ID: 1002578852

View in Genome Browser
Species Human (GRCh38)
Location 5:180195047-180195069
Sequence TGTTCTCTGCAGCAGGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 6, 3: 49, 4: 314}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002578852_1002578857 -7 Left 1002578852 5:180195047-180195069 CCCAGTGCCTGCTGCAGAGAACA 0: 1
1: 0
2: 6
3: 49
4: 314
Right 1002578857 5:180195063-180195085 GAGAACAGCCTGGAGTTGCAGGG 0: 1
1: 0
2: 3
3: 24
4: 254
1002578852_1002578860 7 Left 1002578852 5:180195047-180195069 CCCAGTGCCTGCTGCAGAGAACA 0: 1
1: 0
2: 6
3: 49
4: 314
Right 1002578860 5:180195077-180195099 GTTGCAGGGCCTCTCAAGCTGGG 0: 1
1: 0
2: 1
3: 6
4: 176
1002578852_1002578856 -8 Left 1002578852 5:180195047-180195069 CCCAGTGCCTGCTGCAGAGAACA 0: 1
1: 0
2: 6
3: 49
4: 314
Right 1002578856 5:180195062-180195084 AGAGAACAGCCTGGAGTTGCAGG 0: 1
1: 0
2: 2
3: 24
4: 320
1002578852_1002578862 9 Left 1002578852 5:180195047-180195069 CCCAGTGCCTGCTGCAGAGAACA 0: 1
1: 0
2: 6
3: 49
4: 314
Right 1002578862 5:180195079-180195101 TGCAGGGCCTCTCAAGCTGGGGG 0: 1
1: 0
2: 1
3: 16
4: 204
1002578852_1002578859 6 Left 1002578852 5:180195047-180195069 CCCAGTGCCTGCTGCAGAGAACA 0: 1
1: 0
2: 6
3: 49
4: 314
Right 1002578859 5:180195076-180195098 AGTTGCAGGGCCTCTCAAGCTGG 0: 1
1: 0
2: 1
3: 10
4: 101
1002578852_1002578864 21 Left 1002578852 5:180195047-180195069 CCCAGTGCCTGCTGCAGAGAACA 0: 1
1: 0
2: 6
3: 49
4: 314
Right 1002578864 5:180195091-180195113 CAAGCTGGGGGCCCTGACCTTGG No data
1002578852_1002578861 8 Left 1002578852 5:180195047-180195069 CCCAGTGCCTGCTGCAGAGAACA 0: 1
1: 0
2: 6
3: 49
4: 314
Right 1002578861 5:180195078-180195100 TTGCAGGGCCTCTCAAGCTGGGG 0: 1
1: 1
2: 1
3: 12
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002578852 Original CRISPR TGTTCTCTGCAGCAGGCACT GGG (reversed) Intronic
900134002 1:1106397-1106419 TATTCTCAGCAGCATGCACAAGG - Intronic
900226552 1:1535905-1535927 GGTTCTCTGAAGCAGCCTCTTGG + Intronic
900662743 1:3793611-3793633 TGTTATCTGCAGGAGTCACTGGG - Intronic
901648742 1:10730516-10730538 TGTTCCCTGGAGCAGGCAGCTGG - Intronic
902573752 1:17363612-17363634 TGTTCCCTGCTGGAGCCACTGGG + Exonic
902776403 1:18677425-18677447 TGTTCATTGCAACAGGAACTAGG - Intronic
903179283 1:21597341-21597363 GGTTCTCTGAGGCAGGGACTTGG - Intronic
903184242 1:21620348-21620370 TCATCTCTGCAGCTGGGACTTGG - Intronic
903696196 1:25209131-25209153 TGGTCTCTGCAGAATTCACTTGG - Intergenic
904405583 1:30286153-30286175 TGGGATCTGCAGCAGGCAGTGGG - Intergenic
904458570 1:30662117-30662139 TGGGATCTGCAGCAGGCAGTGGG - Intergenic
905409314 1:37757322-37757344 TGTTAGCTGCAGAAGGCACTTGG + Intronic
906050621 1:42868364-42868386 TGGTCTCTGCTGCTGGCAATTGG - Intergenic
906790450 1:48654560-48654582 TGCTCTCTCCAGCAGGAACGGGG - Intronic
907579153 1:55556232-55556254 TGATGTCAGCACCAGGCACTGGG - Intergenic
907789856 1:57652148-57652170 TGTTATCTGCAGGAGTAACTGGG - Intronic
910220013 1:84880553-84880575 GGTCCTCTGCAGCATGGACTTGG - Intronic
910413669 1:86973973-86973995 TGTTCTCTGTGTCAGGAACTGGG - Intronic
914981565 1:152419122-152419144 TGATCTAGGCAGCAGGCACATGG + Intergenic
915459029 1:156058694-156058716 TGTTCTGAGCAGCAGGGTCTAGG - Intergenic
919771986 1:201167513-201167535 CGTTATCTGCAGGAGTCACTGGG + Intronic
920703372 1:208234393-208234415 CATTTTCTGCAGCAGGCTCTTGG + Intronic
922564055 1:226589753-226589775 GGTCCTCTGCAGCAGGGACAGGG - Intronic
922667305 1:227481701-227481723 TGTTCTGCACAGCAGCCACTGGG + Intergenic
922678567 1:227570117-227570139 CTTTCTGTGGAGCAGGCACTAGG + Intronic
922854559 1:228763430-228763452 TTTGGTCTGCAGCAGGAACTGGG + Intergenic
923225903 1:231938537-231938559 TGTTCTCTTCTGGAGGCTCTGGG - Intronic
924382753 1:243479388-243479410 TGTTCTCTGTCGCAGCTACTCGG + Intronic
1064692525 10:17932497-17932519 TGCTCACTGAAGCAGGAACTTGG - Intergenic
1064699758 10:18006917-18006939 GGGTCTCTGCAGCAGTGACTGGG + Intronic
1065271767 10:24040249-24040271 TGGTCTCTGGAGTAGCCACTTGG + Intronic
1065628477 10:27654308-27654330 TTTTCTGTGCAGCAAGCAATGGG - Intergenic
1067196786 10:44126713-44126735 AGCTCTCTGCAGGAGTCACTAGG + Intergenic
1067663795 10:48256276-48256298 TGATCCCTGCAGCTGACACTCGG - Intronic
1069806477 10:71128381-71128403 TGTTATCTGCAGGAGTAACTGGG - Intergenic
1069876429 10:71566085-71566107 TGTTCTATGCAAAGGGCACTGGG + Intronic
1069943861 10:71972937-71972959 TGTGGTCTGCACCAGGCAATGGG + Intronic
1071523915 10:86347266-86347288 GCTTCTCTGCCACAGGCACTTGG - Intronic
1072454271 10:95562197-95562219 TGTTCTCTGCAGTTAACACTGGG - Intergenic
1075447539 10:122524185-122524207 TGTTGTCTGCAGGAGTAACTGGG + Intergenic
1077351829 11:2096693-2096715 TGTGCCCTGGAGCAGGCCCTGGG - Intergenic
1078645732 11:13140217-13140239 TCTTCCTTGCACCAGGCACTAGG - Intergenic
1078869090 11:15327445-15327467 TGTTCTTTTCAGTAGCCACTTGG - Intergenic
1079146619 11:17858024-17858046 TGTTCCCTGCAGCAGGCACAGGG - Intronic
1079390457 11:20017799-20017821 TGTGATCTGCAACAGGCAGTGGG - Intronic
1079718126 11:23774391-23774413 TCATATCAGCAGCAGGCACTAGG - Intergenic
1083655163 11:64225999-64226021 CCCTCTCTGCAGCAGGGACTTGG - Intronic
1083720547 11:64601599-64601621 TGTTCTCTGGAGAAGGCAGGAGG + Exonic
1084014472 11:66370528-66370550 TCTACTGTGGAGCAGGCACTGGG - Intronic
1084050854 11:66599053-66599075 TGTTCCCTGCTGCCAGCACTGGG + Intronic
1084470140 11:69354547-69354569 TGTTCTCTTGAGCAGGTACCTGG - Intronic
1084772591 11:71353412-71353434 TGTTTTCTGCACCACACACTTGG + Intergenic
1084954673 11:72684961-72684983 GGTTCTCAGCTTCAGGCACTAGG + Intergenic
1086024693 11:82276458-82276480 TGTTATATGCAGCACTCACTGGG + Intergenic
1086970178 11:93073023-93073045 TGTTCTCTGCAGGAGTAACTGGG - Intergenic
1087685234 11:101255216-101255238 TGGTCTCTGCCACAGGCTCTGGG + Intergenic
1090097059 11:123752689-123752711 TGTTCTGTGCAGCAAACACCAGG + Intergenic
1091622399 12:2099288-2099310 GGTTCTCTGCAGAAGGATCTAGG - Intronic
1094210567 12:27885691-27885713 TGTTCTCTACAGCAGGCTGCTGG + Intergenic
1094337025 12:29371111-29371133 TTTTATCTGTACCAGGCACTGGG + Intronic
1094628412 12:32148333-32148355 TGTTCCCCGCAACAGGCACCCGG + Intronic
1097564517 12:61251518-61251540 TGGTCTCTGCTGCTGGCAATTGG + Intergenic
1098066585 12:66624600-66624622 TATCCTCTGCAGCAAGTACTAGG + Intronic
1098645591 12:72896465-72896487 TGATCTCTGCAGCAGTAGCTTGG + Intergenic
1098710273 12:73749373-73749395 TTTTCTCTGCAGCTGGTTCTTGG - Intergenic
1100276976 12:93080469-93080491 TGTTATCTGCAGGAATCACTGGG + Intergenic
1100793532 12:98156182-98156204 TGTTTTCTGCAGAAAGCATTAGG + Intergenic
1100803442 12:98257124-98257146 TTTTCTCTTCAGCACGCATTTGG - Intergenic
1101523876 12:105509829-105509851 TGGTCTCTGCAGCCTGGACTGGG - Intergenic
1102047081 12:109836011-109836033 TGGCCTCTGCACCAGACACTGGG + Intergenic
1102534922 12:113574468-113574490 TGTTCTCTGGTCCAGGCACCGGG + Intergenic
1103447277 12:121002349-121002371 GGTTCTCAGCAGCAGGCCCAGGG - Exonic
1104327351 12:127812054-127812076 TGCTTTCAGCAGCAGGCAGTTGG - Intergenic
1104436381 12:128760232-128760254 TGTTGTCTGGAGCAGTCACTGGG - Intergenic
1107836764 13:44417962-44417984 TGTTCCCTGCAGGAGTCACCTGG + Intergenic
1107949064 13:45445674-45445696 TGTTATCTGCAGGAGGCATTGGG + Intergenic
1108323253 13:49306313-49306335 TGTCCCCTGCAGCTGGCACTGGG - Intergenic
1108416027 13:50199051-50199073 TCTTCTCTGCTGCAGGCTCCTGG + Intronic
1109154894 13:58896812-58896834 TGTTTTCTTCAGGAGGCTCTTGG - Intergenic
1110973535 13:81799330-81799352 AGATCTCTGCAACAGGCATTAGG - Intergenic
1111452754 13:88440276-88440298 TGTTCTCAGCTGGAGGCTCTGGG - Intergenic
1112926649 13:104683535-104683557 TGTTCCCTGCAGCAGCCAAAGGG + Intergenic
1113310831 13:109130815-109130837 TGTTCAATGCAGTAGCCACTAGG + Intronic
1113811291 13:113144113-113144135 TGGTCTCTCCAGCAGGCCCGAGG - Intronic
1113949716 13:114065308-114065330 TGTGCTCTGCCGCAGGCTCGGGG + Intronic
1115271009 14:31552564-31552586 TGTTGTCTGCAGCATTGACTTGG + Intronic
1116791030 14:49340223-49340245 TGTTTACTGCAGAAGGCACCTGG - Intergenic
1116862228 14:50003707-50003729 TGGTCTCTGCAGCAGTCAGAAGG + Intronic
1116955364 14:50917575-50917597 TGTGCTCAGCTGCAGGAACTGGG - Intronic
1118056796 14:62087344-62087366 TGGACTCTGCAGCAGGCCCCAGG - Intronic
1118474135 14:66101387-66101409 TGTTATCTGCAGGAGTAACTGGG - Intergenic
1119199803 14:72743890-72743912 TGTTCTCTGCAGCTTGCACTTGG - Intronic
1119541507 14:75441447-75441469 TGAGCACTGCACCAGGCACTGGG + Intronic
1119689019 14:76656062-76656084 TGTCCTCAGCACCTGGCACTTGG + Intergenic
1120250640 14:82058751-82058773 TGGTCTCTGCTGCTGGCAGTTGG + Intergenic
1121007573 14:90500145-90500167 CTTTCTCTGCACCAGGCACTGGG - Intergenic
1122220585 14:100236879-100236901 TATTTTCTGGAGCAGGTACTAGG + Intergenic
1122247832 14:100416825-100416847 ACTTTTCTGTAGCAGGCACTTGG + Intronic
1122997331 14:105272299-105272321 TGTCCACAGCTGCAGGCACTCGG + Intronic
1123702844 15:22928489-22928511 TGTGCTCTGCAGCACGCCCTTGG - Intronic
1124230772 15:27944506-27944528 TGTTATCTGCAGGAGTAACTGGG - Intronic
1124335929 15:28857053-28857075 TGTTATCTACAGGAGGCACTGGG + Intergenic
1124829190 15:33131579-33131601 TATTTCCTGCAGCAAGCACTTGG - Intronic
1125114138 15:36068079-36068101 TTTGCTCTGGAGCAGGCACCGGG + Intergenic
1125543814 15:40488253-40488275 TGGGCTCTGCAGCAGGCGCGGGG + Intergenic
1127506377 15:59601765-59601787 TGTTATCTGCAGGAGTAACTGGG + Intronic
1128232774 15:66047172-66047194 TGTTCTACACAGCAGGCATTTGG - Intronic
1128921126 15:71611283-71611305 TCTTTTCTGCATCAGGCATTTGG + Intronic
1129057971 15:72835676-72835698 TGTACTCTGCACCAAGCTCTGGG - Intergenic
1129176920 15:73846994-73847016 TGTTCCCTGCAGGAGGCTCCAGG - Intergenic
1129788498 15:78324585-78324607 TGTTCTCTGGAACAGACACTGGG - Intergenic
1129960824 15:79682371-79682393 TGTGCTCTGCAGCAGGGCCCTGG - Intergenic
1130948294 15:88565991-88566013 CTGACTCTGCAGCAGGCACTGGG + Intergenic
1131887519 15:96933485-96933507 TAAACCCTGCAGCAGGCACTGGG + Intergenic
1132379232 15:101354977-101354999 CGTGTTCTCCAGCAGGCACTGGG - Intronic
1132975147 16:2707221-2707243 TGTTTTCTGGAGCAGGCGCCTGG + Intronic
1133040349 16:3057256-3057278 TGTCCTCTGCAGCAGGGCCAGGG + Intronic
1133110553 16:3545642-3545664 TTTTCCCTGCAGCCTGCACTTGG - Intronic
1133235406 16:4385179-4385201 TGCTGACTGCAGCAGGCCCTGGG + Intronic
1133738552 16:8633777-8633799 CCTTCTCTGCATGAGGCACTGGG - Intronic
1134042152 16:11076851-11076873 TGATCTCCCCAGCAGGCCCTGGG - Intronic
1134082295 16:11333519-11333541 TGTCCACTACAGCAGGCATTTGG - Intronic
1136908259 16:34122463-34122485 TGTTTTGTGGAGCAGGCAATAGG - Intergenic
1138078688 16:54068108-54068130 TGTTCTTTGCTGCTGGCATTGGG - Intronic
1138534026 16:57650295-57650317 TGTCGTCTGCAGCAGCGACTGGG - Exonic
1138594878 16:58024685-58024707 TTTTCTCTAGAGCAGGCCCTCGG - Intergenic
1138803863 16:60069571-60069593 TGTTCTGTGCAGAAGGAAGTTGG + Intergenic
1138814384 16:60187452-60187474 TGTTCCCTGCAGAAGACAGTTGG - Intergenic
1139291559 16:65863212-65863234 CATTCTCTGTAGCAGGCAGTAGG - Intergenic
1139321251 16:66116214-66116236 TGTCCTCTGCAGCAGTGCCTTGG - Intergenic
1139654144 16:68377193-68377215 TGTTCCCTGCAGTGGGGACTGGG + Intronic
1141827905 16:86493874-86493896 ACTTCTCTGCACCCGGCACTGGG + Intergenic
1142504853 17:356851-356873 GGTTGTCTGCAGCAGCCACGTGG + Intronic
1143572681 17:7770237-7770259 TGTTCCTGGCTGCAGGCACTGGG + Exonic
1144858262 17:18282955-18282977 TGTTCTCTGCAGGAGGCCTGCGG - Intronic
1146586867 17:34090277-34090299 TGTTCTCTCCTACAGGCATTTGG - Intronic
1146602718 17:34232732-34232754 TGTTATCTGCAGGAGTTACTGGG - Intergenic
1147445754 17:40474425-40474447 TGTTCTCTCCAGGAGGCTCCAGG - Intergenic
1148541529 17:48484327-48484349 TGTTTTCTGCAACTGGCACCAGG - Intergenic
1148722962 17:49768011-49768033 TGTTGACTGCAGCATGCTCTTGG + Intronic
1149451972 17:56756875-56756897 TGGTCTCTGCATGAGGCATTTGG + Intergenic
1150611810 17:66739441-66739463 CCTGCTCTGCACCAGGCACTGGG + Intronic
1151576141 17:74953469-74953491 TGGTCTCTGCAGTAGGGGCTGGG - Intronic
1151732624 17:75920385-75920407 TGTGCTCGGCAGCAGGCTCCGGG + Exonic
1151741280 17:75983929-75983951 TGTTATCTGCAGGAGTAACTGGG + Intronic
1151907170 17:77056220-77056242 TGTTGTCTGCAGAAGGCGCCAGG + Intergenic
1151913051 17:77097073-77097095 TGTTCTCACCAGCTGGCACTGGG - Intronic
1152812273 17:82387539-82387561 TTTTCACTGCTGCAGGCACAGGG + Intergenic
1153112886 18:1614334-1614356 TGTACTCTGCTGCAGGGACCAGG - Intergenic
1153415656 18:4843257-4843279 TGTTCTCTCCACAAGGCACAGGG + Intergenic
1153961791 18:10146497-10146519 AGTTCCCTGAAGGAGGCACTAGG + Intergenic
1154165109 18:12008905-12008927 TGCACTCTGCAGCAGGCCCTGGG - Intronic
1154408446 18:14119002-14119024 TAATCTATACAGCAGGCACTAGG - Intronic
1156370862 18:36470127-36470149 TGTCCTCTGGAGCAGGTCCTAGG + Intronic
1160533874 18:79580938-79580960 TGTCCTCTCCAGGAGGCCCTGGG - Intergenic
1161998235 19:7727733-7727755 TGCAGTCTGGAGCAGGCACTGGG - Intergenic
1162314414 19:9929237-9929259 TGTACTATGCAACAAGCACTGGG - Intronic
1162522953 19:11192891-11192913 TGGTAGCTGCAGCGGGCACTGGG + Exonic
1162570154 19:11466817-11466839 TGTTATCTCCAGCAGATACTGGG - Exonic
1163416129 19:17187493-17187515 TGTTCTCTGTGGCAGGCACTGGG - Intronic
1164510305 19:28891095-28891117 TCTACTCTCCAGCAGCCACTGGG - Intergenic
1165223823 19:34339890-34339912 GCTTCTCTGCAGCAGGGACATGG - Exonic
1168089974 19:54075996-54076018 TGTTCTCAGCAGGAGACTCTGGG - Intronic
1168190676 19:54736333-54736355 TTTTCTCTCCAGCAGGCAGTGGG - Exonic
1168192900 19:54752728-54752750 TTTTCTCTCCAGCAGGCAGTGGG - Exonic
1168194989 19:54767556-54767578 TTTTCTCTCCAGCAGGCAGTGGG - Intronic
1168197235 19:54783998-54784020 TTTTTTCTCCAGCAGGCAGTGGG - Exonic
1168200815 19:54814196-54814218 TTTTCTCTGCAGCAGGCAGTGGG - Exonic
1168203039 19:54830456-54830478 TTTTCTTTCCAGCAGGCAGTGGG - Exonic
1168205593 19:54848263-54848285 TTTTCTCTCCAGCAGGCAGTGGG - Intronic
1168270223 19:55245750-55245772 TCTTCTCTGCACCGGGCACTGGG + Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
926244305 2:11112036-11112058 TGCTCTCTGCAGCACACAGTGGG - Intergenic
926421460 2:12703877-12703899 GGTTTTGTGCAGCAGGAACTGGG + Intergenic
926540217 2:14167876-14167898 TTTTCTCTCCTGCAGGCTCTTGG - Intergenic
926589380 2:14723852-14723874 TGTTTTCTTCATCACGCACTTGG + Intergenic
927086209 2:19676082-19676104 TGTTCTTTGGAGAAGGCACCTGG + Intergenic
927990867 2:27445981-27446003 TCTTCTTTGCTGCAGGCAGTTGG - Exonic
929307666 2:40382050-40382072 TTTTCTGTGCAGCAAGCAGTAGG + Intronic
929620170 2:43346711-43346733 TGGTCTCTGCTGCAGCCCCTTGG - Intronic
930113224 2:47696713-47696735 TGTTATCTGCAGGAGTAACTGGG - Intronic
933152090 2:78927982-78928004 GGTTCTATGCTGCTGGCACTGGG - Intergenic
933198316 2:79418209-79418231 TGTTATCTGCAGGAATCACTGGG + Intronic
934081947 2:88476254-88476276 TATTTTCTGCAGTAGGCTCTAGG + Intergenic
935826494 2:106956579-106956601 TGTTCTCTCCAGCAGGAACTAGG - Intergenic
936921965 2:117697942-117697964 TCTGCTCTGGAGTAGGCACTGGG + Intergenic
937939758 2:127275913-127275935 TGTCCTCTGCAGCACGCAGGAGG + Intronic
941181677 2:162266644-162266666 TGTTCTCATCTGGAGGCACTGGG - Intergenic
941531052 2:166671914-166671936 TGTTCTCAGCATCTGGCACATGG - Intergenic
941887337 2:170541715-170541737 TTTTCTATGTACCAGGCACTGGG + Intronic
941916322 2:170816221-170816243 TTTTCTCTGCCGGTGGCACTGGG + Intronic
942015929 2:171815192-171815214 TCTTCTCTGCAGCAGTCTCCTGG - Exonic
942163156 2:173213432-173213454 TTTTCACTGAAGCAGGCAATTGG + Intronic
946401237 2:219469407-219469429 TGTCCCCTGCAGCACCCACTTGG + Intronic
946409159 2:219507857-219507879 TGTTATCAGCACCAGGCTCTGGG + Intergenic
946615250 2:221502006-221502028 TGTTCTCTACACCAGGCTCTCGG - Intronic
947228283 2:227860533-227860555 TGCGGTCTCCAGCAGGCACTAGG + Intergenic
947530727 2:230907218-230907240 TGGTCTCTTCAGCAGCCACCTGG - Intergenic
948561703 2:238858037-238858059 GGTTCTCTGTACCAGGCTCTTGG + Intronic
1169262216 20:4147604-4147626 TGTTCTTTGCAGTAGGAAGTTGG - Intronic
1170381093 20:15760447-15760469 TGTTTCCTGCAGCAGCCACTGGG - Intronic
1170870504 20:20201692-20201714 TGATCTCTGGAGAAGGCGCTGGG + Intronic
1171048902 20:21837544-21837566 TGGTCTCTGTAGCAGGCTCAGGG + Intergenic
1171182301 20:23099695-23099717 TGCTCCCTATAGCAGGCACTAGG - Intergenic
1171350734 20:24501313-24501335 TATCCTCTGCAGCATGCACAGGG + Intronic
1171372174 20:24668963-24668985 TGCCCTCTGCAGCAGCCTCTGGG + Intergenic
1171772796 20:29338373-29338395 TGTTTTGTGGAGCAGGCACTAGG + Intergenic
1171814746 20:29775697-29775719 TGTTTTGTGGAGCAGGCACTAGG + Intergenic
1171903689 20:30881029-30881051 TGTTTTGTGAAGCAGGCACTAGG - Intergenic
1172254871 20:33508733-33508755 TGTCCTTTGCAGCAGGGACATGG - Intronic
1172510555 20:35497971-35497993 TCTGCCCTGCAGCAGGCCCTGGG + Exonic
1172628329 20:36361519-36361541 TCTTCTCTGCAGCAGCCAGAAGG - Intronic
1173826422 20:46050682-46050704 TGTGCAGTGCACCAGGCACTGGG + Intronic
1173928767 20:46800679-46800701 TTTGGTCTGCATCAGGCACTGGG - Intergenic
1174105175 20:48156807-48156829 TGTTATCTGCAGGAGTCACTGGG + Intergenic
1175125068 20:56745290-56745312 TGTTCTGTGCACCAGGGCCTGGG + Intergenic
1175987866 20:62772927-62772949 TGTCCTCTACAGCAGTCACTGGG - Intergenic
1176103801 20:63376418-63376440 CTTCCTCTGCAGCAGGGACTGGG - Intronic
1176139553 20:63538995-63539017 TGCTCTCTGCAGCCGCCACTGGG - Intergenic
1176285497 21:5016923-5016945 TCCTCTCAGCAGCAGGCACTGGG + Intergenic
1177201140 21:17957459-17957481 TGTTTTGTTCATCAGGCACTAGG + Intronic
1177291198 21:19114214-19114236 TGTTCTCTTCAGCACACCCTCGG + Intergenic
1178358614 21:31929970-31929992 TGCTCTCAGCAGAAGGCCCTGGG - Intronic
1179069140 21:38055184-38055206 TGTTCTCAGAAGCTGTCACTTGG + Intronic
1179608018 21:42530820-42530842 CATTCTCTGCAGCAGGTACGTGG - Intronic
1179789714 21:43749444-43749466 TGTTCTCTGCAGCTCTCCCTGGG - Intronic
1179871684 21:44246552-44246574 TCCTCTCAGCAGCAGGCACTGGG - Exonic
1180318187 22:11296248-11296270 TGTTTTGTGGAGCAGGCACTAGG + Intergenic
1180337086 22:11586988-11587010 TGTTTTGTGAAGCAGGCACTAGG - Intergenic
1181855276 22:25777038-25777060 TCTACTATGCAGCAGGCACTCGG - Intronic
1182859799 22:33549197-33549219 TCTTCTCTGCACCATGCACTGGG - Intronic
1183562395 22:38585733-38585755 AGTTCTCTGCTGTAGACACTGGG - Intronic
1183945814 22:41325152-41325174 TTTTTTCAGCAGCAGGGACTGGG + Intronic
949931994 3:9086069-9086091 TGTTCTCTGGATCAGCCACTTGG - Intronic
950190201 3:10971218-10971240 TCTTCTCTGTACCAGGCTCTAGG - Intergenic
950764898 3:15266370-15266392 TGTCCTCTCCAGCAGCCACCTGG + Intronic
952446767 3:33388658-33388680 TGTTTTCTGTACCAGTCACTGGG - Exonic
953500041 3:43424462-43424484 TGTTATCTGCAGGAGTAACTGGG - Intronic
954225444 3:49178026-49178048 GATTCCCTGCAGCAGGCAATAGG + Exonic
954962750 3:54580641-54580663 TATTTTCTGCAGCAAGCACAGGG - Intronic
955113941 3:55978057-55978079 TCTGCTCTGTATCAGGCACTGGG - Intronic
955432072 3:58856470-58856492 TGACCTCAGCTGCAGGCACTGGG + Intronic
955486163 3:59436877-59436899 TTTACTATGCATCAGGCACTGGG + Intergenic
955506720 3:59639897-59639919 GGATCTCTGCATCAGGAACTGGG + Intergenic
956426778 3:69144469-69144491 TTTACTATGCAGCAGGCACAAGG + Intergenic
956442971 3:69298134-69298156 TAAACTCTGCAGCAGGCCCTAGG - Intronic
960550719 3:118973291-118973313 TGTTCTATGTATAAGGCACTGGG + Intronic
960817878 3:121691833-121691855 TATTCTCTGCAGCAGCCTCTTGG + Exonic
961075224 3:123976104-123976126 TGTTCACTGCACAAGGTACTTGG + Intronic
961649970 3:128412444-128412466 TGTCCTCTGAGGCAGGGACTGGG + Intergenic
962749098 3:138419993-138420015 TGTTATCTGCAGGAGTAACTGGG - Intergenic
963005178 3:140720423-140720445 TGTTCTCTGGAGCTGGCAGATGG - Intergenic
964592449 3:158379521-158379543 TTTTCTCTGGAGTAGGCATTAGG - Intronic
965687245 3:171317294-171317316 TGTTCTCTCCAGGAAGCACCAGG + Intronic
966498656 3:180611417-180611439 TGTTCAGTCCAGAAGGCACTAGG + Intronic
966653826 3:182330682-182330704 TGTTCTCTTCAGCACCCACTTGG + Intergenic
966960145 3:184927410-184927432 GATACTCTGCAGCAGTCACTGGG - Intronic
967051764 3:185791525-185791547 TGTCCTCTGTGCCAGGCACTAGG + Intronic
967754839 3:193157170-193157192 TGTTCTCTGGAACAGGAACGAGG + Intergenic
967983964 3:195081802-195081824 TGTGGTCTGCAGCAGCCAGTGGG + Intronic
968789243 4:2648048-2648070 TGTTCTCTACTGCAGCCACAGGG + Intronic
969228636 4:5814895-5814917 TGTTCTTTGCTGCTGGGACTGGG + Intronic
969326900 4:6449315-6449337 TGTTCTCTGCAGCTGCCGCAGGG - Intronic
971261544 4:25061773-25061795 TGTTCTCTGCTCCATGCACCAGG + Intergenic
971340762 4:25766671-25766693 TGATCTCAGCACCAGGCTCTGGG - Intronic
971424041 4:26499112-26499134 TCTGCTCTGTAGCAGGAACTGGG + Intergenic
971832180 4:31709061-31709083 TGTACTCTGCTCCAGGCACTAGG - Intergenic
972330856 4:38063397-38063419 TGTTTACTGAAGCAGGCAATAGG - Intronic
973171757 4:47153858-47153880 TGTTCCCTGAAGCACACACTAGG + Intronic
973978718 4:56288070-56288092 TGTTCTGTGCATCAGGTACCAGG + Intronic
975612475 4:76215719-76215741 TGTTCTCTGCAGCAGTCTCCGGG - Intronic
977058993 4:92233053-92233075 TTTCCTCTGAAGCAGGCACTTGG + Intergenic
979271739 4:118770269-118770291 TGTTCTCTTCAGCTGGTAATAGG + Intronic
979472373 4:121114598-121114620 TGTGCTGTGTAGCAGACACTTGG - Intergenic
980556325 4:134410293-134410315 TTTTCTCTGCTCCAGGCACATGG + Intergenic
981455080 4:144944234-144944256 TGTTTTCTGAGGCAGGCAGTGGG + Intergenic
982330845 4:154180483-154180505 TCTTCTCTGCAGGTGGCCCTGGG + Intergenic
982939347 4:161528679-161528701 TGTTCTCTGTTGCAGGAATTCGG - Intronic
985084267 4:186297037-186297059 TGTGCTCTGCATCATGCAGTGGG + Intergenic
985154923 4:186977484-186977506 TATTCTATGCATTAGGCACTAGG - Intergenic
985662307 5:1163422-1163444 TGTGCTCTGCAGTAAGCTCTGGG + Intergenic
987546553 5:19317583-19317605 TGTCCTTTGCAGCAGGGACATGG - Intergenic
991610690 5:68446753-68446775 TGTTCTTTGAAGCAGTAACTTGG + Intergenic
995538573 5:113162075-113162097 TGTTCTCTGAAGCAGTCAGCAGG - Intronic
998265910 5:140667672-140667694 TCTGCTCTGAGGCAGGCACTTGG + Intronic
999425654 5:151485824-151485846 TGTCCATTGCAGCAGCCACTAGG + Intronic
999446900 5:151647333-151647355 TTTTCTATTCAGCAGACACTGGG + Intergenic
999452904 5:151691708-151691730 TGTGCTTTGCATCAGGCACTGGG + Intergenic
1000837042 5:166167865-166167887 TGTTCACTGCAGAAGGCCCCAGG + Intergenic
1002157065 5:177291108-177291130 TGTTCCCTGCAGCCCACACTTGG - Intronic
1002419521 5:179138348-179138370 TCTCCTCTGCAGCTGGCCCTGGG + Intronic
1002578852 5:180195047-180195069 TGTTCTCTGCAGCAGGCACTGGG - Intronic
1003150012 6:3540446-3540468 TGGCATCTGCAGCAGGCACCTGG + Intergenic
1003264330 6:4552203-4552225 TGTTCTCTGCCACTTGCACTTGG + Intergenic
1003317538 6:5025920-5025942 TTTTCTCAGCCGCAGACACTTGG + Intergenic
1003391122 6:5713828-5713850 TGTTCTCTGGGGCTGCCACTTGG - Intronic
1003515798 6:6817764-6817786 TCTTCTCTGCATCAGGCCATAGG + Intergenic
1006556038 6:34867725-34867747 AGTTCTCTCCAGCAGCCATTAGG + Intronic
1008199733 6:48571545-48571567 TGTTCTCTGAAGCTGGGGCTAGG - Intergenic
1010374493 6:75150929-75150951 TTTTTTCTGCAGCAGACATTTGG + Intronic
1010622674 6:78096108-78096130 TGTTCTCTGATGCAGGAAGTGGG - Intergenic
1013825289 6:114203890-114203912 TTTTCTGTGCAGCAGGCAAGAGG + Intronic
1014083640 6:117316551-117316573 TGTGCACTGCTCCAGGCACTGGG + Intronic
1014534059 6:122595676-122595698 TGGTCTCTGCTGCTGGCAATTGG + Intronic
1015376155 6:132512875-132512897 TGCGCTCTGCAGCAGGCACTCGG - Intronic
1016304899 6:142673602-142673624 TATTCTGTGGATCAGGCACTGGG - Intergenic
1017414772 6:154208056-154208078 TGCTCTGTGCAACAGACACTGGG - Intronic
1017641357 6:156497417-156497439 TTTACTCTGCTGCAGGCACTGGG + Intergenic
1017978369 6:159377045-159377067 TGTTCTCTGCACAGGGCACCCGG - Intergenic
1018340846 6:162849420-162849442 CTTTCTCAGCAGCAGGCACTGGG - Intronic
1018910681 6:168099616-168099638 TGTTCTCTGCAGGATGCAGCAGG - Intergenic
1019183169 6:170205344-170205366 TGTTCTCAGCCTGAGGCACTCGG + Intergenic
1019668175 7:2263189-2263211 TGTTCTCTGGAACAGGCGCCTGG + Intronic
1020057180 7:5125911-5125933 CGTTTTCTGCAGCAGAAACTTGG + Intergenic
1020170731 7:5842993-5843015 CGTTTTCTGCAGCAGAAACTTGG - Intergenic
1021738342 7:23660808-23660830 TGTTATCTGCAGGAGGAATTGGG - Intergenic
1022858423 7:34339951-34339973 TGTTCTCTGCAGGAAGCAGGAGG + Intergenic
1022969769 7:35506058-35506080 CTTACTCTGCAGCAGGCACCAGG + Intergenic
1023125211 7:36948392-36948414 TCATCTATGCACCAGGCACTTGG + Intronic
1023494897 7:40784591-40784613 TCTTTTCTGTAGCAGGGACTGGG + Intronic
1026632769 7:72052422-72052444 TGTTTACTCCAGCAGGCTCTGGG + Intronic
1027647233 7:80817767-80817789 AGTTCTTTTCAGCAGACACTTGG + Intronic
1028720865 7:94029644-94029666 TGTTCTCTACAGAAGGCAAATGG - Intergenic
1031514454 7:122684853-122684875 ATTCCTCTGCAGCAGGCCCTTGG - Intronic
1031965539 7:128025648-128025670 CCTCCTCTGTAGCAGGCACTTGG - Intronic
1032128159 7:129209488-129209510 TGCTGTCTGCAGCAGGGACCTGG - Intronic
1032319621 7:130874233-130874255 TGTTCTCAGCAGCAAGCAGCTGG + Intergenic
1033032688 7:137843156-137843178 TCTTCTATGCAACAGGCACTGGG - Intronic
1033586517 7:142778684-142778706 GGTGCTCAGCAGCAGGGACTGGG + Intergenic
1033626182 7:143111887-143111909 TGTTATCTGCAGAAGTAACTGGG - Intergenic
1034672824 7:152870899-152870921 GGGTCTCTGCAGCAGGATCTGGG + Intergenic
1034672836 7:152870951-152870973 GGGTCTCTGCAGCAGGATCTGGG + Intergenic
1034672848 7:152871003-152871025 GGGTCTCTGCAGCAGGATCTGGG + Intergenic
1034672860 7:152871055-152871077 GGGTCTCTGCAGCAGGATCTGGG + Intergenic
1035373395 7:158393038-158393060 CCTTCTCTGCAGCAGGCACAGGG - Intronic
1035827384 8:2659529-2659551 TGTTTTCTGCAGCGGGTACAGGG + Intergenic
1036012988 8:4748905-4748927 GGTTCTCTGCTGCAGACACTGGG + Intronic
1037997811 8:23366327-23366349 TGTTCTCTGCAGCTTGCTCTGGG - Intronic
1042403106 8:68372388-68372410 TCTTCTCAGCAGGAGGGACTGGG - Intronic
1043960906 8:86417182-86417204 TGTTGTCAGCAGCGGGAACTGGG + Intronic
1045586154 8:103539595-103539617 TGCTCTGTGGAGCAGGCTCTTGG - Intronic
1046159061 8:110335107-110335129 TGGTTCCTGTAGCAGGCACTGGG + Intergenic
1046704246 8:117433307-117433329 TGCTCTGTTCAGCAGGCTCTAGG + Intergenic
1046868487 8:119177287-119177309 TTTTCTCTGTGCCAGGCACTAGG + Intronic
1047306193 8:123654915-123654937 TCTTCTCTGGAGCAGCCCCTGGG + Intergenic
1047567179 8:126058131-126058153 TGTTCACTGCTACAGGCTCTTGG + Intergenic
1048527120 8:135213349-135213371 AGTTGGCTGCAGCAGGCTCTTGG - Intergenic
1048553225 8:135453388-135453410 TGACCTCTGGACCAGGCACTGGG + Intergenic
1048938722 8:139378151-139378173 TTTACTCTGAAGCTGGCACTTGG + Intergenic
1048964837 8:139608001-139608023 TCTTCTAGCCAGCAGGCACTGGG - Intronic
1053150860 9:35741800-35741822 TGTCCTCCGCAGCTGGAACTGGG - Exonic
1053346585 9:37382844-37382866 TGTTTTCTGCAGGAGGCCCTGGG - Intergenic
1054990200 9:71316676-71316698 TGTTCCCTTCTGCAGGCTCTGGG - Intronic
1055141043 9:72877269-72877291 TGTTATCTACAGGAGTCACTGGG + Intergenic
1055729833 9:79268996-79269018 TGTTCCCTGCAAGAGGCACTAGG + Intergenic
1055852135 9:80644604-80644626 TGTTCTGTGCAGCAAGCAGGAGG - Intergenic
1055969831 9:81900649-81900671 AGAGCTATGCAGCAGGCACTGGG - Intergenic
1056033882 9:82583721-82583743 TGCTCTGTGCAGCATGCACTTGG + Intergenic
1056798930 9:89677995-89678017 TGTTCTCTGGAGCAGGCAGCAGG + Intergenic
1058932801 9:109738268-109738290 AGTTCTCAGCGGCAGGCTCTGGG - Intronic
1058952576 9:109917244-109917266 TGTTCCCTTCTGCAGGCTCTAGG - Intronic
1203366416 Un_KI270442v1:262010-262032 TGTTTTGTGGAGCAGGCACTAGG + Intergenic
1187087041 X:16051463-16051485 TGTTATCTGCAGGAGCAACTGGG + Intergenic
1189305293 X:39982353-39982375 TGTTCTCTGCAGGTAGGACTGGG - Intergenic
1192035969 X:67563449-67563471 TGTACTATGCACCAGGCCCTGGG - Intronic
1194543563 X:95204731-95204753 AGTTATCTGCAGCAGGAACATGG - Intergenic
1195722613 X:107880626-107880648 TGTTATCTGCAGGAGTAACTGGG + Intronic
1198314091 X:135449637-135449659 TGTCCACAGCAGCAGCCACTGGG - Intergenic
1198486559 X:137093082-137093104 TGTTCTCTTCTACTGGCACTTGG + Intergenic
1199712951 X:150484735-150484757 TTTTGTTTGCAGCAGGGACTTGG - Intronic