ID: 1002575378

View in Genome Browser
Species Human (GRCh38)
Location 5:180171106-180171128
Sequence CTGGGCTGGGGGAAGGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 628
Summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 563}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002575378_1002575397 12 Left 1002575378 5:180171106-180171128 CCTGTGGCCTTCCCCCAGCCCAG 0: 1
1: 0
2: 4
3: 60
4: 563
Right 1002575397 5:180171141-180171163 CGAGGGCTTCACATCTTCAGGGG 0: 1
1: 0
2: 1
3: 16
4: 147
1002575378_1002575387 -6 Left 1002575378 5:180171106-180171128 CCTGTGGCCTTCCCCCAGCCCAG 0: 1
1: 0
2: 4
3: 60
4: 563
Right 1002575387 5:180171123-180171145 GCCCAGGAGTGGGACCCCCGAGG 0: 1
1: 0
2: 0
3: 26
4: 225
1002575378_1002575400 24 Left 1002575378 5:180171106-180171128 CCTGTGGCCTTCCCCCAGCCCAG 0: 1
1: 0
2: 4
3: 60
4: 563
Right 1002575400 5:180171153-180171175 ATCTTCAGGGGGAAGGAGCCAGG 0: 1
1: 2
2: 2
3: 37
4: 377
1002575378_1002575389 -5 Left 1002575378 5:180171106-180171128 CCTGTGGCCTTCCCCCAGCCCAG 0: 1
1: 0
2: 4
3: 60
4: 563
Right 1002575389 5:180171124-180171146 CCCAGGAGTGGGACCCCCGAGGG 0: 1
1: 0
2: 0
3: 12
4: 163
1002575378_1002575402 26 Left 1002575378 5:180171106-180171128 CCTGTGGCCTTCCCCCAGCCCAG 0: 1
1: 0
2: 4
3: 60
4: 563
Right 1002575402 5:180171155-180171177 CTTCAGGGGGAAGGAGCCAGGGG 0: 1
1: 0
2: 3
3: 27
4: 378
1002575378_1002575398 13 Left 1002575378 5:180171106-180171128 CCTGTGGCCTTCCCCCAGCCCAG 0: 1
1: 0
2: 4
3: 60
4: 563
Right 1002575398 5:180171142-180171164 GAGGGCTTCACATCTTCAGGGGG 0: 1
1: 0
2: 5
3: 16
4: 156
1002575378_1002575399 17 Left 1002575378 5:180171106-180171128 CCTGTGGCCTTCCCCCAGCCCAG 0: 1
1: 0
2: 4
3: 60
4: 563
Right 1002575399 5:180171146-180171168 GCTTCACATCTTCAGGGGGAAGG 0: 1
1: 0
2: 1
3: 9
4: 173
1002575378_1002575401 25 Left 1002575378 5:180171106-180171128 CCTGTGGCCTTCCCCCAGCCCAG 0: 1
1: 0
2: 4
3: 60
4: 563
Right 1002575401 5:180171154-180171176 TCTTCAGGGGGAAGGAGCCAGGG 0: 1
1: 0
2: 0
3: 30
4: 300
1002575378_1002575394 10 Left 1002575378 5:180171106-180171128 CCTGTGGCCTTCCCCCAGCCCAG 0: 1
1: 0
2: 4
3: 60
4: 563
Right 1002575394 5:180171139-180171161 CCCGAGGGCTTCACATCTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 78
1002575378_1002575396 11 Left 1002575378 5:180171106-180171128 CCTGTGGCCTTCCCCCAGCCCAG 0: 1
1: 0
2: 4
3: 60
4: 563
Right 1002575396 5:180171140-180171162 CCGAGGGCTTCACATCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002575378 Original CRISPR CTGGGCTGGGGGAAGGCCAC AGG (reversed) Intronic
900155597 1:1202273-1202295 CTGGGCTGGGGGCTGGGTACTGG - Intergenic
900155612 1:1202311-1202333 CTGGGCTGGGGGCTGGGTACTGG - Intergenic
900155646 1:1202406-1202428 CTGGGCTGGGGGCTGGGTACTGG - Intergenic
900155673 1:1202482-1202504 CTGGGCTGGGGGCTGGGTACTGG - Intergenic
900155708 1:1202577-1202599 CTGGGCTCGGGGATGGGTACTGG - Intergenic
900155721 1:1202615-1202637 CTGGGCTCGGGGATGGGTACTGG - Intergenic
900155734 1:1202653-1202675 CTGGGCTCGGGGATGGGTACTGG - Intergenic
900155765 1:1202748-1202770 CTGGGCTCGGGGATGGGTACTGG - Intergenic
900155778 1:1202786-1202808 CTGGGCTTGGGGATGGGTACTGG - Intergenic
900203398 1:1421043-1421065 CACGGCTGGGGGCAGGCCAGAGG - Intronic
900398742 1:2464168-2464190 CTGGGCTGTGGGAAGTCCTGGGG + Intronic
900457850 1:2786093-2786115 GTGGGGTGGGGGATGGCCAGGGG - Intronic
900485969 1:2923018-2923040 CAGGGCTGGGGGAGGCTCACGGG - Intergenic
901215929 1:7555428-7555450 CAGGGCTGTGGGGTGGCCACAGG - Intronic
901506692 1:9689757-9689779 CGGGGCTGGGGGCGGGGCACGGG - Intronic
901686411 1:10946032-10946054 CTGAGCTGGAGGAGGCCCACAGG - Intergenic
901825399 1:11858172-11858194 CTGGAATGGGGGAAGGCGGCCGG + Intronic
902470853 1:16646931-16646953 GTGTGCTGGGGGAAGGTCCCAGG - Intergenic
902487950 1:16760517-16760539 GTGTGCTGGGGGAAGGTCCCAGG + Intronic
902615937 1:17623569-17623591 CAGTGCTGGGGAAAGGGCACTGG + Intronic
902842494 1:19084129-19084151 CTTGAATGGGGGGAGGCCACAGG - Intronic
902862734 1:19257726-19257748 CTGTGATGGGGGAAGGCCCAGGG + Intronic
903330812 1:22596197-22596219 TGGGGCAGAGGGAAGGCCACAGG + Intronic
903572650 1:24317934-24317956 CTGTGTTGGGGGAAGCCCAGGGG - Intergenic
904046648 1:27613174-27613196 CTGGGGTGGGGGATGGTCACGGG - Intronic
904237942 1:29125900-29125922 GGGGGCTGGGGGAAGGCCCAGGG - Intergenic
904488993 1:30846737-30846759 CTGGGCAGGAGGAAGGGGACTGG + Intergenic
904562796 1:31410027-31410049 CTGGGCTGGGTGATGGGCACAGG + Intronic
905974429 1:42164609-42164631 CTGGGCCGGGGTAGGGACACAGG + Intronic
906243832 1:44259303-44259325 GTGGGGTGGGGGAAGGGCAGAGG + Intronic
906382276 1:45340346-45340368 CTGGGAGAGGGGAAGGCCTCGGG + Exonic
906676708 1:47698427-47698449 CTGGGCTGGGGCCAGGAGACCGG + Intergenic
907012564 1:50977682-50977704 CTGGGCTGGGGGCAGCGCGCGGG - Intergenic
910633208 1:89378629-89378651 CTGGGCTGTGGGTGGTCCACTGG + Intronic
912701109 1:111878795-111878817 CTTGGCTAGGTCAAGGCCACAGG + Intronic
913048092 1:115090082-115090104 CTGGGTTGAGGGCAGCCCACAGG - Intergenic
913076896 1:115347756-115347778 CTGGGCTGTGGGAAGTCCTTAGG + Intergenic
914079670 1:144396350-144396372 CTGGGCTGTGGGTAACCCACAGG + Intergenic
914174570 1:145264887-145264909 CTGGGCTGTGGGTAACCCACAGG + Intergenic
914350087 1:146833029-146833051 CTGGCCTAGGGGAAAGCCCCCGG - Intergenic
914379822 1:147105917-147105939 CTGGACTGGCGTGAGGCCACTGG - Intergenic
914529298 1:148506375-148506397 CTGGGCTGTGGGTAACCCACAGG + Intergenic
914682026 1:149945107-149945129 CTGGGGTGGGGGAATCCCCCAGG + Intronic
914800826 1:150961098-150961120 CCGGGCTGGGGGAAGCCGAATGG + Exonic
914825479 1:151135850-151135872 GGGGCCTGGGGGAAGGGCACAGG - Intronic
915448616 1:155989439-155989461 CTGGGCTGGGGGCAAGCAACAGG - Intronic
915515838 1:156412196-156412218 CTGGGCTTGGGAAGGGCCAGTGG + Intronic
915543411 1:156582656-156582678 GTGGGCAGGGGGAAGGGTACTGG + Intronic
916144556 1:161727172-161727194 CTGGGCTGGGGGAGGGGCGTAGG - Intronic
916491916 1:165309456-165309478 AAGGCCTGGGGGAAGGTCACAGG - Intronic
916891477 1:169116208-169116230 CTGAGGTGGGGGAAGGGCAATGG - Intronic
918200647 1:182263287-182263309 GTAGGCTGGGGGAAGGGCCCAGG + Intergenic
919980111 1:202637702-202637724 CTGGGCTGAGGCCAGGCCAAGGG + Intronic
920301151 1:204989914-204989936 CTGGGCCTGGGCCAGGCCACGGG - Intronic
920398066 1:205660778-205660800 CTGGGCTGGGGGCAGGGGGCTGG - Intronic
920702159 1:208226078-208226100 CTGGGCTAGGTGAAGGCAGCAGG - Intronic
921842839 1:219846741-219846763 CTGGGCGGTGGGGAGGTCACAGG + Intronic
922162834 1:223090891-223090913 CTAGGCCATGGGAAGGCCACGGG + Intergenic
922340739 1:224652965-224652987 CCCAGCTGGAGGAAGGCCACCGG + Intronic
922834107 1:228617231-228617253 GGGAGCTGGGGGAAGGCCGCGGG - Intergenic
922835216 1:228621687-228621709 GGGAGCTGGGGGAAGGCCGCGGG - Intergenic
922835775 1:228623907-228623929 GGGAGCTGGGGGAAGGCCGCGGG - Intergenic
923077814 1:230625377-230625399 GTGGGCTGGGTGAAGACCCCAGG + Intergenic
923665637 1:235996201-235996223 CTGTGCTGGGGGATGCACACAGG + Intronic
924573150 1:245256482-245256504 CTGGCCAGGGGCAAGGACACAGG - Intronic
924772032 1:247087543-247087565 CTGGGCAGGGGGAGGGCCCAGGG - Intergenic
924821754 1:247498751-247498773 CTGGGCAGGGGGACGGCTTCAGG + Intergenic
1062907087 10:1186502-1186524 CTGGGCTTGGGGAACGCGTCAGG - Intronic
1064830346 10:19457695-19457717 CTGGGTTGGTCCAAGGCCACAGG + Intronic
1065389441 10:25167922-25167944 CTGGGGTGGGGGCAGGGAACTGG - Intergenic
1067038234 10:42934354-42934376 CAGGGCTGGGGGCAGGTCAGGGG + Intergenic
1067343013 10:45419497-45419519 CGGGGCTGGGGGAGGGCCGGTGG - Intronic
1067471576 10:46541914-46541936 CTGGGCTGGGGGAAGGGGTGGGG - Intergenic
1067907337 10:50307195-50307217 CTGGCCAGGGGAAAGGCCAATGG + Exonic
1070225364 10:74498668-74498690 GTGGGCTGGGGGAAGGGGAGAGG - Intronic
1070312606 10:75284423-75284445 CTGGGTTGGGGGAAGGGGACTGG + Intergenic
1070388611 10:75949517-75949539 AAGGGTTGGGGGAAGGCCATGGG + Intronic
1070588891 10:77787594-77787616 CTGAGCTGCGGGAAGCCCGCAGG - Intergenic
1070736278 10:78865840-78865862 CTGGCCTGGGGGAAGGCAGAAGG - Intergenic
1070827359 10:79399069-79399091 CTGGGCTGAGGGGAGGCCCTAGG - Intronic
1070833044 10:79432030-79432052 TAGGGCTGGGGGAAGGCTTCAGG - Intronic
1070959608 10:80489474-80489496 TGGGGATGGGGGAAGGCCAAAGG + Intronic
1071294841 10:84211920-84211942 CTGGGGAGGGGGCAGGCCATAGG + Intronic
1072540869 10:96397100-96397122 CTGGGCTGGGAGAGGGACAGTGG + Intronic
1072784319 10:98269509-98269531 CTGGGGTGGGGCAGGGGCACTGG - Intergenic
1072790923 10:98317291-98317313 CTGGTCTGGTGGAATGCCTCTGG + Intergenic
1073120820 10:101121802-101121824 CTGGGCTGGGGGCAGCCAGCGGG - Intronic
1073288435 10:102401927-102401949 CTGGGGAGGGGGCAGGGCACAGG - Intronic
1073460305 10:103662002-103662024 CAGGGCTGGGGGCAGGCCTGAGG - Intronic
1073624747 10:105085299-105085321 GTGGGCTGGAGGAGGGCCTCAGG + Intronic
1073901128 10:108222285-108222307 CTGCCCTGGGAGAAGGCCAGTGG + Intergenic
1074327641 10:112468184-112468206 CTGGGTTGCAGAAAGGCCACCGG + Intronic
1075909648 10:126113074-126113096 CTGGGCAGTGGGCAGGCCAAAGG + Intronic
1076273442 10:129176201-129176223 CTGGGCTGGAGGATGGAGACAGG + Intergenic
1076284204 10:129277407-129277429 CTGGGCTTGGGTGAGGTCACTGG + Intergenic
1076542620 10:131223834-131223856 GTGGGCAGGGGGAGGGCCAGGGG - Intronic
1076629383 10:131843106-131843128 CTGGCCTTGGGGATGGCCAGGGG - Intergenic
1077021830 11:420393-420415 CTGGCCAGCGGGAAGCCCACAGG + Intronic
1077145230 11:1041561-1041583 CTGGGGTGGGGGCAGGATACGGG + Intergenic
1077225930 11:1439175-1439197 CTGGGCTGGGGGCTGCCCTCAGG + Intronic
1077358085 11:2127797-2127819 CAGGGCTGGGGGAGGGGCACAGG + Intergenic
1077394664 11:2315150-2315172 GTGGGCTGGGGGAGGGCTGCCGG - Intronic
1077864514 11:6211449-6211471 CCGGGCTGGGGCTAGGGCACAGG - Exonic
1078251341 11:9619101-9619123 CTGGACTGGGTGAAGGGCACAGG + Intergenic
1078423522 11:11231312-11231334 CTGGGCTGGGCTAAGGTCCCTGG - Intergenic
1080416200 11:32072208-32072230 CTGGGGTGGGGGCAGGCGAGAGG - Intronic
1082786994 11:57322716-57322738 CTGGGCTGGGAGAACGGGACAGG + Intronic
1083890929 11:65595485-65595507 CAGGGCTGAGGGAAGGTCCCAGG + Exonic
1084323094 11:68384412-68384434 CTGTGCAGGGGCATGGCCACAGG + Intronic
1084326081 11:68401003-68401025 CAGGGCTGGGGGAGGGACATCGG - Intronic
1084605677 11:70170238-70170260 ATGGGCAGGGGGATGACCACAGG + Intronic
1084658682 11:70534568-70534590 CAGGGCTGGGACAAGGCCCCAGG + Intronic
1084677085 11:70641852-70641874 CTGGGCTGTGGGCAGTCCAGCGG + Intronic
1084703147 11:70800712-70800734 CTGGGCTGAGAGGAGCCCACAGG - Intronic
1084978702 11:72816991-72817013 CTGTCCTGTGGGAAGGCCAAGGG - Intronic
1085588604 11:77735152-77735174 CTGGGGTGGGGGACGAGCACCGG + Intronic
1085747735 11:79129294-79129316 GTGGGTTGGGGGAACTCCACAGG + Intronic
1087168615 11:95027720-95027742 CTGGCCATGGTGAAGGCCACAGG - Intergenic
1087171238 11:95051583-95051605 CTGGCCATGGTGAAGGCCACAGG - Intergenic
1089697899 11:120227026-120227048 CTGGGCGGAGGGAAGGGGACAGG + Intronic
1090266084 11:125353841-125353863 CTCAGCTTGGGGAAGGCCAATGG - Intronic
1090442656 11:126737199-126737221 CTGGGCTGGGGCCTGGCCTCAGG + Intronic
1091046264 11:132328590-132328612 CTGTGCTGGAGGAAGGACACAGG - Intronic
1092696507 12:11177466-11177488 CTGGGTTGGGGGGAGGGCAGGGG + Intergenic
1093764146 12:22942970-22942992 CAGGGCTGGGGCAAGGTCAAAGG + Intergenic
1094483394 12:30903513-30903535 GGAGGCTGGGGAAAGGCCACTGG + Intergenic
1094718844 12:33040950-33040972 GTGGGGTGGGGGAAGCCCAAAGG - Intergenic
1095591861 12:43912346-43912368 GTGGGGTGGGGGAAGGGGACAGG + Intronic
1095984203 12:47988822-47988844 CTGGGCAGGGAAAAGGGCACAGG - Intronic
1096258683 12:50077869-50077891 CTGGGGTGGGGGAAGTCTATAGG - Intronic
1096601987 12:52735968-52735990 CCAGGCTGGGGGCAGGTCACAGG - Intergenic
1096743148 12:53709291-53709313 ATGGGCTGGGGGAAACCCAGGGG - Intronic
1098302305 12:69066924-69066946 CTGGGCTTGGGGATGGGCATAGG - Intergenic
1100781092 12:98027378-98027400 CTGGGGTAGGGGGTGGCCACTGG - Intergenic
1101827116 12:108229065-108229087 ATGGCCTGGGGGTAGGGCACTGG - Intronic
1102156056 12:110728981-110729003 GTGGTCTAGGGGAGGGCCACAGG + Intronic
1102470687 12:113158252-113158274 GTGGGCTGGGGGAGGGGAACAGG - Exonic
1102678309 12:114673375-114673397 CTGTGCTGGGGGGAGGTCTCAGG - Intronic
1102772027 12:115486371-115486393 CTGGGCTGAGGAAAGCTCACAGG + Intergenic
1103730348 12:123023104-123023126 CTGGGCTGGGGCCAGCTCACTGG + Intronic
1104067473 12:125317495-125317517 CTGGGCTGGGGGCAGGACTTTGG + Intronic
1104861217 12:131925113-131925135 CTAGGCTGGGAGAGGGCAACAGG - Intergenic
1107312770 13:39097557-39097579 CATGGCTGGGGGGAGGCCTCAGG + Intergenic
1107926620 13:45269386-45269408 CCAGGCTGGGGGTAGGCCAGAGG + Intronic
1108068981 13:46607960-46607982 GAGGGATGTGGGAAGGCCACAGG + Intronic
1110436912 13:75485831-75485853 CTGGGCTGAAGGAAGGTCACAGG - Intergenic
1112462915 13:99618706-99618728 CTGGGTGGGGGGAAGGGAACAGG - Intronic
1112562522 13:100526815-100526837 CTGAGCTGGGTTAAGCCCACTGG - Intronic
1112754937 13:102621768-102621790 ATGGGCTGGGGGAAGAACAGAGG + Intronic
1113343286 13:109447582-109447604 GGGGACTGGGGAAAGGCCACTGG + Intergenic
1113787398 13:113009781-113009803 ATGGGCTTCGGGAAGGCCTCTGG + Intronic
1113811589 13:113146052-113146074 CTGGGGTGGGGGAAGACCTGGGG - Intronic
1115119994 14:29927650-29927672 CTGGGCTGGGGGAGGGCAAGGGG + Exonic
1115264582 14:31487787-31487809 CTGGCGCAGGGGAAGGCCACAGG + Intronic
1117338047 14:54771635-54771657 TTGGGATGGGGGTAGGCCCCAGG - Intronic
1118255275 14:64200335-64200357 CGGGGGTGGGGGAAGGGCTCAGG - Intronic
1119063385 14:71500302-71500324 TTTGGCTGGGGGAAGGCAAGAGG - Intronic
1119866808 14:77981140-77981162 CTGGGCTGGGGGAGGGCAGCAGG - Intergenic
1120542012 14:85762324-85762346 CTGACCTGGGGGAAGTTCACTGG + Intergenic
1121150572 14:91630003-91630025 CTGGGCTGGGGAAATGGCACAGG - Intronic
1121219590 14:92275575-92275597 CTGGGCTGTGAGAACCCCACAGG + Intergenic
1121486892 14:94323225-94323247 CTGGGCAGGGGGAGGGACAGAGG + Intronic
1122151667 14:99729214-99729236 CTGAGCCTGTGGAAGGCCACTGG - Intergenic
1122203296 14:100135684-100135706 CTGGGGAAGGGGAAGGCTACAGG - Intronic
1122245084 14:100396761-100396783 GTGGGCTGTGGCAGGGCCACAGG + Intronic
1122557845 14:102591462-102591484 GTTGGCTGGGGGTAGGGCACCGG + Intergenic
1122608406 14:102963732-102963754 TTGGGCTGTGGGAGGGTCACAGG + Intronic
1122663061 14:103310777-103310799 CTTTTCTGGGGGAAGGCCTCAGG + Intergenic
1122836194 14:104432225-104432247 CTGGGCTCAGGGAGGGCCAGGGG + Intergenic
1122890834 14:104731559-104731581 CTGAGCTCTGGGAAGGCCATGGG - Intronic
1122913588 14:104845509-104845531 GTGGGGTGGGGGAGGGGCACAGG - Intergenic
1122973220 14:105160525-105160547 CGGGGCTCGGGGAAAGCAACAGG + Intronic
1202904482 14_GL000194v1_random:60335-60357 CTGGGTTGGGGTAAGTCTACTGG - Intergenic
1123898038 15:24848182-24848204 GTGCGCTGTGGGAAGGTCACAGG + Intronic
1123939818 15:25211409-25211431 CTGGGCTTGGGCAAGACCCCTGG - Intergenic
1123995671 15:25716346-25716368 CTGGCCTGGGGCAGGGCCAGAGG - Intronic
1124061672 15:26298642-26298664 CTGGCCCGTGGGGAGGCCACTGG + Intergenic
1124177022 15:27435906-27435928 CTGGGCTCTGGGAATGGCACAGG + Intronic
1124420673 15:29518629-29518651 AAGGGCAGGAGGAAGGCCACAGG + Intronic
1124495725 15:30185747-30185769 CTGGGCTGAGGCCAGGCCAAGGG + Intergenic
1124747848 15:32352899-32352921 CTGGGCTGAGGCCAGGCCAAGGG - Intergenic
1126104418 15:45138262-45138284 CAGGGCTGTGGGAAAGCCAGTGG + Intronic
1127207403 15:56734452-56734474 CAGTGCTGGGGGAAGCCCTCAGG - Intronic
1127842590 15:62843916-62843938 CTGGGCTCTGGAAAGGCCTCTGG + Exonic
1128218303 15:65949643-65949665 CTGGGCTGAGGAATGGCCAGAGG + Intronic
1128336194 15:66787180-66787202 CTGGGCTGGCCCATGGCCACGGG - Intergenic
1128347683 15:66864867-66864889 CTGGCCTGGAGGACTGCCACTGG + Intergenic
1128674645 15:69599754-69599776 CTGTGCTGGGGAAAGCCCTCAGG - Intergenic
1129161708 15:73751520-73751542 TTGGGATGGGGGAAGGCAGCAGG + Exonic
1129230770 15:74196113-74196135 CTTGGCTGGGGACAGGCCCCGGG - Exonic
1129525052 15:76208524-76208546 ATGGGCTGGAGGAAGGGCTCTGG - Intronic
1129865237 15:78902417-78902439 CTGGGCCTGGGGGGGGCCACTGG + Intergenic
1129888363 15:79054571-79054593 CTGGGCTGGGGAAAGGCACATGG - Intronic
1130018344 15:80204438-80204460 CCGGGCTGGGGGAAGGGGAATGG - Intergenic
1130511691 15:84594943-84594965 CTGGGATGGGTGAAGTCCTCTGG - Intergenic
1130542879 15:84834731-84834753 AGGGGCTGAGGGAAGGCCACAGG + Intronic
1130547705 15:84868796-84868818 CTGGGCTGGGGCAAGGGCTTGGG - Exonic
1131120670 15:89821586-89821608 GTGGGCTGGGGGAGGGAGACAGG + Intergenic
1131231214 15:90660905-90660927 CTGGGCTGGGCCCAGGGCACCGG + Intergenic
1131370166 15:91874412-91874434 CAGGGCTGGGGGAAGGGGAGTGG - Intronic
1132349790 15:101132671-101132693 CTGGGCTGGAGCTAGGCCTCAGG - Intergenic
1132543354 16:521661-521683 CTGGGCAGGGTGGATGCCACAGG + Exonic
1132880818 16:2160983-2161005 CTGGGCTGAGGGGAGGCCTCGGG + Intronic
1132981941 16:2742724-2742746 CTGGGCTGGTGGAAGGAGCCAGG + Intergenic
1133229176 16:4358374-4358396 CGGGGCAGCCGGAAGGCCACAGG + Exonic
1133429672 16:5725697-5725719 CTGGCATGGGGGAAATCCACTGG + Intergenic
1133916386 16:10113093-10113115 CTGGGCTGGGGGGCGCCCCCAGG - Intronic
1135603663 16:23804378-23804400 CTTGGCTGGGGGAAAGACAGTGG + Intergenic
1135680323 16:24450866-24450888 CTGGGCTGATCCAAGGCCACTGG + Intergenic
1136022507 16:27449040-27449062 CTGGGCTGGGGGACTGCCCTGGG + Exonic
1136061042 16:27726725-27726747 CTGAGCTCGGGGAAGGCCTCTGG - Intronic
1136412665 16:30086166-30086188 CAGGGCTGGGGGAAGGGAGCGGG + Exonic
1136534639 16:30892663-30892685 CTGGGCTGGGGGGTGCCCCCAGG + Exonic
1136867073 16:33767330-33767352 CAGCGCTGGGGGAAGCCCACAGG - Intergenic
1137270195 16:46898050-46898072 CTGGGCTGGGAGGAGGCGTCGGG + Intronic
1137600376 16:49752287-49752309 GTGGGGTGGGGGAGGGCCACTGG - Intronic
1137671924 16:50284148-50284170 CTGGCCTGGGGACATGCCACTGG + Intronic
1137708468 16:50550428-50550450 ATGGGCTGGGGAGAGGCCAGTGG + Intronic
1138430129 16:56963179-56963201 GTGGGCTGGGGGCAAGCCCCAGG - Intronic
1138591074 16:58000198-58000220 CCGGGCTGGAGAAAGGCCCCAGG + Intronic
1139428048 16:66895436-66895458 TTGGGCTGGGGACAGGCCTCAGG - Intronic
1139983952 16:70882502-70882524 CTGGCCTAGGGGAAAGCCCCCGG + Intronic
1140200619 16:72891781-72891803 CTGGGCTGGGGGTTGGGGACAGG - Intronic
1140246282 16:73252881-73252903 GTATGCTGGCGGAAGGCCACCGG + Intergenic
1140391298 16:74589422-74589444 CTGTGCTGAGGGAAGGGCACTGG + Intronic
1140455577 16:75103505-75103527 CTGGGCGGGGGGAAGGGGAGTGG + Intronic
1140847866 16:78907227-78907249 CTGGGTGGGGGGCAGGGCACAGG + Intronic
1141173521 16:81705134-81705156 CTGGGCCGGGGGCAGGCTGCAGG - Intronic
1141348807 16:83274088-83274110 CTGGCCTGGGGGAAGGCGAGAGG - Intronic
1141480712 16:84304852-84304874 CTGAGCTGGGGCTGGGCCACAGG + Intronic
1142108343 16:88318185-88318207 CTGGGCTGGAGGGAGGCCGCTGG + Intergenic
1142235589 16:88921065-88921087 CTTGCCTGGGGGAAGGCCCAGGG - Intronic
1142284287 16:89165454-89165476 CTGGGTAGGGAGAAGGGCACGGG - Intergenic
1203105091 16_KI270728v1_random:1348873-1348895 CAGCGCTGGGGGAAGCCCACAGG + Intergenic
1203128423 16_KI270728v1_random:1613495-1613517 CAGCGCTGGGGGAAGCCCACAGG - Intergenic
1142472122 17:170394-170416 CTGGGCTGGGGGACAGCCTGGGG + Intronic
1142984971 17:3690192-3690214 CAGGCCTGGGGGAGGGGCACAGG - Intronic
1143478849 17:7217463-7217485 CTGGGGTGGGGGAGGGGAACTGG + Intronic
1143667986 17:8375434-8375456 CTGGGCTGCGTGCAGCCCACAGG - Intronic
1144966389 17:19079206-19079228 CTGGGCTGGGGGATGGTGCCTGG + Intergenic
1144981529 17:19172851-19172873 CTGGGCTGGGGGATGGTGCCTGG - Intergenic
1144986695 17:19205388-19205410 CTGGGCTGGGGGATGGTGCCTGG + Intergenic
1145883371 17:28367304-28367326 TTGGGCTGGGGGAAGGAGATGGG + Exonic
1146262017 17:31428048-31428070 CTGGGGTGAGGGAAGGGCAGAGG - Intronic
1146380406 17:32323358-32323380 CTGGGCTCAGGGAAGACCAGGGG + Exonic
1147947507 17:44088335-44088357 CTGTGGTGGGGGCAGGACACAGG - Intronic
1148000753 17:44385712-44385734 CAGGCCTGGAGAAAGGCCACAGG + Exonic
1148757460 17:49981077-49981099 CTGGGCTTGGGGAATGTGACAGG - Intergenic
1148782716 17:50130500-50130522 CTGGGCTGGGGGATTCCCAGAGG + Intergenic
1148938530 17:51186060-51186082 CTGGGAGGTGGGAAGGCCTCCGG + Intronic
1149204986 17:54233656-54233678 ATGGGTTGGGAGAGGGCCACAGG + Intergenic
1149286013 17:55165432-55165454 TTGGGCTGGAGGAAGCTCACTGG - Intergenic
1149517986 17:57294871-57294893 CTGGGTTGGGTGCAGGCCAGGGG + Intronic
1150265410 17:63829386-63829408 ATGAGCTGAGGGAAGGGCACAGG - Intronic
1151004278 17:70415734-70415756 CTAACCAGGGGGAAGGCCACAGG - Intergenic
1151382298 17:73734316-73734338 CTGGGCTGGGGGAAGGAGGGGGG - Intergenic
1151384247 17:73745473-73745495 CTGGGCTGAGAGAAGCCCTCAGG + Intergenic
1151679759 17:75617081-75617103 CTGGGCTGGGGGACAGCATCTGG - Intergenic
1151723180 17:75869829-75869851 CTGGGGTGTGGGGAGGCCATGGG + Intergenic
1152015331 17:77746952-77746974 CTGGGCTGGGGCAGGCCCAGGGG - Intergenic
1152475721 17:80516813-80516835 CTGGGCTGGGGAAGGGGCTCTGG - Intergenic
1152627985 17:81396963-81396985 CTGGGCTGGGAGTGGGCCCCGGG + Intronic
1152757726 17:82093961-82093983 CTGGGCTGGCTGCTGGCCACAGG - Intronic
1154152087 18:11914321-11914343 CTGTGCTGGGAGAGGGTCACTGG - Intergenic
1156479372 18:37426492-37426514 CTGAGCTGTGGGAGAGCCACTGG + Intronic
1157269760 18:46263698-46263720 CTGTGCTGTGGGAAGTCAACAGG - Exonic
1157600552 18:48890527-48890549 CTGGGTGGGGGGCACGCCACAGG + Intergenic
1157724455 18:49953137-49953159 CTGGGCAGGGAGGAGGCCAACGG - Intronic
1158427454 18:57352674-57352696 CGGGGGTGGGGGGAGGCCACCGG - Exonic
1158845739 18:61440795-61440817 ATGGGATGGGGGAAGGGCACAGG + Intronic
1159924993 18:74261422-74261444 CTGGCCAGGGGGAAGCCCAGTGG + Intronic
1160855440 19:1215158-1215180 CTGGGCTCGGCAAAGGCCCCGGG - Intronic
1160856415 19:1219958-1219980 ATGGGCTGGAAGCAGGCCACTGG - Intronic
1160923858 19:1533701-1533723 CTTGGCTGGGGCCAGGACACAGG - Intronic
1160940379 19:1618006-1618028 CTGGGCTGGTGGAAGGCACAGGG + Intronic
1161087770 19:2343082-2343104 CTGGGCAGGTGGAAGGGCAGTGG + Intronic
1161159694 19:2755049-2755071 CTGTGCTGGGTGGAGGCCACGGG - Exonic
1161197335 19:2994104-2994126 GTGGGCTGGGGGCAGGACCCGGG + Intronic
1161239672 19:3215181-3215203 CTGGGCTGGGGAGAAGACACTGG + Intergenic
1161246452 19:3255123-3255145 GGGGACTGGGGGACGGCCACAGG - Intronic
1161296622 19:3523474-3523496 CTGGGCTCCAGGCAGGCCACTGG + Intronic
1161719622 19:5895674-5895696 GCGGGCTGGGGGTAGGCCAGGGG + Intronic
1161852435 19:6744723-6744745 CTGGGCTACGGGAAGGGCAGAGG + Intronic
1162597693 19:11641654-11641676 CTGGGGTGGGAGAAGTCCCCTGG + Intergenic
1162816530 19:13198722-13198744 TGGGGCTGGGGGAAGCTCACAGG + Intergenic
1162990934 19:14301699-14301721 CTGGGCTGGAGGCAGCCCAAGGG + Intergenic
1163009425 19:14415728-14415750 AGGGGCTGGGGGATGGCAACAGG - Intronic
1163276635 19:16288636-16288658 CTGGGGTGGGGGAAGGGAAATGG - Intergenic
1163611063 19:18301826-18301848 CTGAGCTGGGAGAAGGTCAATGG + Intergenic
1163677551 19:18662893-18662915 CTTGGCAGGGGAAAGGCCACGGG + Intronic
1164542227 19:29129552-29129574 ATGCGTTGGGGGATGGCCACAGG + Intergenic
1164816935 19:31211520-31211542 CTGGGCTGGGGCAGGGGCAGTGG + Intergenic
1165247309 19:34505005-34505027 CTGGGCTGGGTGGAGGCTGCAGG - Exonic
1165330383 19:35138686-35138708 CTGGGCTGGGGGCCGCCCCCTGG + Intronic
1165435385 19:35792207-35792229 CTGGGGTGGGGGCAGGCCGAGGG + Intergenic
1165744562 19:38222860-38222882 CCAGGCTGGGGGAAGGGGACAGG + Intronic
1165963636 19:39556009-39556031 CTGGGCTGGAGGTAAGCCCCTGG - Intergenic
1165971033 19:39629937-39629959 CTGGGCTGTGGCAAAACCACTGG - Intergenic
1166048178 19:40241987-40242009 CTGGTGCGGGAGAAGGCCACTGG - Exonic
1166094076 19:40529002-40529024 AAGGGCTGGGGAAAGGCCCCGGG - Intronic
1166140378 19:40802200-40802222 CTGGGCTGAGGGAAGGAAAGGGG + Intronic
1166301181 19:41913008-41913030 CTGGGAGAGGGGAAGGCCCCGGG - Intronic
1166919797 19:46221411-46221433 CTGGGATGGGGGACAGACACAGG + Intergenic
1167366786 19:49058619-49058641 GTGGGCGGGGGGAAGGGTACGGG + Exonic
1167375252 19:49107735-49107757 CTGGGGTGGGGGGCGGTCACGGG + Intronic
1167569169 19:50276246-50276268 CAGGGCTGGGGGAAGGACTTAGG + Intronic
1167666054 19:50823331-50823353 GTGGGGTGGGGGAAGCCCATGGG + Intronic
1167705730 19:51079850-51079872 CTGGCCATGGGGAAGGGCACAGG - Intronic
1168590976 19:57633936-57633958 CTGGGCCGGGGCAAGGGTACAGG + Intronic
1202653396 1_KI270707v1_random:26510-26532 CAAGGCTGGGGGAGGGGCACCGG + Intergenic
1202703249 1_KI270713v1_random:3723-3745 GTGTGCTGGGGGAAGGTCCCAGG - Intergenic
925886044 2:8394432-8394454 CTGGGCAGGGGGAAGGTGAAGGG - Intergenic
926109423 2:10172585-10172607 GAGGGCTGGGGAAAGGGCACAGG - Intronic
927053418 2:19350593-19350615 CTGCGCTTGGGAAAGGCCGCGGG + Intergenic
927199564 2:20569962-20569984 CAGGGCTGGGGGCAGCCCAGAGG - Intronic
927519999 2:23692948-23692970 CTGGGCTGGGGTCAGGCGTCAGG - Intronic
927862836 2:26570870-26570892 GTGGGATGGAGGAGGGCCACAGG + Intronic
927911541 2:26903483-26903505 CTGGGCTGGGGACTGGACACTGG - Intronic
927920831 2:26970860-26970882 CCGGGCTGGGGGAGGGGAACCGG + Intronic
928308144 2:30188172-30188194 CTGGGCTCGGGGAAGGTAGCAGG + Intergenic
928702459 2:33912796-33912818 CTGGGCAGGAGGCAGGTCACTGG - Intergenic
929032406 2:37661520-37661542 CGGGGCTGGATGAAGCCCACAGG + Intronic
929140983 2:38666369-38666391 CTGGGCTGCGAGCAGGCCCCAGG + Intronic
929686346 2:44038497-44038519 GAGGGCTGGGGGCAAGCCACGGG + Intergenic
929711313 2:44269689-44269711 CTGGGCTGAGGGGAGGCAAGGGG + Intergenic
929822258 2:45282930-45282952 CTGGGCAGGGAGCAGGCCTCAGG - Intergenic
929988142 2:46758337-46758359 TTGGGCAGCAGGAAGGCCACCGG - Intronic
931567691 2:63632144-63632166 CTGTGCTGGTGCAAGGGCACTGG - Intronic
932329379 2:70889071-70889093 CTGGGCTCGGGAAAGGCAGCGGG - Intergenic
934123574 2:88864056-88864078 CTGGGATGGGGGAAGGTAAAAGG + Intergenic
934708686 2:96501816-96501838 CTGGGCTGGGGGAGGGAGGCTGG + Intronic
934925922 2:98381725-98381747 CTGGGCTGGGGGAAGGAGGCTGG + Intronic
937236984 2:120437028-120437050 CAGGGCTGGGGGAAGGCAGCAGG + Intergenic
940903421 2:159147353-159147375 CTGGGCTGGAGGGAGGGAACAGG - Intronic
944264372 2:197707159-197707181 CTTGGCTGGTGAAAGCCCACCGG + Exonic
944868281 2:203883768-203883790 CTGGGCTGAGGGAAGGAGGCTGG + Intergenic
946161784 2:217840017-217840039 CTGGGCTGAGAGAAGGGCAGAGG + Intronic
946193809 2:218021712-218021734 CAGGGTAGGGGGAAGGCCTCAGG + Intergenic
946504537 2:220284845-220284867 TTGGGGTGGGGGAAGCCCACAGG - Intergenic
946791622 2:223306505-223306527 CATGGCTGGGGGGAGGCCTCAGG + Intergenic
947911705 2:233804924-233804946 CTGGGCTCTGGGAATGCTACGGG - Intronic
948457690 2:238114452-238114474 CTGGGCTGGGGGAATGGCAAAGG - Intronic
948729010 2:239951858-239951880 CTGGGCAGCGGGAAGGACAGTGG + Intronic
948751348 2:240135203-240135225 CTGGGTTGGGGGATGCCGACTGG - Intronic
948789430 2:240369746-240369768 CTGGGCAGGGCGAGGGACACTGG + Intergenic
1169263640 20:4154870-4154892 GTGGGCTGGGGGCAGGACAGAGG + Intronic
1169799495 20:9500371-9500393 CTGGCCTGGGGGAAGGCTGGAGG - Intergenic
1170898126 20:20435004-20435026 CTGGGCATGGGGTAGGACACAGG - Intronic
1172583473 20:36065865-36065887 CGGGGCTGGGAGGAGGCCGCAGG + Intergenic
1172970925 20:38872577-38872599 CAGGGCTGGGGTAGGGCCACCGG + Intronic
1173482863 20:43416802-43416824 GTGTGCTGGGGGAAGCCCATGGG - Intergenic
1173550923 20:43932735-43932757 CTGGGTTGGGTGAAGGCAAGGGG + Intronic
1173666743 20:44768425-44768447 CTGGGCTGGCAGAAGCCCAAGGG + Intronic
1173750392 20:45470922-45470944 CAGGGCTGGGGGAGGCCCCCAGG - Intronic
1175063251 20:56263156-56263178 CTGGGCTTGGGGGAGGCAGCAGG + Intergenic
1175349659 20:58309386-58309408 CTGGGCTCGGGGGATGCCAGGGG - Intergenic
1175371608 20:58496383-58496405 CTGGCCTGGGGGCAGGCGTCAGG - Intronic
1175942803 20:62545743-62545765 CTGGGCTGTGGGCAGGACAGGGG - Intergenic
1175944100 20:62550800-62550822 GAGGGCTGGGGGAAGGGCAGGGG + Exonic
1175961975 20:62642050-62642072 AGGGGCTGGGGGAACGCCACGGG - Exonic
1176022541 20:62969373-62969395 CGGGGCTGGGGGAGAGCAACGGG - Exonic
1176073576 20:63238660-63238682 CTGTGCTTGGCCAAGGCCACTGG + Intronic
1176119118 20:63446148-63446170 CTGAGCTGAGGGAAGGCCCCAGG + Intronic
1176138099 20:63533858-63533880 CTGGGCTGGGGGCAGCCCCCAGG - Intronic
1176145229 20:63562473-63562495 CTGGGCTGGGGGACCGCCCCGGG - Intronic
1176157340 20:63628139-63628161 GGGGGCTGGAGGAGGGCCACAGG - Intergenic
1176598763 21:8773145-8773167 CAAGGCTGGGGGAGGGGCACTGG - Intergenic
1176644686 21:9339421-9339443 CGAGGCTGGGGGAGGGGCACCGG - Intergenic
1180009371 21:45039889-45039911 AGGGGCTGGGGGAAGCCCCCAGG + Intergenic
1180027108 21:45172222-45172244 CCGGGGTGGTGGAAGGCCGCTGG + Intronic
1180162748 21:46005653-46005675 CTGGGCTGGAGGAGGGCAGCAGG + Intergenic
1180377829 22:12111519-12111541 CGAGGCTGGGGGAAGGGCACCGG - Intergenic
1180419675 22:12801761-12801783 CAAGGCTGGGGGAGGGGCACCGG + Intergenic
1180594749 22:16965775-16965797 CCGTGCTGGGCCAAGGCCACAGG + Intronic
1180881778 22:19209375-19209397 CTGGGCCGGGGGTAGGACATGGG + Intronic
1181053832 22:20250132-20250154 CTTGGCTGGGGGAATTCCAATGG - Intronic
1181926189 22:26360704-26360726 CTGTGCTGGGGAAAGCGCACAGG - Intronic
1182340598 22:29617460-29617482 ATGGGGTGGGGGAATGCTACTGG - Intronic
1182371501 22:29814539-29814561 CTGGGCAGGGAAGAGGCCACTGG + Intronic
1182551140 22:31101254-31101276 CTGTGATGGGGGAAGCCCAGGGG + Intronic
1182760748 22:32720702-32720724 CTGTGGGGTGGGAAGGCCACGGG - Intronic
1184042230 22:41951130-41951152 ATGGGCAGGGGGAAAGCCTCTGG - Intergenic
1184186315 22:42867586-42867608 CTGGGCTGTGTCAAGGCCTCAGG - Intronic
1184191600 22:42898684-42898706 CTGGGCTCGGGGAAGGGCATGGG - Intronic
1185143582 22:49117261-49117283 CGGGGCTGGGGAAAAGCCAGGGG + Intergenic
1185171031 22:49294778-49294800 CTACGCTGGGGGAAGCACACAGG + Intergenic
1185336131 22:50271623-50271645 CTGGGTTGGGGCGAGGACACGGG + Intergenic
1185414897 22:50704598-50704620 CGGGGCTGGGGGAGGGCCACGGG - Intergenic
949129576 3:483638-483660 CAGGGCTTGGGGGAGGCCAAAGG + Intergenic
949878213 3:8641042-8641064 CAGGGCTGGGGAAATGGCACAGG - Intronic
950152894 3:10702088-10702110 CTGGGTAGCGGGAAGCCCACTGG - Intronic
950665061 3:14490332-14490354 GTAGGCAGGGGGAAGGCCAAGGG - Exonic
951629170 3:24699630-24699652 CTGGTCTGGGGGAAAACCATGGG + Intergenic
952377697 3:32781067-32781089 CTGGGGTGGGGGAGGGCCGAGGG - Intergenic
952801156 3:37293214-37293236 CTGGGCTGCATGCAGGCCACGGG - Intronic
953031393 3:39182175-39182197 CTGGGCTAGGGGTAGGCTAGGGG + Intergenic
953033158 3:39190959-39190981 CTGGGCTGGTGTCAGGCCCCTGG + Intronic
953352832 3:42229068-42229090 CTGGGCTGGGAGAAGGGCTTGGG - Intergenic
953385258 3:42502581-42502603 CAGGGCTGGGGGCGGGCCCCGGG - Intronic
953406954 3:42664444-42664466 CTGGGTTGGGGGCAGGCCTGGGG - Exonic
954298579 3:49687312-49687334 GTGTGCTGGGGGAAGGCCCCAGG + Intronic
954303375 3:49713157-49713179 CTGGGCAGGGGGCAGGCTAGGGG - Intronic
954409641 3:50364836-50364858 CTGGGCGGGCGCAAGGCCGCGGG + Intronic
954628783 3:52037121-52037143 CTGGGCTGGGGGAAGGTGGGAGG + Intergenic
955046919 3:55369524-55369546 CTGGGCCTGGGGATGCCCACTGG + Intergenic
955071650 3:55576891-55576913 CAGGGCTCAGGAAAGGCCACAGG - Intronic
956826045 3:72997282-72997304 CTGGGCTGGGGGAGGGGAGCCGG + Intronic
958154893 3:89743915-89743937 ATTGGCTGGGGGAAGCCCACTGG - Intergenic
960613950 3:119580134-119580156 CTGGGATGGGGGAAGAAGACCGG - Exonic
960733471 3:120751414-120751436 CTGGATTTGGGGAAGGCCTCTGG + Intronic
960769337 3:121174919-121174941 CTGAGCTGGGGAAAGGGAACAGG + Intronic
960944695 3:122958130-122958152 CTGGGCTGGGGGAAGCTGCCAGG - Intronic
961333966 3:126159103-126159125 CTGGGCTGGGGGAGGCTCACAGG - Intronic
961390895 3:126551762-126551784 CTGGGCAGGGCCCAGGCCACCGG - Intronic
961413022 3:126736738-126736760 CTGGTCTGAGTGAAGGCCATGGG + Intronic
961487551 3:127227387-127227409 AGGGGGTGGGGCAAGGCCACTGG + Intergenic
961593270 3:127996516-127996538 CTGGGCTGGGGGTGGGAGACAGG + Intergenic
961810993 3:129521574-129521596 CTGGGGTGGGGCAAGGGCTCTGG - Intergenic
962967107 3:140365537-140365559 CTGGGCTGTGGGAAGGACATGGG - Intronic
967124441 3:186411618-186411640 GTGGGCTAGGGGAAGGGCTCTGG + Intergenic
967953788 3:194861392-194861414 CTGGGCTAGGGGCAGACCAGTGG - Intergenic
967994658 3:195157585-195157607 CTGGGCTGGGTGAAGGATAGGGG - Intronic
968005620 3:195240688-195240710 CTGTGCTGGGGGATGGTCTCTGG - Intronic
968283654 3:197495542-197495564 CTGGGCTTGGGGAAATCCATGGG - Intergenic
1202742205 3_GL000221v1_random:65647-65669 CGAGGCTGGGGGAGGGGCACTGG + Intergenic
968672093 4:1857165-1857187 CTGGGCTGGGGGGAGGCTCCTGG - Intergenic
968727034 4:2252552-2252574 CTGGGGTGGGGGAGGGCAGCAGG + Intronic
968909256 4:3469313-3469335 CTGGGCTGGGTGGAGGGCACCGG - Intronic
968944717 4:3657576-3657598 CTGGGGTGGGGGAAAGGCAGGGG + Intergenic
969219766 4:5752082-5752104 CTGTGCTGGGCCGAGGCCACAGG - Intronic
969251518 4:5971385-5971407 CTGGGCTGATGGGAGGCCACAGG - Intronic
969421186 4:7097102-7097124 CGGGGCTGGGGGAGGGCAGCTGG + Intergenic
969461985 4:7333825-7333847 CTGGGCTGGGGAAAGGGGCCAGG + Intronic
969713514 4:8857813-8857835 CTGGGCAGGGGCAAGGGCAAGGG - Intronic
972378303 4:38494648-38494670 CAGGGCTGAGGGAAGGTCAATGG - Intergenic
972668300 4:41189359-41189381 AGGGGCAGGAGGAAGGCCACAGG + Intronic
972984736 4:44749692-44749714 CAAGGCTGGGGGAGGGGCACTGG - Intergenic
973362103 4:49175512-49175534 CAAGGCTGGGGGAGGGGCACCGG - Intergenic
973725096 4:53767452-53767474 CTGGAGTGGGGAAAGGTCACTGG + Intronic
976317462 4:83673792-83673814 CTGGGGTGGGGGCAGGTCAGAGG - Intergenic
976433209 4:84987619-84987641 CAAGGCTGGGGGAGGGGCACCGG + Intergenic
978710190 4:111770692-111770714 CAGGGCTGGGGGTAGGGCAAGGG + Intergenic
981276223 4:142900894-142900916 CTGTGGTTGGGGGAGGCCACAGG + Intergenic
985207544 4:187555211-187555233 TTGGGGTGGGGGGAGGCAACAGG + Intergenic
1202759442 4_GL000008v2_random:96980-97002 CGAGGCTGGGGGAAGGGCACCGG - Intergenic
985523388 5:389625-389647 CTGGTCTGGGGGAAGGGCCCGGG - Intronic
985676601 5:1234693-1234715 CTTGGCTGAGGGAAGGGCATGGG - Intronic
985698843 5:1358543-1358565 CTGGGCTGGGGCCAGGGCTCAGG + Intergenic
985749322 5:1665392-1665414 CGGGGATGGAGGAATGCCACAGG + Intergenic
985909701 5:2869281-2869303 GTGGTCTGGTGGAAGGCCATAGG - Intergenic
986227440 5:5828796-5828818 CTGGGGTGGGAGAAGGCAAAGGG - Intergenic
987008952 5:13740291-13740313 CTGGGCTGGGAGTAGACCAGGGG - Intronic
988591283 5:32551938-32551960 CTGAGCTGGCTGTAGGCCACTGG - Intronic
988846836 5:35135869-35135891 CTGTGGTGTGGGAAGGCCAGGGG + Intronic
989978215 5:50609899-50609921 CTGGGCTGTGGGTAACCCACAGG - Intergenic
991391140 5:66144551-66144573 CTCGGCTGGGGGAGGGGCGCGGG + Intronic
991630968 5:68655969-68655991 CTGGGCTGGAGGCAGGGCAGGGG + Intergenic
993483926 5:88458503-88458525 GTGGGGTGGGGGAAGGGCAGAGG + Intergenic
993880615 5:93356320-93356342 CTGGGTTGGGGGTAAACCACTGG - Intergenic
997475189 5:134138621-134138643 CTGGGCAGGAGGCAGGCCCCTGG - Intronic
997602036 5:135147008-135147030 CAGGGCTGAGGGAAGGCACCTGG + Intronic
997690023 5:135822067-135822089 ATGAGCTGTGGGAGGGCCACTGG + Intergenic
999320851 5:150614276-150614298 GTGTGGTGGGGGAAGGGCACTGG - Intronic
1001216096 5:169857370-169857392 CTTGGCAGGGGGAAGGGTACTGG + Intronic
1001823948 5:174731335-174731357 CTGGGCTGGGGGATGGAAGCCGG + Intergenic
1001824597 5:174734913-174734935 ATGGGGTGGGGGAAGGCTAGGGG + Intergenic
1002075549 5:176706184-176706206 ATGGGCTGGGGGAAGGGCAGAGG + Intergenic
1002213267 5:177610717-177610739 CTGTGCTGAGGGAACACCACAGG - Intergenic
1002422848 5:179158631-179158653 CTGGGCTGGGCCAAGGCTCCCGG + Intronic
1002575378 5:180171106-180171128 CTGGGCTGGGGGAAGGCCACAGG - Intronic
1002670385 5:180861494-180861516 GTAGGCTGGGGGAGGGGCACAGG + Intergenic
1002764773 6:229484-229506 CTGGGCTGTGGGAAGTCCACAGG - Intergenic
1002782880 6:380391-380413 CTGGGCTGGGGGCGGGACCCAGG - Intergenic
1003035260 6:2636091-2636113 CTGACCTGGGGCCAGGCCACAGG + Intergenic
1003161485 6:3638224-3638246 CTGGGCTGGGAGCAGGGCAGGGG + Intergenic
1006301223 6:33194387-33194409 TTGTGCTGGGGGAAGGACAGAGG + Exonic
1006342294 6:33453299-33453321 CTGAGGTGGGGAAAGGGCACAGG - Exonic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006448500 6:34092767-34092789 CGGGGCTGGGGCAGGGCCCCGGG - Intronic
1006448648 6:34093286-34093308 CTGGTCTGGGGGGTGGCCCCAGG - Intronic
1006467937 6:34207096-34207118 CTGGGCAGGGGGATGGCCTGTGG + Intergenic
1006630836 6:35428436-35428458 CTGGGGAAGGGGAAGGCCCCTGG + Intergenic
1006830820 6:36967242-36967264 CTGGGCTGGAGAAAGGCCACAGG + Intergenic
1006850278 6:37093205-37093227 CTGCTCTGGCGGAAGGCCAGTGG + Intergenic
1007139312 6:39555216-39555238 CTGGGCTTGGGGAGGGCTCCAGG - Intronic
1007483512 6:42165238-42165260 CTGGGGTGGGGGAAGGCGCATGG + Intronic
1007967351 6:46015336-46015358 CTGGCCTGCGGAAAGGCCACGGG + Intronic
1010905781 6:81486272-81486294 CACGGCTGGGGGGAGGCCTCAGG - Intergenic
1014920842 6:127213354-127213376 TTGGGCAGGGGGAGGGTCACGGG + Intergenic
1015507881 6:134008030-134008052 CTGAGCTGGGGCAGGGCCAAAGG - Intronic
1015519358 6:134115159-134115181 GTGGCCTGGGGGAAGGACAGGGG + Intergenic
1015955435 6:138593261-138593283 CTGGACTGGGGCAAGGACAACGG - Intronic
1016033002 6:139357050-139357072 CTGGGTTGGTTCAAGGCCACTGG + Intergenic
1017296010 6:152795660-152795682 CTGGGCCAGGGGATGGCCAATGG - Intergenic
1018887366 6:167951432-167951454 ATTGGCTGGGAGACGGCCACAGG - Exonic
1018953293 6:168392406-168392428 GTGTGCTGGGGGATGGGCACAGG - Intergenic
1018953332 6:168392514-168392536 GTGTGCTGGGGGATGGGCACAGG - Intergenic
1018953341 6:168392541-168392563 GTGTGCTGGGGGATGGGCACAGG - Intergenic
1019024621 6:168948704-168948726 CTGGGCTGTAGGGAGCCCACTGG - Intergenic
1019316639 7:390063-390085 CTCGGCTGTGGGAAGGCCAGAGG - Intergenic
1019389460 7:777840-777862 CTGGAGTGGGCGAAGGACACGGG + Intronic
1019485104 7:1285706-1285728 CTGGGGTGTGGGAAGGACAGCGG + Intergenic
1019635707 7:2074577-2074599 CTGGGAGGGGGCAAGGCCAGCGG + Intronic
1019723423 7:2587218-2587240 CAGGTTTGGGGAAAGGCCACGGG + Intronic
1020098655 7:5382321-5382343 CTGGGCTGGGGCTGGGCCTCTGG - Intronic
1021574861 7:22097661-22097683 CTGGGCTGGGTGAAGGCATCAGG - Intergenic
1021777970 7:24072476-24072498 ATGGGCTGGGGGAAGGAGGCTGG + Intergenic
1022259548 7:28690982-28691004 CTGGGTGGAGGGAAGGACACAGG + Intronic
1023990205 7:45124232-45124254 GAGGGCTGGGGGAAAGCCAGTGG - Intergenic
1024525455 7:50345115-50345137 ATGGGCTGGGAGAAGACCAGAGG - Intronic
1025092882 7:56077982-56078004 CTGGGGAAGGGGAAGGGCACGGG - Intronic
1025264065 7:57440994-57441016 CTGGGCAGTGGGAAGGGCCCAGG + Intergenic
1025858189 7:65302662-65302684 CTGGGCTGGGGGTAGACTCCGGG + Intergenic
1026803907 7:73417856-73417878 CTGGGCTGGGTGAGAGACACAGG + Intergenic
1027059409 7:75073660-75073682 CGGGGCTGGGGCGAGGGCACTGG - Exonic
1027241193 7:76330357-76330379 GTGGGCTGGGGGAAGGGGGCTGG + Intronic
1027266255 7:76496756-76496778 CTGGGCTGCAGCAAGGCCCCAGG - Intronic
1027317635 7:76994874-76994896 CTGGGCTGCAGCAAGGCCCCAGG - Intergenic
1029159048 7:98538754-98538776 CTGGGCTGGGATAAGACCAAGGG + Intergenic
1029440599 7:100584869-100584891 CTGGGCTGGGGTGAGGCTTCGGG + Intronic
1029518986 7:101048126-101048148 ATGGGGTGGGGGAAGGCCTGGGG - Intronic
1029543940 7:101200616-101200638 CTGGTCTGGGAGAGGGCCAGAGG - Intronic
1029613292 7:101639401-101639423 CTGAGGTGGGGGAAGATCACTGG + Intergenic
1029744845 7:102511176-102511198 CTGGGCTCCGAGTAGGCCACGGG + Intronic
1029762837 7:102610338-102610360 CTGGGCTCCGAGTAGGCCACGGG + Intronic
1030098630 7:105924021-105924043 CTGGGCTGAGGGTAGGTCAGGGG + Intronic
1030911686 7:115257813-115257835 CTTGAATGGGGGAAGGGCACTGG + Intergenic
1031096773 7:117429438-117429460 CTGAGATGGGGGAAGACCAGTGG + Intergenic
1032394791 7:131581612-131581634 CTGGGCCCGGGGACGGACACAGG - Intergenic
1033528894 7:142243891-142243913 CTGGGCTGGTGGAAGACCAGGGG - Intergenic
1034273010 7:149812347-149812369 CTGGGGTGGGGGCTGGTCACAGG - Intergenic
1034395897 7:150824811-150824833 GTGGGGTGGGGGAGGGCCACTGG - Intronic
1034468214 7:151242228-151242250 CTGGGCTGTGGGAGAGCAACAGG + Exonic
1034898872 7:154895199-154895221 CTGGTCCGGGGGAAGGACTCAGG - Intergenic
1035022745 7:155808865-155808887 CCGCGCTGGGGGAAGCCCACCGG - Intronic
1035231731 7:157469630-157469652 CTGTCCTGGGGGAAGGGCAAGGG + Intergenic
1035530133 8:344832-344854 CTGAGCTGGGGGAAGGCCAGTGG - Intergenic
1035849991 8:2909082-2909104 CTAGGATGGGGGAAGGCAGCAGG - Intergenic
1035866249 8:3085658-3085680 CTGGGGTGTGGGGAGGCCATGGG + Intronic
1036182494 8:6597526-6597548 CTGGGCTGGGAGAGGGCTCCGGG - Intronic
1036614722 8:10379472-10379494 CTGGCATGGGGCGAGGCCACAGG - Intronic
1036767150 8:11556358-11556380 GAGGGGTGGGGGAAGGACACAGG + Intronic
1037419128 8:18683334-18683356 GGGGGCTGGGGGAAGACCAGGGG + Intronic
1037707735 8:21329840-21329862 CTGGGCTGTGGGATGGAGACTGG - Intergenic
1038781133 8:30569154-30569176 CTGGCCTGGGAGCAGGCCAGGGG - Intronic
1040524809 8:48211859-48211881 GTGGGGTGGGGGAAGGCGAGAGG + Intergenic
1041384167 8:57280499-57280521 CTGGGCTGGGGGAAGGGCGAGGG + Intergenic
1042483894 8:69331240-69331262 CTGGGGTGGGGGAAAAACACTGG - Intergenic
1043651817 8:82604363-82604385 CAGGGCTGTTGGAAGGCCTCAGG + Intergenic
1044839436 8:96325466-96325488 GGGGGCTGGGGGAAAGCCAGCGG - Intronic
1046312722 8:112459450-112459472 CTAGGCTGGGGAAGGGCCAGCGG + Intronic
1047673290 8:127172151-127172173 CTGGGCTGGAGGATAGACACAGG + Intergenic
1048004194 8:130405493-130405515 GGGGTCGGGGGGAAGGCCACTGG + Intronic
1048307790 8:133296110-133296132 CTGGGCTTGGGGAATGCGGCTGG - Intronic
1048470594 8:134700761-134700783 CTGGGCTGGGCGAGGGGCTCAGG - Intronic
1048528660 8:135227705-135227727 CTGGGTTGGGGGAACGTCAGGGG - Intergenic
1048810804 8:138284327-138284349 CTGAGCAGAAGGAAGGCCACTGG - Intronic
1048881267 8:138874680-138874702 CTGGGCTGGGAGCAGGGCAGAGG - Intronic
1049404337 8:142444991-142445013 CTGGGCAAGGGCAAGGCCTCGGG + Intergenic
1049409103 8:142464592-142464614 CTGGCCTGCAGGAAGGCCAGGGG - Exonic
1049469815 8:142770281-142770303 CAGGGCTGGGTGGAAGCCACAGG + Intronic
1050396622 9:5204682-5204704 CTGGGCTGGGGTAAGGATGCAGG + Intergenic
1051370582 9:16355664-16355686 TTGGGATGGGGAGAGGCCACAGG - Intergenic
1052362113 9:27573051-27573073 CTCGCCTGGGGGAAGGCCGGAGG - Intronic
1052854907 9:33401182-33401204 GTGGGCTGGGTGAAGGACAGGGG + Intronic
1053424835 9:38003998-38004020 CTGGGCTGAGGGAAGCACATGGG - Intronic
1053508759 9:38669161-38669183 CTGGGGTTGGGAAAGGACACTGG + Intergenic
1053719778 9:40933764-40933786 GTGGGTTGGGGGAAGGGGACAGG + Intergenic
1055521358 9:77084308-77084330 TGAGGATGGGGGAAGGCCACAGG - Intergenic
1055633442 9:78248454-78248476 CTGGGAAGGGGGAAGATCACTGG - Intronic
1055640620 9:78316280-78316302 CTGAGCTGCGGGAAGGGCCCAGG + Intronic
1056050415 9:82762567-82762589 CTGGGCTGGGAAAAGGGAACAGG - Intergenic
1057037761 9:91824288-91824310 TTTGGCTGGGGGAACCCCACAGG - Intronic
1057499095 9:95582606-95582628 GGGGGATGGGGGAAGGGCACAGG + Intergenic
1058153378 9:101486382-101486404 AAGGGCTGGGGGAGGGCGACTGG - Intronic
1059023911 9:110604295-110604317 CTGGGGTGGGGGAAGGGAAGAGG - Intergenic
1059332991 9:113548231-113548253 CTGGGCTGGGGGCAGGAAAGGGG + Intronic
1059404204 9:114089853-114089875 AGGGGCTGGGGGAAGCCCAAGGG - Intronic
1060005911 9:119999149-119999171 CAGGAGTGGGGGAATGCCACAGG - Intergenic
1060826539 9:126691081-126691103 CTGAGCTGGGGGCAGGCCTCAGG + Intronic
1060977074 9:127771150-127771172 CTGGGCCTGGGGAGGGCCAGCGG - Intronic
1060984676 9:127813295-127813317 CTGGGCTGGGGGCACTCCAGAGG - Exonic
1061061033 9:128250646-128250668 CTGGGCTGGGGCGGGGCCTCTGG + Intronic
1061081648 9:128374427-128374449 CTGGGGTGGGGGAGGGTGACAGG - Intronic
1061147545 9:128808728-128808750 CAGGGCTGGGGGATGGGAACAGG - Exonic
1061149433 9:128820528-128820550 CTGGGCTGTGGGAGGGACAGAGG + Exonic
1061443607 9:130624526-130624548 CTGGGCTGCGTGCAGCCCACAGG - Intronic
1061497998 9:130986588-130986610 CTGGGCCGGGGAAAGGCCCTCGG - Intergenic
1061547851 9:131315143-131315165 CTGTGCTTTGGGAAGGTCACTGG + Intergenic
1061626090 9:131841533-131841555 CTGGGCTGGCGGAGGGCTCCTGG + Intergenic
1061664303 9:132151552-132151574 CTTAGCTGGGGGAAGGTTACTGG + Intergenic
1062263891 9:135678038-135678060 CTGGGATGGGGAGAGGCCGCCGG - Intergenic
1062344836 9:136109849-136109871 CTGGGCTGGGGGAGGGGCGCCGG + Intergenic
1062354743 9:136156672-136156694 CTGGGCTGGTGAAAGGCAGCCGG - Intergenic
1062430835 9:136526242-136526264 CTGGGCTGGGCTGTGGCCACAGG + Intronic
1062436340 9:136548072-136548094 CTGGGAAGGGGGTAGGCCCCTGG + Intergenic
1062500883 9:136851507-136851529 CAGGGCTGTGGGCAGGACACGGG + Intronic
1062503013 9:136859295-136859317 CCGGGCTGGGGGCAGGCTGCTGG - Exonic
1062588823 9:137263817-137263839 CTGGGGAAGGGGAGGGCCACAGG - Intronic
1062623123 9:137431473-137431495 CTGGGCTGGGCCAGGACCACGGG - Intronic
1062656675 9:137607227-137607249 CAGGGCTGGGGGAAACCCCCGGG - Intronic
1203769379 EBV:41112-41134 CTGGGGTGGGGGATGGGCTCAGG - Intergenic
1203789657 EBV:144031-144053 CTGGGGTGGGGGATGGGCTCAGG - Intergenic
1203691235 Un_GL000214v1:45203-45225 CGAGGCTGGGGGAGGGGCACCGG - Intergenic
1203710834 Un_KI270742v1:95571-95593 CGAGGCTGGGGGAGGGGCACCGG + Intergenic
1203540218 Un_KI270743v1:81875-81897 CGAGGCTGGGGGAAGGGCACCGG - Intergenic
1203645060 Un_KI270751v1:58988-59010 CGAGGCTGGGGGAGGGGCACCGG + Intergenic
1186250142 X:7656835-7656857 AGGGGATGGGGGAAGGGCACTGG + Intergenic
1186263061 X:7801780-7801802 CTGGGCTGAGGGGAGGCCATTGG - Intergenic
1186851957 X:13589184-13589206 CTGGTCTGGGACAAAGCCACAGG + Intronic
1187829581 X:23367295-23367317 CTGGGCAGGTGGGAGGCCAGAGG - Intronic
1190266370 X:48829533-48829555 CTGGGCGGGGTGAGGGCCCCAGG - Exonic
1190420664 X:50281301-50281323 CTGGGCTGGTGGAGGGTCGCAGG + Intronic
1192183276 X:68929545-68929567 CTAGGCAGGGGGAAGGACCCAGG - Intergenic
1192221929 X:69203302-69203324 CTGGCCTGGAGGAAGGCCTTGGG + Intergenic
1192418898 X:71010825-71010847 CTGGGCAGGGGAAAGGCCAGAGG - Intergenic
1193406689 X:81109117-81109139 CAGGGATGAGGGAAGGCCAGGGG + Intergenic
1195244177 X:102980815-102980837 CTGGGCAGGGAGAAGGCAACTGG - Intergenic
1195719340 X:107851514-107851536 AGGGGATGGGGGAAGGACACTGG - Intronic
1197365652 X:125562320-125562342 CTGGGAGGTGGGAAGCCCACTGG - Intergenic
1198254618 X:134914537-134914559 CTGGGGAGGGGGAAGGATACAGG + Intronic
1199273913 X:145920722-145920744 CTGGGCTGGGGCAAGGGTACAGG - Intergenic
1199760145 X:150898779-150898801 CTGGGCTGGGGTTAGGCCGGGGG + Intronic
1199761272 X:150905927-150905949 CGGGGCTGGGGGAGGGCTAATGG - Intergenic
1200102370 X:153694465-153694487 CTGGGCTGGGGGATGGTGGCGGG + Intronic
1200829803 Y:7679181-7679203 CTGGGCTCCGTGAATGCCACAGG + Intergenic
1201059942 Y:10036520-10036542 CTGGGCTGAGTGAATGCCCCAGG + Intergenic
1201604145 Y:15766579-15766601 GTGGGCTGAGGGAAGGCAAGTGG + Intergenic