ID: 1002579537

View in Genome Browser
Species Human (GRCh38)
Location 5:180199358-180199380
Sequence CAGGATCCGGTCAGTGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002579537_1002579540 -8 Left 1002579537 5:180199358-180199380 CCTTCATCACTGACCGGATCCTG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1002579540 5:180199373-180199395 GGATCCTGGATATTAAAATAAGG No data
1002579537_1002579542 1 Left 1002579537 5:180199358-180199380 CCTTCATCACTGACCGGATCCTG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1002579542 5:180199382-180199404 ATATTAAAATAAGGCCAGAAAGG 0: 1
1: 0
2: 2
3: 48
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002579537 Original CRISPR CAGGATCCGGTCAGTGATGA AGG (reversed) Intronic
906165592 1:43683783-43683805 CAGGAGTGTGTCAGTGATGATGG + Exonic
911946551 1:104116618-104116640 AAGGATGCGGTCAGTAGTGAAGG - Intergenic
912565301 1:110583403-110583425 CAGAATGCTGTCAGTGACGAAGG + Intergenic
912587886 1:110783438-110783460 CAGGAAAAGGGCAGTGATGAAGG - Intergenic
918479174 1:184959138-184959160 CAGGATCAGTTCAGAAATGAGGG - Intronic
923723151 1:236484300-236484322 CACCACCAGGTCAGTGATGAAGG - Intronic
923778680 1:237002147-237002169 CAGCAACAGGTCAGTGATGAAGG - Intergenic
1062848812 10:727801-727823 CAGGATATGCTCAGGGATGATGG - Intergenic
1067828143 10:49594167-49594189 CAGCAGCCGGTCTGAGATGAGGG + Intergenic
1068112806 10:52700276-52700298 CAGGACCCTTTCAATGATGATGG - Intergenic
1075665303 10:124225530-124225552 CAGGATCCTGGCAGTGTTCATGG + Intergenic
1075706037 10:124501632-124501654 CTGGAACTGGACAGTGATGATGG + Intronic
1076501255 10:130937976-130937998 CAAGTTCCGGTCAGTCCTGATGG - Intergenic
1078081537 11:8207749-8207771 CAGGATAGGGACAGGGATGACGG - Intergenic
1078518452 11:12044879-12044901 CAGGCTACGGTCAGGGGTGAGGG - Intergenic
1084117164 11:67049156-67049178 GAGGATCTGCTCAGTGCTGATGG + Exonic
1089437419 11:118482084-118482106 CAGAATCAGGTGAGTGAGGAGGG + Exonic
1091395261 12:150478-150500 CAGTTTCAGGTCAGTGAGGAGGG + Intronic
1092229139 12:6767026-6767048 CGGGATCCGGTCAGCGAGGTGGG - Intronic
1100373930 12:93994836-93994858 CAGGATCTGGGCAGGGTTGAGGG - Intergenic
1100869069 12:98892128-98892150 CAGCATCTGGTCAGAAATGAGGG + Intronic
1108487711 13:50943829-50943851 CAGGGTCTGGACACTGATGAGGG + Intronic
1108594467 13:51937774-51937796 CTGGGTCCAGTCAGTGATGTTGG + Intronic
1113558479 13:111257617-111257639 CAGAATCAGGTGAGTGATCACGG + Intronic
1114523062 14:23351004-23351026 GAGCATCTGGTCAGTGGTGAAGG + Intronic
1116339954 14:43709703-43709725 CAGAATGCGGTCAGAAATGATGG - Intergenic
1119738068 14:76996602-76996624 CAGGACCTGGGCAGTGCTGATGG + Intergenic
1119778965 14:77265724-77265746 CAGGAGCGGGTTGGTGATGAAGG + Exonic
1122303788 14:100748503-100748525 CATGATCAGGTCACTGAGGAAGG + Intergenic
1124184964 15:27516986-27517008 CACGATGCTGTCAGTGATGGAGG - Intronic
1125610276 15:40964787-40964809 CAGGAGGCAGGCAGTGATGAGGG + Intergenic
1126476186 15:49067854-49067876 CAGGAACTGGATAGTGATGATGG - Intergenic
1127329286 15:57922974-57922996 CAGGATCAGCTCAGGGAGGAGGG + Intergenic
1136374393 16:29856780-29856802 CAGGAGCCAGTCAGGGATGTGGG + Intergenic
1138347470 16:56328817-56328839 CTGGAGCCGGGCAGTGATGCGGG + Intronic
1138577940 16:57920481-57920503 CTGGAGCCGGTCGTTGATGATGG + Exonic
1139360776 16:66398418-66398440 CAGGAGATGGTCAGTGATGGTGG - Intronic
1140766443 16:78163781-78163803 CAGGATCTGGTCATTATTGATGG + Intronic
1148767359 17:50047043-50047065 CAGGATGAGGGCAATGATGAAGG - Intergenic
1148836875 17:50470024-50470046 CAGGATATTGTCTGTGATGAGGG + Intronic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1157175558 18:45448954-45448976 CAGATTCCGGTCAGTGATCCTGG - Intronic
1160687069 19:442050-442072 CAGGACCTGGGCTGTGATGACGG + Intronic
1167166912 19:47804702-47804724 CAGTACCTGATCAGTGATGAAGG - Intronic
1167174925 19:47859062-47859084 CAGTACCTGATCAGTGATGAGGG + Intergenic
925305534 2:2845900-2845922 AAGGATCCTGTCAGAGAGGAGGG - Intergenic
926250003 2:11149797-11149819 CAGGATCCAGTCAAGGATCACGG - Intergenic
928664149 2:33533717-33533739 CAGGAACCGGTCAGAAATCAGGG - Intronic
933159998 2:79013379-79013401 CAGGCTCTGGCCAGTGATGAAGG - Intergenic
934179807 2:89610708-89610730 CAAGACCCTGTCAGTGATCATGG - Intergenic
934780851 2:96968715-96968737 CAAGAGCAGGACAGTGATGAGGG - Intronic
939998913 2:148947817-148947839 CAGCATGATGTCAGTGATGATGG - Intronic
948355404 2:237373543-237373565 CAGGATACAGTGGGTGATGAGGG - Intronic
1173023861 20:39289758-39289780 CAGGCTCAGATCAGAGATGAGGG - Intergenic
1181163646 22:20972056-20972078 CAGCACCTGGTTAGTGATGAAGG + Intronic
1182252190 22:29009871-29009893 CTGGAGATGGTCAGTGATGATGG - Intronic
1182280314 22:29214570-29214592 CAAGAGCCAGGCAGTGATGATGG + Intronic
1184445460 22:44544510-44544532 CAGGATCAAGGTAGTGATGAGGG + Intergenic
950409271 3:12824475-12824497 CAGGAGTGGGTCAGTGATCATGG - Intronic
951376632 3:21926287-21926309 CTGGGTCCTGTCAGGGATGAGGG - Intronic
954476381 3:50750208-50750230 CAGGGCCAGGTCAGGGATGAGGG - Intronic
962317164 3:134366079-134366101 TAGGATCCCCTCAGGGATGATGG - Intronic
962386463 3:134936402-134936424 CCGGCTCCGGGCAGTGATGGAGG + Intronic
964236773 3:154540167-154540189 AAGGAACAAGTCAGTGATGATGG - Intergenic
964309387 3:155376446-155376468 CAGGATGCAGTCAGTCTTGAAGG - Intronic
965398219 3:168186451-168186473 GAGGATCCGCTCAGTGAGTATGG + Intergenic
967230794 3:187335701-187335723 AAGGATAGGGTCAGTGCTGAAGG + Intergenic
971363747 4:25959528-25959550 CAGAATCCAGTCAGTCATGGTGG + Intergenic
975940860 4:79644080-79644102 CAGGATCCTTACAGTCATGACGG + Intergenic
981127186 4:141120315-141120337 CAGGAAACGGTGACTGATGATGG + Intronic
984905755 4:184624485-184624507 CAGAAACAGGTCAGTGATGGAGG - Intergenic
984905759 4:184624515-184624537 CAGAAACAGGTCAGTGATGGAGG - Intergenic
984905763 4:184624545-184624567 CAGAAACAGGTCAGTGATGGAGG - Intergenic
984905767 4:184624575-184624597 CAGAAACAGGTCAGTGATGGAGG - Intergenic
984905771 4:184624605-184624627 CAGAAACAGGTCAGTGATGGAGG - Intergenic
984905775 4:184624635-184624657 CAGAAACAGGTCAGTGATGGAGG - Intergenic
985999189 5:3616758-3616780 CAGGGTCCGGGCAGTGGTGATGG - Intergenic
987115617 5:14724496-14724518 AAGGATCAGTGCAGTGATGAAGG + Intronic
987976229 5:25018523-25018545 CAGGATCCTGCAAGTGAAGAGGG - Intergenic
989360687 5:40598069-40598091 GAGGACTCAGTCAGTGATGATGG + Intergenic
994287381 5:97985716-97985738 AATGATCTGGACAGTGATGATGG - Intergenic
996555626 5:124776337-124776359 CAGGATGCTGGCAGTGAAGAGGG + Intergenic
997064583 5:130546301-130546323 CAGGACCGGGGCAGTAATGAGGG + Intergenic
998503165 5:142651200-142651222 CAGGCTCCCGTGGGTGATGAAGG - Intronic
1002044379 5:176533705-176533727 CTGCCTCCGGTCAGAGATGAGGG + Intronic
1002269035 5:178057678-178057700 CTTGATCCGGTCAGTTATTATGG + Intergenic
1002579537 5:180199358-180199380 CAGGATCCGGTCAGTGATGAAGG - Intronic
1003419061 6:5939413-5939435 CTGGAGCAGGTCAGTGATGCTGG + Intergenic
1005702262 6:28413849-28413871 CAGGATCAGGTCAGTCAAGCAGG - Intergenic
1005992676 6:30913325-30913347 CCGGATCTGGTCGGTGATGGTGG - Exonic
1006241976 6:32690147-32690169 CAAGATCCAGTCAGTAGTGAAGG + Intergenic
1006335586 6:33418885-33418907 CAGGATGGGGACAGTGGTGATGG + Intergenic
1010410652 6:75557710-75557732 CAGCATCCGTTCATTCATGATGG - Intergenic
1017112087 6:150941554-150941576 CAGGATGGGGGCAGTGAGGATGG + Intronic
1023039708 7:36161412-36161434 CAGCATTCGGTCAGGGATGAAGG + Intronic
1023329124 7:39095113-39095135 AAGGATCCTCTCAGTTATGAGGG + Intronic
1023868729 7:44251577-44251599 CAGGATCCGGGCAGTGATTTTGG - Intronic
1024981850 7:55163874-55163896 CAGAAGCCGAACAGTGATGATGG + Intronic
1033172516 7:139096476-139096498 CAGGATCCTGTGAGTGACAAAGG + Intronic
1049037517 8:140087868-140087890 CAGGACCTTGTCAGTGATGGTGG - Intronic
1049715034 8:144085782-144085804 GAGGGTGCGGTCTGTGATGAGGG - Intronic
1052856143 9:33407867-33407889 CAGGATTTGGGCAGAGATGAGGG - Intergenic
1057444731 9:95105599-95105621 CAGGAGACGGCCAGTGCTGATGG - Intronic
1061019978 9:128008097-128008119 CAGGCTCCGGTGAGGGAAGAGGG + Intergenic
1190266687 X:48831243-48831265 CGGGATCCGGGCAGTGCTCAGGG + Exonic
1192262898 X:69518176-69518198 CATGGTCCAGACAGTGATGATGG + Intronic
1195290291 X:103425643-103425665 CATGATTCTGACAGTGATGAGGG + Intergenic
1196725161 X:118888987-118889009 CAGGACCGGGGCAGTAATGAGGG - Intergenic
1197161509 X:123327880-123327902 AAGAATCAGGTCAGTGATGTTGG + Intronic