ID: 1002574071

View in Genome Browser
Species Human (GRCh38)
Location 5:180161659-180161681
Sequence CAGGAGCCGCGGGGCTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 930
Summary {0: 1, 1: 0, 2: 9, 3: 89, 4: 831}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002574071_1002574083 19 Left 1002574071 5:180161659-180161681 CCTCCCCAGCCCCGCGGCTCCTG 0: 1
1: 0
2: 9
3: 89
4: 831
Right 1002574083 5:180161701-180161723 CATTCGCGCCCATCTCTGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 89
1002574071_1002574079 -9 Left 1002574071 5:180161659-180161681 CCTCCCCAGCCCCGCGGCTCCTG 0: 1
1: 0
2: 9
3: 89
4: 831
Right 1002574079 5:180161673-180161695 CGGCTCCTGGAACACCGCTGTGG No data
1002574071_1002574082 18 Left 1002574071 5:180161659-180161681 CCTCCCCAGCCCCGCGGCTCCTG 0: 1
1: 0
2: 9
3: 89
4: 831
Right 1002574082 5:180161700-180161722 GCATTCGCGCCCATCTCTGCCGG 0: 1
1: 0
2: 0
3: 2
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002574071 Original CRISPR CAGGAGCCGCGGGGCTGGGG AGG (reversed) Intronic