CTTGGAGGGGGAAATGTTGGAGG + Intergenic
1023186618 7:37539442-37539464 GTTGAAGGGGGAACAGTGGGAGG + Intergenic
1023960097 7:44919361-44919383 CTGAAAGGGGGTATGGTGGGGGG - Intergenic
1023966007 7:44963295-44963317 CTGACAGGGGGAAGCTTGGGCGG + Intronic
1024505242 7:50157039-50157061 CTGGAAGGGGGACAAGAGAGAGG + Intronic
1025257386 7:57393809-57393831 CTGGAGGGGTGAGACCTGGGTGG - Intergenic
1026828181 7:73596689-73596711 CTGGAAGGGGCCAATGTGGCCGG + Exonic
1027237003 7:76304004-76304026 CAGGGAGGAGGAAACTTGGGTGG - Exonic
1029480192 7:100807619-100807641 ATGGGAGGGGGAACGGTGGGTGG - Intronic
1030616403 7:111742557-111742579 GTGGGAGAGGGAAATGTGGGGGG - Intronic
1032153476 7:129449634-129449656 TTGGAATGGGGACATGTGGGAGG - Intronic
1032341289 7:131075670-131075692 CTGGAAGGGGGAAGCCTGAGTGG - Intergenic
1032565787 7:132941562-132941584 CAGGAAGTGGTAAACGTGGAGGG - Intronic
1032923768 7:136578414-136578436 TTGGAATGGGGACATGTGGGAGG - Intergenic
1033561674 7:142537816-142537838 CTGGAAGGCTGAAAAGTGGGAGG + Intergenic
1033942827 7:146677181-146677203 CTGGAAGTGGGGGAAGTGGGAGG + Intronic
1035654351 8:1294196-1294218 CTGGCAAGGGGAGAGGTGGGAGG - Intergenic
1035718901 8:1776055-1776077 CTGTGAGGGGCACACGTGGGTGG + Intronic
1036485530 8:9175505-9175527 CTGGGAGGGAGAAAGGTGTGAGG + Intergenic
1037404941 8:18532348-18532370 CTGGAAGAGGAAAATCTGGGTGG - Exonic
1038927720 8:32158762-32158784 TGGGAAGGAGGAAACGTGAGAGG + Intronic
1041457965 8:58080639-58080661 ATGGAAGAGGGAAACCTGTGTGG - Intronic
1042028167 8:64445877-64445899 ATGGAATGGGGACAGGTGGGAGG + Intergenic
1044202043 8:89449787-89449809 TTGGAATGGGGATGCGTGGGAGG + Intergenic
1044506149 8:93022249-93022271 GTGGAAGGGGGAGACGGAGGTGG + Intergenic
1044764568 8:95557833-95557855 CTGCAAGGGGGCAACGAGGCTGG - Intergenic
1044873077 8:96639195-96639217 CCGGAAGGTGGAGACGTGTGTGG - Intergenic
1045308173 8:100977094-100977116 CTTTAAGAGGGAAAGGTGGGTGG + Intergenic
1045535913 8:103027662-103027684 ATGGAAGGGAAAAAAGTGGGAGG - Intronic
1045839010 8:106558367-106558389 CTGGCAGGGGGAATCCAGGGTGG - Intronic
1046586135 8:116150319-116150341 TTGGAATGGGGACACGTGGGAGG - Intergenic
1047234552 8:123028444-123028466 CTGGGAGGAGGGAAAGTGGGAGG + Intronic
1048301490 8:133254596-133254618 CTGGAAAGGAGTAAAGTGGGTGG + Intronic
1048973439 8:139657863-139657885 CTGGATGGGGGTGATGTGGGTGG - Intronic
1049755307 8:144308883-144308905 CTGAAAGGGAGACACATGGGTGG - Intronic
1049792339 8:144477918-144477940 CTGGGAGGAGGAAATGTCGGGGG - Intergenic
1049966966 9:788656-788678 CTTGAATGGGGAAAGGTGGTTGG + Intergenic
1049981563 9:908819-908841 GTGGGAGGGGAAAACGGGGGAGG - Intronic
1050089291 9:2000652-2000674 CTGGAAGGGGCAAGAGTGGATGG - Intergenic
1052227257 9:26105675-26105697 TTGGAATGGGGATGCGTGGGAGG + Intronic
1052803098 9:32988400-32988422 CTGGAATAGGGAAACTTGTGGGG - Intronic
1053123420 9:35561933-35561955 TTGGAAGGGAGAGAGGTGGGTGG - Exonic
1056532432 9:87498631-87498653 CTGGAGGTGGGAAAGCTGGGTGG + Intronic
1057159923 9:92882396-92882418 CTGGAAGGTGGGAAGGTGGAGGG + Intergenic
1057316220 9:93970434-93970456 TTGGAATGGGGACATGTGGGAGG + Intergenic
1057483379 9:95462998-95463020 CTGGGAGGGGCAAGGGTGGGTGG - Intronic
1060263082 9:122092874-122092896 TTGGACGGGGGCAGCGTGGGCGG + Exonic
1060978608 9:127779647-127779669 CTAGAATGGGGAGAAGTGGGAGG + Intergenic
1061714392 9:132509836-132509858 GTGGAAGGGGGAAAAGATGGGGG - Intronic
1186420317 X:9420346-9420368 CTGGAAGAGAGAGACGTTGGTGG - Intergenic
1187704297 X:21993982-21994004 AAGGAAGGGGGAAAGGAGGGAGG - Intronic
1188537397 X:31212781-31212803 TTGTAAGGGGGAAAAGTGGGTGG + Intronic
1190059078 X:47199395-47199417 CGGGAAGGGGGAAAGGGGGAAGG - Intronic
1190131418 X:47752050-47752072 GTGGAGAGGGGATACGTGGGTGG + Intergenic
1192298073 X:69870687-69870709 CTGGAATGGGGATGCGTGGGAGG - Intronic
1192429032 X:71100335-71100357 CTGGGAGCGGGAAATGTGTGTGG + Intronic
1192479554 X:71473198-71473220 GAGGAAGGGGGAAATTTGGGAGG + Intronic
1193876936 X:86872599-86872621 TTGGAATGGGGACATGTGGGAGG + Intergenic
1194917306 X:99722141-99722163 CTGGAAAAGGGCAAAGTGGGAGG + Intergenic
1196021225 X:110992909-110992931 CTGTAAAGGAGAAACGTTGGGGG - Intronic
1197001944 X:121450346-121450368 TTGGAATGGGGACATGTGGGAGG + Intergenic
1197245463 X:124162017-124162039 TTGGAATGGGGACATGTGGGAGG - Intronic
1197554631 X:127938256-127938278 TTGGAATGGGGAAGAGTGGGAGG - Intergenic
1197706330 X:129637106-129637128 CTGGTAGGGGGAAAACTGGTGGG + Intergenic
1198750091 X:139931259-139931281 CTGAAGGGGGTAAACGTGGACGG + Intronic
1198837900 X:140823790-140823812 CTGAAAGGGGAAAAAGTGGATGG - Intergenic
1199883572 X:151996178-151996200 CTTGGAGGGGGAAATGTGAGAGG - Intergenic
1200340652 X:155391788-155391810 TTGGAATGGGGACATGTGGGAGG - Intergenic
1201529956 Y:14980654-14980676 TTGGAATGGGGACATGTGGGAGG - Intergenic