ID: 1002570808

View in Genome Browser
Species Human (GRCh38)
Location 5:180138312-180138334
Sequence GAAGAGGCCTGCCCCTGAGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002570808_1002570811 -6 Left 1002570808 5:180138312-180138334 CCCACTCAGGGGCAGGCCTCTTC 0: 1
1: 0
2: 0
3: 14
4: 160
Right 1002570811 5:180138329-180138351 CTCTTCTAGATTCTTCCCCCCGG 0: 1
1: 0
2: 3
3: 16
4: 176
1002570808_1002570814 10 Left 1002570808 5:180138312-180138334 CCCACTCAGGGGCAGGCCTCTTC 0: 1
1: 0
2: 0
3: 14
4: 160
Right 1002570814 5:180138345-180138367 CCCCCGGCACCCCTCCACGAAGG 0: 1
1: 0
2: 1
3: 7
4: 162
1002570808_1002570822 29 Left 1002570808 5:180138312-180138334 CCCACTCAGGGGCAGGCCTCTTC 0: 1
1: 0
2: 0
3: 14
4: 160
Right 1002570822 5:180138364-180138386 AAGGTTGTTTTTCACAAGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002570808 Original CRISPR GAAGAGGCCTGCCCCTGAGT GGG (reversed) Exonic
900226614 1:1536129-1536151 GAAGAGGCCTCCCCCGGAGGGGG + Intronic
900641676 1:3690602-3690624 GCTGAGGCCTGCCCCGGACTTGG + Intronic
900744260 1:4350724-4350746 GAAGAGGCATCCGCATGAGTGGG + Intergenic
901150340 1:7097104-7097126 GAAGAGGGCTCGCCCTGAGTTGG - Intronic
901400741 1:9013775-9013797 AAAGAGGCCTGACCTGGAGTCGG + Intronic
902238429 1:15072901-15072923 GATGAGGCCGGGCGCTGAGTAGG + Intronic
902990512 1:20184498-20184520 GAAGAGGCCTGGCCCAGACCAGG + Intergenic
904803149 1:33111071-33111093 GAAGCAGCCTGCTGCTGAGTGGG + Intronic
904955481 1:34280097-34280119 GAGGCAGCCTGCCCCAGAGTGGG + Intergenic
906364174 1:45191458-45191480 GAAGAGGCATAACCCTGGGTGGG - Intronic
907074605 1:51566871-51566893 CATGAGGCCTGCCCCAGAGGAGG + Intergenic
907336195 1:53701365-53701387 GAAGAAGACTTTCCCTGAGTCGG - Intronic
911493418 1:98598112-98598134 GAAAAGGCCTGCCACATAGTAGG - Intergenic
912491695 1:110066032-110066054 GTGGAGGCCTGGCCCTGAGGAGG + Intronic
912796271 1:112695462-112695484 GAGTAGGTCAGCCCCTGAGTTGG - Exonic
916520124 1:165556041-165556063 GCAGGGGGCTACCCCTGAGTAGG + Intronic
919752796 1:201048699-201048721 GCAGTGGCCTGCCGCTGAGCTGG + Intronic
922145763 1:222942627-222942649 GAAGAGGAGTGCCACTGTGTTGG + Intronic
924463932 1:244283668-244283690 GCAGAGGGCTGCCTCTGAGTCGG - Intergenic
924669989 1:246114387-246114409 GAAGAGGCCAGCCCCCGATGGGG + Intronic
924801663 1:247332481-247332503 GGTGAGTCCTGACCCTGAGTGGG + Intergenic
1064902395 10:20309462-20309484 GAATTGGACTGCCCCAGAGTTGG + Intergenic
1065244336 10:23742272-23742294 GGAGGGGCCTGCCACTGAGCAGG + Intronic
1066193464 10:33076912-33076934 CAAGATGCCTGCCCCTGATGTGG + Intergenic
1070884067 10:79874609-79874631 GAAGCTGCCTACCCCTGTGTGGG - Intergenic
1071808923 10:89156743-89156765 CAAGAGCCATGCCTCTGAGTGGG + Intergenic
1074703560 10:116112442-116112464 GAGGGGGGCTGCCCCTGAGATGG + Intronic
1075489535 10:122854758-122854780 GAAAAGGCCAGCCCCTGTATTGG - Intronic
1080875141 11:36267962-36267984 GCAGAGGCCATCCCCTGAGCTGG + Intergenic
1083949876 11:65947963-65947985 GGAGAGGGCAGCCCCTGACTTGG + Intronic
1084793793 11:71491086-71491108 GAATGGTCCTGCCCCTGAGCTGG + Intronic
1085277999 11:75312241-75312263 GAACAGGCCTGCCCCTGGGAAGG + Intronic
1092061843 12:5557513-5557535 GATGTGGGCTGCCCCAGAGTGGG + Intronic
1095788380 12:46136456-46136478 GAAGTGGCCTTCCCCTGGGAGGG - Intergenic
1096524810 12:52204139-52204161 GAGGAGGCCTGCCTGTAAGTGGG - Intergenic
1119875068 14:78052366-78052388 GCAGAGGCCTACCACTGAGTAGG + Intergenic
1120951557 14:90046385-90046407 GAAGCTGCGTGCCCCTGATTTGG + Intergenic
1122556201 14:102581741-102581763 GAGGAGGCCTGCCCCATGGTGGG + Intergenic
1123067034 14:105624009-105624031 GACTAGGCATGCCCCCGAGTGGG + Intergenic
1123071055 14:105642736-105642758 GACTAGGCATGCCCCCGAGTGGG + Intergenic
1123076015 14:105667777-105667799 GACTAGGCATGCCCCCGAGTGGG + Intergenic
1123090718 14:105741006-105741028 GACTAGGCATGCCCCCGAGTGGG + Intergenic
1123096350 14:105768770-105768792 GACTAGGCATGCCCCCGAGTGGG + Intergenic
1123998574 15:25735435-25735457 GCACAGGCCTGGCCCTGTGTTGG - Intronic
1124399833 15:29338484-29338506 GGAGAGGTCAGCCCCTGAGAGGG + Intronic
1126574503 15:50183749-50183771 GAAGAGGCCTACACAGGAGTGGG + Intronic
1128345340 15:66849548-66849570 GGAGAGGCCTGGCCTGGAGTAGG - Intergenic
1128841264 15:70853560-70853582 GAAGAGGCCTCCTCCAGAGGAGG + Intronic
1129850709 15:78791972-78791994 AAAGAGGCCAGCCCATGACTGGG + Intronic
1130844712 15:87734038-87734060 GAGGAGGCGTGCGGCTGAGTAGG + Intergenic
1132504485 16:300582-300604 GAACAGGCGTGCCCCAGAGCTGG + Intronic
1134139258 16:11703009-11703031 GAGGAGGCCTGGCACTGAGTAGG + Intronic
1134220654 16:12351190-12351212 TAAGAGGCCTGACACTTAGTTGG + Intronic
1134357625 16:13499007-13499029 TGAGAGGTCTGCCCCTGAGCAGG + Intergenic
1136086658 16:27890210-27890232 GAAGAGGACGGCCGCTGAGTGGG + Intronic
1136655338 16:31706063-31706085 GAAGAGGGTGGTCCCTGAGTGGG - Intergenic
1141551923 16:84812029-84812051 GAAGGGACCTGGCCCTGAGATGG + Intergenic
1142061896 16:88035736-88035758 GATGGGGTCTGCCCCTGCGTAGG + Intronic
1142223173 16:88865158-88865180 GGAGACGCCTGGCCCTGACTCGG + Intronic
1143012182 17:3872198-3872220 GAAGTTCCCTGACCCTGAGTGGG + Intronic
1143859215 17:9875773-9875795 GAAGAGAGCTGCCTCTGAGCTGG - Intronic
1146474054 17:33147835-33147857 GGAGAGGGAAGCCCCTGAGTAGG - Intronic
1146790438 17:35747788-35747810 GAAGAGGCCTAGCTCTGGGTTGG - Intronic
1147045562 17:37749255-37749277 GAAGATGCCTGCCCCTCATAGGG - Intergenic
1148860321 17:50601188-50601210 GGAGAGGCCTTGCCCTGAGCGGG - Intronic
1149388245 17:56163694-56163716 GCAGAGGCCTGCCCATCAATGGG + Intronic
1152888556 17:82866850-82866872 GAAGAGGCCAGTTCCTGAGAGGG - Intronic
1156478612 18:37422154-37422176 GAAGAGGCCAGGGCCTGAGTGGG + Intronic
1157184695 18:45528838-45528860 CATGAGGCCAGCCCCAGAGTGGG - Intronic
1157234887 18:45955061-45955083 GGAGAGGCCAGACCCTGTGTGGG - Exonic
1158440988 18:57474175-57474197 GAAGAGGAGAGCCCCTGAATGGG - Intronic
1161683681 19:5692940-5692962 GAAGAGGCCAGCCCCTGGCCAGG + Intronic
1163026244 19:14514395-14514417 TAAGAGGCCAGACCCTGGGTTGG + Intergenic
1164049124 19:21568953-21568975 GAAGAGGACTGAGGCTGAGTTGG + Intergenic
1165830536 19:38728268-38728290 GAGGAGGCCGGGCCCAGAGTAGG - Intronic
927253437 2:21018815-21018837 GAATAGGCCTGCCGCTTATTGGG + Intronic
927253445 2:21018860-21018882 GAATAGGCCTGCCGCTTAGTGGG + Intronic
927553543 2:24017842-24017864 GAGGAGGCCAGCCCCAGAGGAGG + Intronic
928171399 2:29006831-29006853 GAAGAGGCCAGCGTCTGAGTGGG - Intronic
930221238 2:48748778-48748800 GATGATTCCTGTCCCTGAGTGGG - Intronic
932429637 2:71666391-71666413 GAAGAGGCATGCACCTCAGAAGG - Intronic
933774712 2:85765179-85765201 CAAGAGGCCTGTCCCTGCCTAGG + Intronic
935147663 2:100407076-100407098 GAAGAGGCCTGCCAAGGACTAGG + Intronic
935622353 2:105141372-105141394 GAAGAGACCTGCCTCTGTGAGGG - Intergenic
937287614 2:120763058-120763080 GAGCAGGGCTGCCCCTCAGTCGG - Intronic
937868841 2:126773282-126773304 GTGGTGGCCTGCCCCGGAGTGGG + Intergenic
937961701 2:127464959-127464981 GAAGAGGCCTCCAGCAGAGTGGG - Intronic
938200849 2:129371860-129371882 GTTGAGGCCTGCTCCTGAGCTGG + Intergenic
938552056 2:132391498-132391520 GACGAGGCCTGCCAGGGAGTTGG + Intergenic
939146887 2:138426210-138426232 TTAGAGGCCTGCCCCTGGGAGGG - Intergenic
940042987 2:149379785-149379807 GAAGATGCCTGGCACTTAGTAGG - Intronic
940801296 2:158136055-158136077 GAATTGGCCTGCTCCTGGGTGGG + Exonic
942309877 2:174646255-174646277 GGAGAGGGATGCTCCTGAGTAGG - Intronic
943523332 2:188983649-188983671 AAAGAGGCCTGCTACCGAGTAGG - Intronic
944540272 2:200747693-200747715 GCAGAGGCCTGCCAGAGAGTAGG - Intergenic
948164154 2:235848390-235848412 GAAGAGATTTGCCTCTGAGTAGG - Intronic
948537428 2:238656522-238656544 GTATGGGCCTGCCCCAGAGTGGG + Intergenic
948542407 2:238700004-238700026 GAAGTGGCTTGGCCCTGAGCAGG + Intergenic
948676774 2:239601481-239601503 GGAGAGGCCTGCCCTGCAGTGGG - Intergenic
1172242574 20:33423251-33423273 CAAGTGGCCTGTCCCAGAGTGGG + Intronic
1174476588 20:50800228-50800250 GATGAGCCCTGAGCCTGAGTAGG + Intronic
1174763413 20:53229119-53229141 GAAGGGGCTTGACCCTGAGCTGG + Intronic
1176123379 20:63464275-63464297 GGAGAGGCCAGCCTCTGAGAAGG - Intronic
1179996371 21:44976246-44976268 GCAGAGGCCTGCAGCAGAGTGGG - Intronic
1181412435 22:22733913-22733935 CAAGTGGCCTGCTCATGAGTGGG + Intergenic
1184030078 22:41888075-41888097 GAACAGGCAAGCCCCAGAGTGGG - Intronic
1184193219 22:42908827-42908849 GAGGAGGCCTGTGGCTGAGTAGG - Intronic
1184946373 22:47807186-47807208 GAAGAGGCCTGGGCCAGGGTGGG - Intergenic
1185269636 22:49923097-49923119 GAGGAGGGCAGCCCCTGAGGAGG - Intronic
950475377 3:13211468-13211490 GAAGAGCCGAGACCCTGAGTTGG - Intergenic
950645995 3:14377091-14377113 GAATAGGCCTGGCCCTGGCTTGG + Intergenic
954720844 3:52561572-52561594 GCAGAGCACTGCCCCTGACTTGG - Intronic
955590155 3:60526380-60526402 GGAGAGGCCAGCACCTCAGTTGG + Intronic
961380637 3:126494539-126494561 GGAGAGGCCTGCCCCTGTCCTGG - Intronic
961478974 3:127167356-127167378 GGAGAGGTGTGCCCCTGGGTGGG - Intergenic
961788081 3:129359389-129359411 GAAGAGCCCAGACCCTGAGTTGG + Intergenic
961865911 3:129953328-129953350 GACAAGGCCTGGCCCTGAGCAGG + Intergenic
962942980 3:140142392-140142414 TGAGAGGCCTGCCCCAGTGTGGG - Intronic
963552252 3:146739235-146739257 GAAGCCGCCTGCCCCAGAGGTGG - Intergenic
969871392 4:10107181-10107203 GAGGAGGGGTGTCCCTGAGTGGG - Intronic
986018540 5:3779539-3779561 GAGGAGGGCTGGCCCGGAGTGGG + Intergenic
986397408 5:7344306-7344328 TAAGAGACCTGTCCCTGAGGAGG - Intergenic
996021443 5:118594978-118595000 TCAGAAGCCTGCCCCTGGGTGGG + Intergenic
997641910 5:135454984-135455006 GACCAGGCCTGCACCTGGGTTGG + Intergenic
998092711 5:139380521-139380543 GAAGAGGCCGGGTCCTGAGGAGG - Intronic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
999693394 5:154167986-154168008 GAAGAGGCCTGGACCTTAGGAGG - Intronic
1002570808 5:180138312-180138334 GAAGAGGCCTGCCCCTGAGTGGG - Exonic
1002947154 6:1773505-1773527 GAAGAGGGCTGCCCTTGGGCAGG + Intronic
1003569808 6:7248372-7248394 GAAGAGGCCTCTGGCTGAGTAGG + Intronic
1006056066 6:31385316-31385338 GAAAATACCTGCCCCTGAGGTGG - Intergenic
1006360376 6:33584129-33584151 GAAGAGGCCTGGACATGAGATGG + Intergenic
1006996358 6:38264872-38264894 GCAGAGGCCTGCCTCTGAATGGG + Intronic
1009482671 6:64179543-64179565 TAAGAGGCCTGGCACTTAGTAGG + Intronic
1012433751 6:99193085-99193107 GAGGAGGGCTGCATCTGAGTGGG - Intergenic
1018744498 6:166751368-166751390 CAGGAGGGCTTCCCCTGAGTTGG + Intronic
1019498455 7:1352411-1352433 GAAGAGGCCATTCCCTGAGCAGG + Intergenic
1019575264 7:1734640-1734662 GCAGAGGCAGGCCCCGGAGTGGG - Intronic
1026521740 7:71123826-71123848 GTAGAGGTTTGCCCCTGAGAAGG + Intergenic
1032531026 7:132620254-132620276 TAAGCGGCCTGCCTCTGATTAGG + Intronic
1032931454 7:136677452-136677474 GGGGAGGGCTGCCCCCGAGTTGG + Intergenic
1034297481 7:149987059-149987081 GAAGAAGCAGGCCCCTGTGTGGG - Intergenic
1034441536 7:151088094-151088116 GCAGGGGCCTGTCCCTGACTTGG + Intronic
1034808544 7:154109795-154109817 GAAGAAGCAGGCCCCTGTGTGGG + Intronic
1035070291 7:156139791-156139813 GCAGAGGCCTCCCTCTGGGTGGG - Intergenic
1035121071 7:156567528-156567550 GAAGAGACTTGCCCTTTAGTGGG + Intergenic
1035577196 8:715465-715487 TCAGAAGCCTGTCCCTGAGTGGG + Intronic
1036137407 8:6174789-6174811 GAAGAGCGCTGGCCCTGACTTGG + Intergenic
1036522101 8:9501321-9501343 GAAGAGTGCTGCCCCTGGGCGGG + Intergenic
1038939807 8:32291958-32291980 GAAGAGGCCTTTCTCTGAGAAGG - Intronic
1039486087 8:37911024-37911046 GAAAAGGCATGCCACAGAGTGGG - Intergenic
1039900965 8:41752290-41752312 GAATAGGCCTGGCACAGAGTGGG + Intronic
1041528719 8:58838275-58838297 GAAGCGGCCTGCCTCTGATATGG - Exonic
1041732631 8:61077794-61077816 GCACAGGGCTGCCCATGAGTGGG + Intronic
1042439781 8:68811449-68811471 GAAGCTGCCTGCGTCTGAGTTGG - Intronic
1044564760 8:93651166-93651188 GAAGAGACATGCCACAGAGTAGG - Intergenic
1046240135 8:111478938-111478960 GAAGCTGCCTCCTCCTGAGTGGG - Intergenic
1048076057 8:131072769-131072791 GATGAGGGCTGCCCTGGAGTGGG + Intergenic
1051764797 9:20511964-20511986 GAAGAAGCCCATCCCTGAGTAGG + Intronic
1052570206 9:30211179-30211201 GAAGAGAAATGCCCCTGAGTAGG - Intergenic
1056574349 9:87843428-87843450 GAAGCTGCCTACCCCTGTGTGGG + Intergenic
1057204769 9:93164573-93164595 GAAGACGCCAGCCCCGGTGTGGG + Intergenic
1057698914 9:97348916-97348938 GAGGAGGCCTGGCCATGAGCAGG - Intronic
1060031941 9:120222088-120222110 GAAGCAGCCTGCCCCTGACGAGG - Intergenic
1060421596 9:123473082-123473104 GACACGGCCTGCCCCTGAGGAGG - Intronic
1061068506 9:128294265-128294287 GAAGTGGCCAGGCTCTGAGTGGG + Intergenic
1062101691 9:134731739-134731761 GTAGAGGCCCACCCCTGAGGAGG - Intronic
1062254330 9:135614003-135614025 GATGAGGCCTGTGCCTGAGGGGG - Intergenic
1189083955 X:38000830-38000852 GAAGAGCCCGGCCACTGAGCGGG - Intronic
1190339611 X:49286298-49286320 GAAGTGGCCTGGCCCTGAGCGGG + Exonic
1195458074 X:105092055-105092077 GAAAAGGCCTACCACTGAATAGG - Intronic
1196982601 X:121231739-121231761 GCAGATGCCTGCCTCTGTGTGGG + Intergenic
1198065965 X:133097113-133097135 AAAGAAGCCTGCCCCTGTGGCGG - Intergenic
1200124419 X:153806543-153806565 AAAGAGGCCTGTGCCTGGGTGGG - Intronic
1200250668 X:154552216-154552238 GAAGACGCCTTCCCCTCAGCAGG - Intronic